DUET Question Paper 2019 for M.Sc Botany

DU MSc Botany

Topic:- DU_J19_MSC_BOT

1) Which of the following statements on filiform apparatus is not correct?

[Question ID = 2404]

1. It determines the polarity of the egg apparatus. [Option ID = 9616]
2. It is a highly convoluted extension of the micropylar portion of the synergid wall. [Option ID = 9613]
3. It increases the surface area of the plasma membrane of synergids. [Option ID = 9614]
4. It controls pollen tube growth. [Option ID = 9615]

It is a highly convoluted extension of the micropylar portion of the synergid wall. [Option ID = 9613]

2) Which of the following statements is not correct about aquaporins?

[Question ID = 2413]

1. Phosphorylation and calcium concentration regulates aquaporin activity. [Option ID = 9650]
2. Aquaporins cannot transport uncharged molecules like NH3. [Option ID = 9652]
3. Aquaporins are found in both plant and animal cell membranes. [Option ID = 9649]
4. Activity of aquaporin is regulated by pH and reactive oxygen species. [Option ID = 9651]

Aquaporins are found in both plant and animal cell membranes. [Option ID = 9649]

3) Which of the following statements is NOT correct about Gnetum?
[Question ID = 2368]

1. Tapetal layer is completely absent in the microsporangium. [Option ID = 9470]
2. There are no distinct archegonia, and some free nuclei of the female gametophyte function as eggs.
[Option ID = 9472]
3. The female gametophyte is formed before fertilization. [Option ID = 9471]
4. The secondary wood contains vessels. [Option ID = 9469]

The secondary wood contains vessels. [Option ID = 9469]

4) Which of the following statement is not true about lenticels?

[Question ID = 2371]

1. They are formed by the higher activity of phellogen in some limited areas of the periderm [Option ID =
9481]
2. They start appearing during the early stages of primary growth [Option ID = 9484]
3. They are found in stems as well as roots [Option ID = 9483]
4. They permit the entry of air through the peridem [Option ID = 9482]

They are formed by the higher activity of phellogen in some limited areas of the periderm [Option ID =
9481]

5) Which of the following is not true about the classic experiment carried out to study the nature
of mutations by the 1969 Nobel prize-winning team of Max Luria and Salvador Delbruck?

[Question ID = 2392]

1. Equal number of T1 phage resistant colonies were obtained in all the plates. [Option ID = 9568]
2. It demonstrated that genetic mutations arise in the absence of selection, and not as a response to
selection. [Option ID = 9566]
3. It is also called as Fluctuation Test [Option ID = 9565]
4. They inoculated equal number of .E coli into separate culture tubes with and without T1 phage. [Option ID
= 9567]

It is also called as Fluctuation Test [Option ID = 9565]

6) Which of the following chemical substances are secreted by some animals for communication
with other members of their species?

[Question ID = 2401]

1. Terpenoids [Option ID = 9603]
2. Pheromones [Option ID = 9604]
3. Alkaloids [Option ID = 9601]
4. Phenols [Option ID = 9602]

Alkaloids [Option ID = 9601]

7) Which of the following is the regulatory body conferring approval for transgenic plants?

[Question ID = 2431]

1. NBRI [Option ID = 9724]
2. GEAC [Option ID = 9723]
3. NBPGR [Option ID = 9721]
4. NBA [Option ID = 9722]

NBPGR [Option ID = 9721]

8) Which of the following parts is not observed in a mature seed-coat?

[Question ID = 2407]

1. Aril [Option ID = 9628]
2. Epidermis [Option ID = 9625]
3. Aerenchyma [Option ID = 9626]
4. Hypodermis [Option ID = 9627]

Epidermis [Option ID = 9625]

9) Which type of wood is found in Pinus and Cycas ?
[Question ID = 2367]

1. Manoxylic in Pinus
, and pycnoxylic in Cycas [Option ID = 9466]
2. Manoxylic in both [Option ID = 9468]
3. Pycnoxylic in both [Option ID = 9467]
4. Pycnoxylic in Pinus
, and manoxylic in Cycas [Option ID = 9465]
Pycnoxylic in Pinus, and manoxylic in Cycas [Option ID = 9465]

10) Which one of the following is the most primitive basal angiosperm?

[Question ID = 2434]

1. Nymphaea [Option ID = 9734]
2. Hibiscus [Option ID = 9736]
3. Amborella [Option ID = 9733]
4. Magnolia [Option ID = 9735]
Amborella [Option ID = 9733]

11) Which one of the following sets of compounds is used as biopesticides?

[Question ID = 2384]

1. Pyrethrin, Azadirachtin, Spilanthol [Option ID = 9533]
2. Pyrethrin, Jatrophine, Curcumin [Option ID = 9535]
3. Capsaicin, Citronella oil, Piperine [Option ID = 9536]
4. Azadirachtin, Taxol, Curcumin [Option ID = 9534]

Pyrethrin, Azadirachtin, Spilanthol [Option ID = 9533]

12) Which one of the following statements about cDNA libraries is not correct?

[Question ID = 2428]

1. They can be used to study quantitative variations in gene expressions levels between different tissues
[Option ID = 9711]
2. They can be used to analyse variations in gene expression patterns between different developmental stages
of a plant [Option ID = 9712]
3. They can be used to study alternatively spliced forms of a gene [Option ID = 9710]
4. They are generally composed of larger fragments as compared to genomic DNA libraries [Option ID =
9709]

They are generally composed of larger fragments as compared to genomic DNA libraries [Option ID =
9709]

13) Which one of the following statements is not correct?

[Question ID = 2436]

1. Keys are based on phylogeny. [Option ID = 9744]
2. In a taxonomic key, the two leads together comprise a couplet. [Option ID = 9743]
3. All keys comprise sequence of two contrasting statements, each statement is known as a lead. [Option ID
= 9742]
4. All taxonomic keys are dichotomous. [Option ID = 9741]

All taxonomic keys are dichotomous. [Option ID = 9741]

14) Which one of the following statements is not true?

[Question ID = 2444]

1. Cremocarp is characterstic fruit of Apiaceae [Option ID = 9776]
2. Cypsela is characteristic fruit of Poaceae [Option ID = 9775]
3. Verticillaster is the characteristic inflorescence of Lamiaceae. [Option ID = 9774]
4. The grouping of taxa by overall similarity is called phenetics. [Option ID = 9773]

The grouping of taxa by overall similarity is called phenetics. [Option ID = 9773]

15) Which one of the following statements is not true for aposporous embryo sac development?

[Question ID = 2408]

1. Three megaspores degenerate while functional haploid megaspore undergoes megagametogenesis. [Option
ID = 9630]
2. All the four megaspores degenerate while an aposporous initial forms the embryo sac. [Option ID = 9631]
3. Tetrad is surrounded by a callose wall. [Option ID = 9632]
4. The first and second meiotic divisions result in a tetrad of megaspores. [Option ID = 9629]

The first and second meiotic divisions result in a tetrad of megaspores. [Option ID = 9629]

16) Which one of the following statements is false for a population that is under natural
selection?

[Question ID = 2388]

1. At a given point of time, the sum total of all genotypic frequencies is equal to 1. [Option ID = 9552]
2. At a given point of time for any given bi-allelic gene, the sum of the allele frequencies would be equal to
one. [Option ID = 9551]
3. The genotypic frequencies can be estimated if the allele frequencies are known. [Option ID = 9550]
4. The population will not exhibit Hardy-Weinberg equilibrium. [Option ID = 9549]

The population will not exhibit Hardy-Weinberg equilibrium. [Option ID = 9549]

17) Which one of the following statements is not correct?

[Question ID = 2363]

1. In bryophytes, meiosis occurs in the gametangia to produce sperms and eggs [Option ID = 9449]
2. Amphigastria are found in Porella
[Option ID = 9451]
3. In Anthoceros,each cell contains single large chloroplast with a pyrenoid [Option ID = 9450]
4. In Funaria,
the dominant stage of life cycle is gametophytic [Option ID = 9452]

In bryophytes, meiosis occurs in the gametangia to produce sperms and eggs [Option ID = 9449]

18) Which one of the following is not a constituent of an ayurvedic herbal formulation, ‘Trifala’?

[Question ID = 2381]

1. Emblica officinalis [Option ID = 9524]
2. Terminalia bellerica [Option ID = 9521]
3. Terminalia arjuna [Option ID = 9522]
4. Terminalia officinalis [Option ID = 9523]
Terminalia bellerica [Option ID = 9521]

19) Which one of the following is not a member of Poaceae?

[Question ID = 2440]

1. Hordeum vulgare [Option ID = 9757]
2. Triticum aestivum [Option ID = 9758]
3. Secale cereale [Option ID = 9760]
4. Cynodon dactylon [Option ID = 9759]
Hordeum vulgare [Option ID = 9757]

20) Which one of the following is not found in Marchantia ?
[Question ID = 2365]

1. Barrel shaped epidermal pores in the thallus [Option ID = 9458]
2. Smooth walled as well as tuberculated rhizoids [Option ID = 9457]
3. Filamentous protonema [Option ID = 9460]
4. Elaters [Option ID = 9459]

Smooth walled as well as tuberculated rhizoids [Option ID = 9457]

21) Which one of the following contributes to the formation of peatlands?

[Question ID = 2362]

1. Sphagnum [Option ID = 9448]
2. Riccia [Option ID = 9445]
3. Porella [Option ID = 9446]
4. Cooksonia [Option ID = 9447]

Riccia [Option ID = 9445]

22) Which one of the following crops was the first to have its nuclear genome sequenced?

[Question ID = 2429]

1. Maize [Option ID = 9713]
2. Barley [Option ID = 9716]
3. Rice [Option ID = 9715]
4. Wheat [Option ID = 9714]

Maize [Option ID = 9713]

23) Which one of the following is considered to be a signal metabolite that regulates the
partitioning between sucrose and starch synthesis?

[Question ID = 2423]

1. Fructose 6-phosphate [Option ID = 9691]
2. Fructose 2-phosphate [Option ID = 9692]
3. Fructose-2, 6-bisphosphate [Option ID = 9689]
4. Fructose-1, 6-bisphosphate [Option ID = 9690]

Fructose-2, 6-bisphosphate [Option ID = 9689]

24) Which one of the following is an incorrect combination?

[Question ID = 2383]

1. Diospyros melanoxylon – Indian beedi [Option ID = 9530]
2. Cichorium intybus – khus-khus [Option ID = 9532]
3. Pongamia pinnata – biodiesel [Option ID = 9531]
4. Betula bhojpatra – bhojpatra [Option ID = 9529]
Betula bhojpatra – bhojpatra [Option ID = 9529]

25) Which one of the following genes does not confer resistance to a herbicide?

[Question ID = 2427]

1. ALS [Option ID = 9707]
2. nptII [Option ID = 9708]
3. EPSPS [Option ID = 9705]
4. pat [Option ID = 9706]
EPSPS [Option ID = 9705]

26) Which series is not included in the Gamopetalae in Bentham and Hooker’s system of
classification?

[Question ID = 2442]

1. Inferae [Option ID = 9765]
2. Heteromerae [Option ID = 9766]
3. Bicarpoellatae [Option ID = 9767]
4. Thalamiflorae [Option ID = 9768]

Inferae [Option ID = 9765]

27) Algae that grow at the interface of water and atmosphere are called as [Question ID =
2349]

1. epipelic [Option ID = 9393]
2. benthic [Option ID = 9396]
3. planktonic [Option ID = 9395]
4. neustonic [Option ID = 9394]

epipelic [Option ID = 9393]

28) In non-graminaceous plant roots, iron is transported across the plasma membrane as

[Question ID = 2417]

1. Both ferrous and ferric ions [Option ID = 9665]
2. Ferrous ions [Option ID = 9667]
3. Ferric ions [Option ID = 9668]
4. Fe-Chelate [Option ID = 9666]

Both ferrous and ferric ions [Option ID = 9665]

29) In root nodules of legumes, leg-haemoglobin is important because it

[Question ID = 2415]

1. transports oxygen to the root nodule. [Option ID = 9657]
2. acts as a catalyst in transamination. [Option ID = 9660]
3. acts as an oxygen scavenger. [Option ID = 9658]
4. provides energy to the nitrogen fixing bacterium. [Option ID = 9659]

transports oxygen to the root nodule. [Option ID = 9657]

30) Hygroscopic fibers located in the reaction wood are termed as [Question ID = 2376]

1. fiber-tracheids [Option ID = 9504]
2. libriform fibers [Option ID = 9502]
3. gelatinous fibers [Option ID = 9503]
4. substitute fibers [Option ID = 9501]

substitute fibers [Option ID = 9501]

31) Three-dimensional structures of a cell can be studied by using which of the following
microscopes? [Question ID = 2348]

1. Fluorescent [Option ID = 9391]
2. Phase contrast [Option ID = 9390]
3. Differential interference contrast [Option ID = 9392]
4. Bright field [Option ID = 9389]

Bright field [Option ID = 9389]

32) Buzz pollination is associated with flowers, wherein the anthers exhibit

[Question ID = 2411]

1. poricidal dehiscence. [Option ID = 9643]
2. explosive dehiscence. [Option ID = 9644]
3. longitudinal dehiscence. [Option ID = 9641]
4. valvular dehiscence. [Option ID = 9642]

longitudinal dehiscence. [Option ID = 9641]

33) A distribution in which individuals within a population have an equal chance of living
anywhere within an area is called as

[Question ID = 2400]

1. Random. [Option ID = 9597]
2. Contiguous. [Option ID = 9600]
3. Regular. [Option ID = 9598]
4. Clumped. [Option ID = 9599]

Random. [Option ID = 9597]

34) The term ‘Glabrous’ refers to [Question ID = 2373]

1. sparsely hairy. [Option ID = 9491]
2. lack of trichomes. [Option ID = 9489]
3. presence of glandular trichomes. [Option ID = 9492]
4. presence of bristly hair. [Option ID = 9490]

lack of trichomes. [Option ID = 9489]

35) Identify the incorrect combination from the following:

[Question ID = 2432]

1. Somaclonal variation – F.C. Steward [Option ID = 9727]
2. GUS reporter system – R.A. Jefferson [Option ID = 9728]
3. Protoplast – E.C. Cocking [Option ID = 9725]
4. Edible vaccine – C.J. Arntzen [Option ID = 9726]

Protoplast – E.C. Cocking [Option ID = 9725]

36) Two different DNA molecules were isolated from a bacterial sample. Further experiments
demonstrated that one of these (X) was composed of 40%A, 40%G, 10%T and 10%C but could
not be cut by an exonuclease. The second DNA sample (Y) could be cut by the exonuclease and
was found to be composed of 30%A, 30%T, 20%G and 20%C. Which one of the following
statements can be correctly deduced from the above?

[Question ID = 2424]

1. DNA Y has a double-stranded and circular structure [Option ID = 9694]
2. DNA X has a single-stranded and linear structure [Option ID = 9695]
3. DNA X has a single-stranded and circular structure [Option ID = 9696]
4. DNA X has a double-stranded and linear structure [Option ID = 9693]

DNA X has a double-stranded and linear structure [Option ID = 9693]

37) A binomial in which the genus name and specific epithet are identical in spelling is called

[Question ID = 2439]

1. Autonym [Option ID = 9753]
2. Basionym [Option ID = 9756]
3. Tautonym [Option ID = 9754]
4. Synonym [Option ID = 9755]

Autonym [Option ID = 9753]

38) A plant heterozygous for two tightly linked genes A and B, has the genotype AB/ab. Which
of the following statements is true when the plant is self-pollinated?

[Question ID = 2393]

1. Both loci will segregate in a 3:1 ratio. [Option ID = 9571]
2. Gametes with genotype AB and ab will be less than those with aB and Ab. [Option ID = 9570]
3. The percentage of all the four types of gametes (AB, ab, Ab, aB) would be equal. [Option ID = 9569]
4. The segregation ratio of the two genes will depend upon the distance between them. [Option ID = 9572]

The percentage of all the four types of gametes (AB, ab, Ab, aB) would be equal. [Option ID = 9569]

39) The study of man-made areas with complex, dynamic ecological systems, influenced by
interconnected biological, physical and social components is called as [Question ID = 2397]

1. Social Ecology. [Option ID = 9588]
2. Ecosystem Ecology. [Option ID = 9586]
3. Urban Ecology. [Option ID = 9587]
4. System Ecology. [Option ID = 9585]

System Ecology. [Option ID = 9585]

40) In a pollen wall, the following enzymes serve as markers for intine and exine, respectively.

[Question ID = 2410]

1. Acid phosphatases and esterases [Option ID = 9637]
2. Pectinases and catalases [Option ID = 9638]
3. Kinases and β-1,3 glucanase [Option ID = 9640]
4. Lipases and cutinases [Option ID = 9639]

Acid phosphatases and esterases [Option ID = 9637]

41) In a population of diploid individuals, six alleles exist for a particular gene. What is the
expected number of alleles present in a chromosome; and types of alleles in a heterozygous
individual and in a homozygous individual respectively?

[Question ID = 2387]

1. 2; 2, 1 [Option ID = 9546]
2. 2; 2, 1 [Option ID = 9548]
3. 1; 2, 1 [Option ID = 9547]
4. 1; 2, 2 [Option ID = 9545]

1; 2, 2 [Option ID = 9545]

42) Polysporangiate anthers are seen in the family

[Question ID = 2409]

1. Agavaceae. [Option ID = 9636]
2. Annonaceae. [Option ID = 9635]
3. Anacardiaceae. [Option ID = 9634]
4. Amborellaceae. [Option ID = 9633]

Amborellaceae. [Option ID = 9633]

43) Pfr shows maximum absorption at

[Question ID = 2416]

1. 650 nm. [Option ID = 9664]
2. 660 nm. [Option ID = 9662]
3. 466 nm. [Option ID = 9663]
4. 730 nm. [Option ID = 9661]

730 nm. [Option ID = 9661]

44) Hyperthermophiles are heat loving microbes that can live in temperature optima above

[Question ID = 2399]

1. 50 ⁰C [Option ID = 9594]
2. 60 ⁰C [Option ID = 9595]
3. 80 ⁰C [Option ID = 9593]
4. 40 ⁰C [Option ID = 9596]

80 ⁰C [Option ID = 9593]

45) Dolipore septum is a characteristic of [Question ID = 2356]

1. Zygomycetes. [Option ID = 9423]
2. Chytridiomycetes. [Option ID = 9424]
3. Basidiomycetes. [Option ID = 9421]
4. Ascomycetes. [Option ID = 9422]

Basidiomycetes. [Option ID = 9421]

46) PEP carboxylase activity in C4 and CAM plants is regulated by

[Question ID = 2419]

1. isomerization [Option ID = 9676]
2. carboxylation-decarboxylation [Option ID = 9675]
3. phosphorylation-dephosphorylation [Option ID = 9673]
4. oxidation-reduction [Option ID = 9674]

phosphorylation-dephosphorylation [Option ID = 9673]

47) A globular or hook-like intracellular structure formed by a biotrophic fungus/oomycete for
absorption of nutrients from the host is known as [Question ID = 2359]

1. sclerotium. [Option ID = 9433]
2. vesicle. [Option ID = 9434]
3. sporophore. [Option ID = 9436]
4. haustorium. [Option ID = 9435]

sclerotium. [Option ID = 9433]

48) Glucosinolates do not occur in

[Question ID = 2437]

1. Papaveraceae [Option ID = 9746]
2. Capparaceae [Option ID = 9747]
3. Brassicaceae [Option ID = 9745]
4. Fabaceae [Option ID = 9748]

Brassicaceae [Option ID = 9745]

49) Fruits of which of the following pair of plants possess aril?

[Question ID = 2382]

1. Litchi chinensis and Aegle marmelos [Option ID = 9525]
2. Litchi chinensis and Ananas cosmosus [Option ID = 9528]
3. Vitis vinifera and Aegle marmelos [Option ID = 9527]
4. Myristica fragrans and Litchi chinensis [Option ID = 9526]
Litchi chinensis and Aegle marmelos [Option ID = 9525]
50) Channel proteins that are located in the outer membrane of Gram-negative bacteria are
known as [Question ID = 2345]

1. barrels [Option ID = 9377]
2. murins [Option ID = 9378]
3. granules [Option ID = 9380]
4. porins [Option ID = 9379]

barrels [Option ID = 9377]

51) Orthorhombic crystals of calcium carbonate are known as [Question ID = 2350]

1. aragonite. [Option ID = 9397]
2. detritus. [Option ID = 9399]
3. calcite. [Option ID = 9398]
4. stromatolites. [Option ID = 9400]

aragonite. [Option ID = 9397]

52) Anabolic component of the carbohydrate metabolism includes which one of the following
processes?

[Question ID = 2421]

1. Glycogenolysis [Option ID = 9681]
2. Glyconeogenesis [Option ID = 9683]
3. Citric Acid Cycle [Option ID = 9682]
4. Uronic Acid Pathways [Option ID = 9684]

Glycogenolysis [Option ID = 9681]

53) Aleurone layer is rich in

[Question ID = 2385]

1. essential oils. [Option ID = 9537]
2. starch grains. [Option ID = 9539]
3. proteins. [Option ID = 9538]
4. dietary fibers. [Option ID = 9540]

essential oils. [Option ID = 9537]

54) Mesogenous stomata refers to stomata

[Question ID = 2372]

1. in which all the subsidiary cells have a common origin with guard cells. [Option ID = 9486]
2. having subsidiary cells that are indistinguishable from other epidermal cells. [Option ID = 9487]
3. having subsidiary cells that are aligned parallel to the long axis of the guard cells. [Option ID = 9488]
4. occurring in mesophytic plants. [Option ID = 9485]

occurring in mesophytic plants. [Option ID = 9485]

55) Vestures refer to [Question ID = 2377]

1. Plasmodesmatal connections between any wood elements [Option ID = 9507]
2. clogged hydathodes [Option ID = 9508]
3. resin droplets accumulated in the non-conducting vessel elements [Option ID = 9505]
4. wall ingrowths that impart sieve-like appearance to pits of the vessels [Option ID = 9506]

resin droplets accumulated in the non-conducting vessel elements [Option ID = 9505]

56) Dormant, tough, non-reproductive structure, produced by bacteria to tide over unfavourable
conditions is known as: [Question ID = 2347]

1. heterocyst [Option ID = 9388]
2. sclerotium [Option ID = 9386]
3. endospore [Option ID = 9385]
4. sporocarp [Option ID = 9387]

endospore [Option ID = 9385]

57) Gram-negative bacteria are more resistant to antibiotics than Gram-positive bacteria due to
the presence of [Question ID = 2346]

1. outer lipopolysaccharide layer. [Option ID = 9382]
2. peptidoglycan wall. [Option ID = 9381]
3. porin protein. [Option ID = 9383]
4. teichoic acid. [Option ID = 9384]

peptidoglycan wall. [Option ID = 9381]

58) In Lymnaea peregra , coiling behaviour is controlled by a single gene. Dextral coiling
behaviour is governed by dominant allele ‘D’ and sinistral coiling by recessive allele ‘d’. When a
cross is made using sinistral as female and dextral as male, all the snails are sinistral in F1 and
dextral in F2. Again in F3 a ratio of 3 dextral and 1 sinistral is observed. This kind of pattern is an
example of

[Question ID = 2390]

1. Epistasis [Option ID = 9560]
2. Cytoplasmic maternal inheritance [Option ID = 9558]
3. Cytoplasmic maternal effect [Option ID = 9559]

4. Mendelian inheritance [Option ID = 9557]

Mendelian inheritance [Option ID = 9557]

59) Study the following pedigree. What can be the possible inheritance pattern?

[Question ID = 2391]

1. Autosomal inheritance [Option ID = 9564]
2. X-linked inheritance [Option ID = 9561]
3. Y-linked inheritance [Option ID = 9562]
4. Mitochondrial inheritance [Option ID = 9563]

X-linked inheritance [Option ID = 9561]

60) Accessory cambia, the activity of which leads to formation of a series of cylinders of
secondary vascular tissues are found in [Question ID = 2378]

1. Asclepiadaceae [Option ID = 9512]
2. Chenopodiaceae [Option ID = 9509]
3. Apocynaceae [Option ID = 9511]
4. Bignoniaceae [Option ID = 9510]

Chenopodiaceae [Option ID = 9509]

61) In species where pollen matures and is released prior to the maturation and receptivity of
the gynoecium, the condition is called

[Question ID = 2435]

1. dichogamy [Option ID = 9739]
2. protoandry [Option ID = 9738]
3. protogyny [Option ID = 9737]
4. androdioecy [Option ID = 9740]

protogyny [Option ID = 9737]

62) The sexual fruiting body in Neurospora is called as [Question ID = 2358]
1. cleistothecium. [Option ID = 9429]
2. perithecium. [Option ID = 9431]
3. apothecium. [Option ID = 9432]

4. pseudothecium. [Option ID = 9430]

cleistothecium. [Option ID = 9429]

63) In the fine mapping of rII locus, Benzer was able to demonstrate intragenic recombination
in phages mainly because

[Question ID = 2389]

1. of the large number of phage progeny that could be screened. [Option ID = 9554]
2. phages have haploid genomes. [Option ID = 9556]
3. intragenic recombination occurs only in phages. [Option ID = 9553]
4. making crosses in phages is easier. [Option ID = 9555]

intragenic recombination occurs only in phages. [Option ID = 9553]

64) Blastozone refers to the [Question ID = 2375]

1. quiescent centre of Root Apical Meristem (RAM) [Option ID = 9500]
2. marginal meristem of growing leaves [Option ID = 9499]
3. meristematic region located in the rib zone of Shoot Apical Meristem (SAM) [Option ID = 9497]
4. intercalary meristem [Option ID = 9498]

meristematic region located in the rib zone of Shoot Apical Meristem (SAM) [Option ID = 9497]

65) The number of nucleosomes associated with one turn of solenoid configuration of chromatin
is [Question ID = 2355]

1. 6 [Option ID = 9419]
2. 2 [Option ID = 9417]
3. 8 [Option ID = 9420]
4. 4 [Option ID = 9418]

2 [Option ID = 9417]

66) Lloyd Botanical Garden is located at

[Question ID = 2441]

1. Ootacamund [Option ID = 9762]
2. Srinagar (Kashmir) [Option ID = 9763]
3. Dehra Dun [Option ID = 9764]
4. Darjeeling [Option ID = 9761]

Darjeeling [Option ID = 9761]

67) Similarity resulting from common ancestry is called

[Question ID = 2433]

1. convergence [Option ID = 9732]
2. homology [Option ID = 9730]
3. homoplasy [Option ID = 9729]
4. homonym [Option ID = 9731]

homoplasy [Option ID = 9729]

68) Fluorochromatic reaction test to ascertain pollen viability was developed by

[Question ID = 2412]

1. J. Heslop-Harrison. [Option ID = 9647]
2. E. Strasburger. [Option ID = 9646]
3. S.G. Nawaschin. [Option ID = 9648]
4. P. Maheshwari. [Option ID = 9645]

P. Maheshwari. [Option ID = 9645]

69) In Pellia, the sporogenous tissue develops from the [Question ID = 2364]
1. amphithecium. [Option ID = 9454]
2. endothecium. [Option ID = 9455]
3. epidermis. [Option ID = 9453]
4. columella. [Option ID = 9456]

epidermis. [Option ID = 9453]

70) A pollen grain with colpi occurring in the equatorial region is called

[Question ID = 2438]

1. colporate [Option ID = 9752]
2. zonoporate [Option ID = 9750]
3. zonoaperturate [Option ID = 9751]
4. zonocolpate [Option ID = 9749]

zonocolpate [Option ID = 9749]

71) In plant tissue culture, a high cytokinin : auxin ratio promotes the formation of

[Question ID = 2426]

1. callus. [Option ID = 9702]
2. embryos. [Option ID = 9703]
3. roots. [Option ID = 9701]
4. shoots. [Option ID = 9704]

roots. [Option ID = 9701]

72) Which of the following fruits do not have edible mesocarp? [Question ID = 2379]

1. Tamarindus indica [Option ID = 9515]
2. Punica granatum [Option ID = 9514]
3. Mangifera indica [Option ID = 9516]
4. Carica papaya [Option ID = 9513]
Carica papaya [Option ID = 9513]
73) Which of the following horizons in the soil profile has high amount of organic matter?
[Question ID = 2398]

1. C [Option ID = 9592]
2. A [Option ID = 9590]
3. B [Option ID = 9591]
4. O [Option ID = 9589]

O [Option ID = 9589]

74) Which one of the following is used as a sweetener? [Question ID = 2380]

1. Syzygium cumini [Option ID = 9519]
2. Carica papaya [Option ID = 9520]
3. Stevia rebaudiana [Option ID = 9518]
4. Gymnema sylvestre [Option ID = 9517]
Gymnema sylvestre [Option ID = 9517]
75) Which phylum contains organisms that most closely resemble the common ancestor of fungi
and animals? [Question ID = 2360]

1. Zygomycota [Option ID = 9437]
2. Chytridiomycota [Option ID = 9439]
3. Basidiomycota [Option ID = 9440]
4. Ascomycota [Option ID = 9438]

Zygomycota [Option ID = 9437]

76) Majority of the enzymes are inactive [Question ID = 2353]

1. above 75˚C [Option ID = 9412]
2. between 25-30˚C [Option ID = 9410]
3. at 25˚C [Option ID = 9409]
4. at 15˚C [Option ID = 9411]

at 25˚C [Option ID = 9409]

77) Syngenesious stamens are characteristic of the family

[Question ID = 2443]

1. Ranunculaceae [Option ID = 9769]
2. Brassicaceae [Option ID = 9772]
3. Malvaceae [Option ID = 9770]
4. Asteraceae [Option ID = 9771]

Ranunculaceae [Option ID = 9769]

78) High activity of sucrose synthase is present in

[Question ID = 2422]

1. tissues that utilize sucrose [Option ID = 9686]
2. tissues that synthesize sucrose [Option ID = 9685]
3. sucrose exporting tissue [Option ID = 9688]
4. photosynthetic leaves [Option ID = 9687]

tissues that synthesize sucrose [Option ID = 9685]

79) Methionine is the precursor of which of the following plant growth regulators?

[Question ID = 2418]

1. Indole acetic acid [Option ID = 9670]
2. Cytokinins [Option ID = 9671]
3. Ethylene [Option ID = 9672]
4. Abscisic acid [Option ID = 9669]

Abscisic acid [Option ID = 9669]

80) Trichoblasts are [Question ID = 2370]

1. excessively multiplying cells in the root epidermis [Option ID = 9480]
2. cells that markedly differ from other cells in the same tissue [Option ID = 9479]
3. cells in the root epidermis that gives rise to root hair [Option ID = 9477]
4. epidermal outgrowths that may or may not be glandular [Option ID = 9478]

cells in the root epidermis that gives rise to root hair [Option ID = 9477]

81) Which of the following enzyme is involved in tRNA synthesis? [Question ID = 2396]

1. RNA polymerase II [Option ID = 9582]
2. RNA polymerase IV [Option ID = 9584]
3. RNA Polymerase I [Option ID = 9581]
4. RNA Polymerase III [Option ID = 9583]

RNA Polymerase I [Option ID = 9581]

82) Which one of the following is a phospholipid? [Question ID = 2352]

1. Proline [Option ID = 9407]

2. Methionine [Option ID = 9405]
3. Lecithin [Option ID = 9408]
4. Valine [Option ID = 9406]

Methionine [Option ID = 9405]

83) Which one of the following amino acids has a nonpolar, aliphatic R group? [Question ID =
2351]

1. Lysine [Option ID = 9401]
2. Arginine [Option ID = 9403]
3. Glycine [Option ID = 9404]
4. Histidine [Option ID = 9402]

Lysine [Option ID = 9401]

84) Gynobasic style is a characteristic feature of the family

[Question ID = 2386]

1. Lamiaceae [Option ID = 9543]
2. Papilionaceae [Option ID = 9541]
3. Apiaceae [Option ID = 9544]
4. Asteraceae [Option ID = 9542]

Papilionaceae [Option ID = 9541]

85) Amphigynous antheridium is found in the genus [Question ID = 2357]

1. Phytophthora. [Option ID = 9425]
2. Alternaria. [Option ID = 9426]
3. Botrytis. [Option ID = 9428]
4. Fusarium. [Option ID = 9427]
Phytophthora. [Option ID = 9425]
86) Transfusion tissue in Cycas functions as [Question ID = 2366]

1. micropyle closing tissue after pollination. [Option ID = 9463]
2. lateral conducting channel for water in the leaves. [Option ID = 9461]
3. mucilage secreting tissue in the ducts. [Option ID = 9462]
4. nutritive tissue for embryo. [Option ID = 9464]

lateral conducting channel for water in the leaves. [Option ID = 9461]

87) The Shannon-Weiner index measures: [Question ID = 2403]

1. General diversity [Option ID = 9610]
2. Evenness [Option ID = 9611]
3. Similarity-dissimilarity [Option ID = 9612]
4. Dominance [Option ID = 9609]

Dominance [Option ID = 9609]

88) Hypostase refers to

[Question ID = 2405]

1. a group of cells below the embryo sac and above the funiculus. [Option ID = 9618]
2. nucellar cells above the embryo sac. [Option ID = 9619]
3. parietal cells. [Option ID = 9620]
4. a cap-like structure of cutinized cells above the embryo sac. [Option ID = 9617]

a cap-like structure of cutinized cells above the embryo sac. [Option ID = 9617]

89) Volatile substances that attract pollinators are emitted by [Question ID = 2374]

1. nectaries [Option ID = 9495]
2. osmophores [Option ID = 9493]
3. hydathodes [Option ID = 9494]
4. myrosine cells [Option ID = 9496]

osmophores [Option ID = 9493]

90) The factor responsible for mediating binding of core RNA polymerase to promoter is

[Question ID = 2395]

1. δ-70 [Option ID = 9580]
2. α-70 [Option ID = 9577]
3. Γ-55 [Option ID = 9579]
4. σ-70 [Option ID = 9578]

α-70 [Option ID = 9577]

91) The members of which of the following angiosperm families do not form endosperm?

[Question ID = 2406]

1. Poaceae [Option ID = 9621]
2. Papilionaceae [Option ID = 9624]
3. Brassicaceae [Option ID = 9623]
4. Podostemaceae [Option ID = 9622]

Poaceae [Option ID = 9621]

92) The probability of death of organisms with different ages in the current year is shown in

[Question ID = 2402]

1. Survivorship curve [Option ID = 9605]

2. Static life table [Option ID = 9606]
3. Natality [Option ID = 9608]
4. Cohort life table [Option ID = 9607]

Survivorship curve [Option ID = 9605]

93) The smallest known virus is

[Question ID = 2361]

1.Escherichia coli [Option ID = 9441]
2. Tobacco necrosis satellite virus [Option ID = 9444]
3. Tobacco mosaic virus [Option ID = 9443]
4. Vaccinia virus [Option ID = 9442]

Escherichia coli [Option ID = 9441]

94) The water potential of pure water at atmospheric pressure is

[Question ID = 2414]

1. -2.3 bar. [Option ID = 9653]
2. 1 bar. [Option ID = 9656]
3. 0 bar. [Option ID = 9655]
4. +2.3 bar. [Option ID = 9654]

-2.3 bar. [Option ID = 9653]

95) The microsporangia in the male cone and ovules in female cones of Pinus are positioned on
the

[Question ID = 2369]

1. adaxial surface of the sporophylls [Option ID = 9475]
2. adaxial surface and abaxial surface of the sporophylls, respectively [Option ID = 9473]
3. abaxial surface and adaxial surface of the sporophylls, respectively [Option ID = 9474]
4. abaxial surface of the sporophylls [Option ID = 9476]

adaxial surface and abaxial surface of the sporophylls, respectively [Option ID = 9473]

96) The term "Bio-pharming" refers to

[Question ID = 2430]

1. synthesis of drugs from transgenic plants/animals. [Option ID = 9718]
2. large scale farming of medicinal plants. [Option ID = 9720]
3. genetically modified foods from plants. [Option ID = 9717]
4. recombinant drugs from bacteria. [Option ID = 9719]

genetically modified foods from plants. [Option ID = 9717]

97) The 5’ – 3’ nucleotide sequence of one of the strands of a double stranded DNA molecule is
given below:
5’ – ATGACGATGGACACATGACATAGACGATAATGCCGTGAC – 3’
In the absence of Tm effects, which one of the following sets of primers could, theoretically, be
used to amplify the target sequence by PCR? [Question ID = 2425]

1. 5’ – ATGACGA – 3’ and 5’ – CCGTGAC – 3’ [Option ID = 9700]
2. 5’ – ATGACGA – 3’ and 5’ – GTCACGG – 3’ [Option ID = 9697]
3. 5’ – TACTGCT – 3’ and 5’ – GGCACTG– 3’ [Option ID = 9698]
4. 5’ – TCGTCAT – 3’ and 5’ – CCGTGAC – 3’ [Option ID = 9699]

5’ – ATGACGA – 3’ and 5’ – GTCACGG – 3’ [Option ID = 9697]

98) The concept of symbiogenesis was first articulated by [Question ID = 2354]

1. Lynn Margulis [Option ID = 9414]
2. Lynn Sagan [Option ID = 9416]
3. Ivan Wallin [Option ID = 9413]
4. Konstantin Mereschkowski [Option ID = 9415]

Ivan Wallin [Option ID = 9413]

99) Mark the correct pairing of scientists and their contributions
I Nirenberg and Matthei 1 Telomerase
II Sidney Altman and Thomas Cech 2 DNA Polymerase I
III Arthur Kornberg 3 Ribozyme
IV Elizabeth Blackburn 4 Genetic code

[Question ID = 2394]

1. I-4; II-3; III-2; IV-1 [Option ID = 9575]
2. I-4; II-3; III-1; IV-2 [Option ID = 9574]
3. I-2; II-1; III-4; IV-3 [Option ID = 9573]
4. I-3; II-4; III-2; IV-1 [Option ID = 9576]

I-2; II-1; III-4; IV-3 [Option ID = 9573]

100) One molecule of Calmodulin, a calcium binding protein in eukaryotic cells binds to______
Ca2+ ions.

[Question ID = 2420]

1. 4 [Option ID = 9677]
2. 2 [Option ID = 9678]
3. 8 [Option ID = 9679]
4. 14 [Option ID = 9680]

4 [Option ID = 9677]