ICAR AIEEA UG 2022 Question Paper ABC

ICAR ABC01
Topic:‐ ABC01_Agriculture

1) Match List I with List II

List I List II

(Catalytic
cycle)
(Action)

I. Binding of the substrate induces the
A. Step I enzyme to alter its shape, which fit more
tightly around the substrate.

II. Enzyme releases products of the reaction
B. Step II and the free enzyme is ready to bind to
another molecule of the substrate.

III. Substrate binds to the active site of the
C. Step III
enzyme and fits into the active site.

IV. Active site of the enzyme in close
D. Step IV proximity of the substrate breaks the chemical
bonds of the substrate.

Choose the correct answer from the options given below:

सूची ‐I को सूची ‐II से सुमेिलत क िजए :

सूची ‐I सूची ‐II

उ परे क
गितिविध
चक

A. चरण I. स सटेट का बंधन एंजाइम को अपने आकार को बदलने के िलए पे रत
I करता है जो स सटेट के चार ओर अिधक कसकर िफट होता है

B. चरण II. एंजाइम पितिकया के उ पाद को मु करता है और मु एंजाइम
II स सटेट के दूसरे अणु को बांधने के िलए तैयार होता है

C. चरण III. स सटेट एंजाइम क सिकय साइट से जुड़ता है और सिकय साइट म
III िफट होता है

D. चरण IV. एंजाइम क सिकय साइट स सटेट क िनकटता म स सटेट के
IV रासायिनक बंधन को तोड़ती है

नीचे िदए गए िवक प म से सही उ र चुिनए :

[Question ID = 351][Question Description = 101_91_AGR_AUG22_Q01]
1. A ‐ II, B ‐ I, C ‐ IV, D ‐ III

[Option ID = 1401]
2. A ‐ IV, B ‐ III, C ‐ II, D ‐ I

[Option ID = 1402]
3. A ‐ I, B ‐ II, C ‐ III, D ‐ IV

[Option ID = 1403]
4. A ‐ III, B ‐ I, C ‐ IV, D ‐ II

[Option ID = 1404]

2) Read the following statements ­
A. In prokaryotes, ribosomes are associated with the plasma membrane of the cell.

B. Ribosomes are made of 50S and 20S subunits which when present together form 70S prokaryotic ribosomes.

C. Ribosomes are the site of protein synthesis.

D. The ribosomes of a polysome translate the mRNA into proteins.

Choose the correct answer from the options given below:

िन निलिखत कथन को पढ़­

A. पोकै रयो स म राइबोसोम कोिशका के ला मा िझ ली से जुड़े होते ह

B. राइबोसोम 50S और 20S सबयूिनट से बने होते ह जो एक साथ िमलकर 70S पोकै रयोिटक राइबोसोम बनाते ह

C. राइबोसोम पोटीन सं ष
े ण का थल है

D. एक पॉलीसोम के राइबोसोम mRNA को पोटीन म प रवितत करते ह

नीचे िदए गए िवक प म से सही उ र चुन :

[Question ID = 352][Question Description = 102_91_AGR_AUG22_Q02]
1. A, B and C only
केवल A, B और C

[Option ID = 1405]
2. A, C and D only
केवल A, C और D

[Option ID = 1406]
3. B, C and D only
केवल B, C और D

[Option ID = 1407]
4. A, B and D only
केवल A, B और D

[Option ID = 1408]

3) Given below are two statements­
Statement I: The Double­helix structure of DNA is made of two polynucleotide chains, where the backbone is constituted by
sugar­phosphate, and the bases project inside.

Statement II: Eucaryotic DNA structure contains a set of negatively charged basic proteins called histones.

In light of the above statements, choose the correct answer from the options given below:

नीचे दो कथन िदए गए ह :

कथन ­ I : डीएनए क डबल­हेिल स संरचना दो पोली यूि लयोटाइड श ृंखलाओं से बनी होती है, जहां बैकबोन शुगर­फॉ फेट ारा गिठत होता है, और बेस अंदर पोजे ट करते ह

कथन ­ II : यूके रयोिटक डीएनए संरचना म िह टोन नामक नकारा मक चाज िकए गए मूल पोटीन का एक सेट होता है

उपयु कथन के आलोक म िन निलिखत िवक प म से सही उ र चुन :

[Question ID = 353][Question Description = 103_91_AGR_AUG22_Q03]
1. Both Statement I and Statement II are true
कथन I और II दोन सही ह

[Option ID = 1409]
2. Both Statement I and Statement II are false
कथन I और II दोन गलत ह

[Option ID = 1410]
3. Statement I is true but Statement II is false
कथन I स य है , िक तु कथन II गलत है |

[Option ID = 1411]
4. Statement I is false but Statement II is true
कथन I अ स य है , िक तु कथन II सही है

[Option ID = 1412]

4) Which contrasting trait was studied in garden pea by Gregor Mendel for flower colour?
ग ेगर मडल ारा फूल के रंग के िलए मटर म िकस िवपरीत ल ण का अ ययन िकया गया था?

[Question ID = 354][Question Description = 104_91_AGR_AUG22_Q04]
1. Green/ Yellow
हरा / पीला

[Option ID = 1413]
2. Violet/ White
बगनी / सफेद

[Option ID = 1414]
3. Yellow/ Green
पीला / हरा

[Option ID = 1415]
4. White/ Violet
सफेद / बगनी

[Option ID = 1416]

5) Given below are two statements­
Statement I: Landraces and pure lines are examples of homogeneous population.

Statement II: Composites and multilines are examples of heterogeneous population.

In light of the above statements, choose the correct answer from the options given below:

नीचे दो कथन िदए गए ह :

कथन ­ I : मूल पजाितयाँ और शु पंि याँ सजातीय जनसं या के उदाहरण ह

कथन ­ II : िमिशत और बहपंि याँ िवषम जनसं या के उदाहरण ह

उपयु कथन के आलोक म िन निलिखत िवक प म से सही उ र चुन :

[Question ID = 355][Question Description = 105_91_AGR_AUG22_Q05]
1. Both Statement I and Statement II are true
कथन I और II दोन सही ह

[Option ID = 1417]
2. Both Statement I and Statement II are false
कथन I और II दोन गलत ह

[Option ID = 1418]
3. Statement I is true but Statement II is false
कथन I स य है , िक तु कथन II गलत है |

[Option ID = 1419]
4. Statement I is false but Statement II is true
कथन I अ स य है , िक तु कथन II सही है

[Option ID = 1420]

6) Given below are two statements, one is labelled as Assertion A and the other is labelled as Reason R
Assertion A : Globulin proteins are insoluble in water but soluble in dilute salt solutions of strong acids and bases.

Reason R : Scleroproteins are soluble in all neutral solvents and in dilute alkalies and acids.

In light of the above statements, choose the correct answer from the options given below:

नीचे दो कथन िदए गए ह : एक को अिभकथन (A) और दूसरे को तक (R) कहा गया है

अिभकथन (A) : लो युिलन पोटीन पानी म अघुलनशील होते ह लेिकन मजबूत अ ल और ार के तनु नमक के घोल म घुलनशील होते ह

तक (R) : लेरोपोटीन सभी तट थ द ावक म और पतले ार और अ ल म घुलनशील होते ह

उपयु कथन के आलोक म िन नांिकत िवक प म से सही उ र चुन :

[Question ID = 356][Question Description = 106_91_AGR_AUG22_Q06]
1. Both A and R are true and R is the correct explanation of A
(A) और (R) दोन सही ह और (R), (A) क सही या या है

[Option ID = 1421]
2. Both A and R are true but R is NOT the correct explanation of A

(A) और (R) दोन सही ह पर तु (R), (A) क सही या या नह है

[Option ID = 1422]
3. A is true but R is false
(A) सही है पर तु (R) सही नह ह

[Option ID = 1423]
4. A is false but R is true
(A) सही नह है पर तु (R) सही ह

[Option ID = 1424]

7) Which of the following cellular function is associated with Biotin (Vit. H)?
िन निलिखत म से कौन­सा कोिशक य काय बायोिटन (िवटािमन­एच) से जुड़ा है?

[Question ID = 357][Question Description = 107_91_AGR_AUG22_Q07]
1. Coenzyme in CO2 fixation
CO2 ि थरीकरण म कोएंजाइम

[Option ID = 1425]
2. Coenzyme for amino acid conversion
अमीनो अ ल पांतरण के िलए कोएंजाइम

[Option ID = 1426]
3. Coenzyme for pyruvate metabolism
पाइ वेट चयापचय के िलए कोएंजाइम

[Option ID = 1427]
4. Part of dehydrogenase enzyme
िडहाइडोिजनेज़ एंजाइम का िह सा

[Option ID = 1428]

8) Who reported first time the presence of ribosomes in plants?
पौध म राइबोसोम क उपि थित क सूचना सवपथम िकसने दी थी?

[Question ID = 358][Question Description = 108_91_AGR_AUG22_Q08]
1. Robinsen and Brown (1953)
रॉिब सन और बाउन (1953)

[Option ID = 1429]
2. Haguenau (1958)
हागुएनाउ (1958)

[Option ID = 1430]
3. Palade (1953)
पालेड (1953)

[Option ID = 1431]
4. Christain de Duve (1955)
िक टैन डी यूव (1955)

[Option ID = 1432]

9) Given below are two statements­
Statement I: The smooth bacterial movement in a fixed direction mediated by the rotation of flagella in a clockwise
direction.

Statement II: The tumbling in bacterial movement is caused by the rotation of flagella in an anticlockwise direction.

In light of the above statements, choose the correct answer from the options given below:

नीचे दो कथन िदए गए ह :

कथन ­ I : िनबाध जीवाणु को एक िनि त िदशा म गित लेजेला के दि णावत िदशा म घूमने से होती है

कथन ­ II : जीवाणवीय ट बिलंग मूवमट लेजेला के वामावत िदशा म घूमने के कारण होता है

उपयु कथन के आलोक म िन निलिखत िवक प म से सही उ र चुन :

[Question ID = 359][Question Description = 109_91_AGR_AUG22_Q09]
1. Both Statement I and Statement II are true
कथन I और II दोन सही ह

[Option ID = 1433]

2. Both Statement I and Statement II are false
कथन I और II दोन गलत ह

[Option ID = 1434]
3. Statement I is true but Statement II is false
कथन I स य है , िक तु कथन II गलत है |

[Option ID = 1435]
4. Statement I is false but Statement II is true
कथन I अ स य है , िक तु कथन II सही है

[Option ID = 1436]

10) Which component is absent in the cell wall of gram negative bacteria?

ग ाम ऋणा मक जीवाणुओं क कोिशका िभि म कौन­सा घटक अनुपि थत होता है?

[Question ID = 360][Question Description = 110_91_AGR_AUG22_Q10]
1. Lipoprotein
लाइपोपोटीन

[Option ID = 1437]
2. Lipopolysaccharide
लाइपोपॉलीसेकरे ाइड

[Option ID = 1438]
3. Glycolipids
लाइकोिलिप स

[Option ID = 1439]
4. Phospholipid
फॉ फोिलिपड

[Option ID = 1440]

11) Given below are two statements­
Statement I: BOD is a measure of the organic matter present in the water.

Statement II: The greater the BOD of waste water, more is its polluting potential.

In light of the above statements, choose the correct answer from the options given below:

नीचे दो कथन िदए गए ह :

कथन ­ I : बीओडी पानी म मौजूद काब िनक पदाथ का एक माप है

कथन ­ II : अपिश जल क बीओडी िजतनी अिधक होती है, उसक पदूषण मता उतनी ही अिधक होती है

उपयु कथन के आलोक म िन निलिखत िवक प म से सही उ र चुन :

[Question ID = 361][Question Description = 111_91_AGR_AUG22_Q11]
1. Both Statement I and Statement II are true
कथन I और II दोन सही ह

[Option ID = 1441]
2. Both Statement I and Statement II are false
कथन I और II दोन गलत ह

[Option ID = 1442]
3. Statement I is true but Statement II is false
कथन I स य है , िक तु कथन II गलत है |

[Option ID = 1443]
4. Statement I is false but Statement II is true
कथन I अ स य है , िक तु कथन II सही है

[Option ID = 1444]

12) Which light is most favourable for plant growth and development?
पौधे क वृि और िवकास के िलए कौन सा पकाश सबसे अनुकल
ू है?

[Question ID = 362][Question Description = 112_91_AGR_AUG22_Q12]
1. Blue
नीला

[Option ID = 1445]
2. Green
हरा

[Option ID = 1446]
3. Violet
वायलेट

[Option ID = 1447]
4. Red
लाल

[Option ID = 1448]

13) Match List I with List II

List I List II
Rice Optimum temperature
A. Germination I. 20–25°C
B. Tillering II. 33°C
C. Panicle initiation III. 31°C
D. Ripening IV. 20–35°C
Choose the correct answer from the options given below:

सूची I को सूची II के साथ सुमिे लत कर

सूची I सूची II
धान इ तम तापमान
A. अंकुरण I. 20­25°C
B. फुटान II. 33°C
C. पु पगु छ आर भन III. 31°C
D. पकना IV. 20­35°C
नीचे िदए गए िवक प म से सही उ र चुिनए:

[Question ID = 363][Question Description = 113_91_AGR_AUG22_Q13]
1. A‐I, B‐II, C‐III, D‐IV [Option ID = 1449]
2. A‐I, B‐III, C‐II, D‐IV [Option ID = 1450]
3. A‐IV, B‐II, C‐III, D‐I [Option ID = 1451]
4. A‐IV, B‐III, C‐II, D‐I [Option ID = 1452]

14) Where is ‘ICAR­National Bureau of Animal Genetic Resources’ situated?
आईसीएआर­रा ीय पशु आनुवांिशक संसाधन यूरो कहां ि थत है?

[Question ID = 364][Question Description = 114_91_AGR_AUG22_Q14]
1. Agra
आगरा

[Option ID = 1453]
2. Izatnagar
इ जतनगर

[Option ID = 1454]
3. Karnal
करनाल

[Option ID = 1455]
4. Mathura
मथुरा

[Option ID = 1456]

15) Given below are two statements
Statement I: As per 20th Livestock Census, total livestock population is 536.76 billion in the country.

Statement II: As per 20th Livestock Census, the total number of cattle in the country is 193.46 billion.

In light of the above statements, choose the correct answer from the options given below

नीचे दो कथन िदए गए ह :

कथन ­ I : 20व पशुधन गणना के अनुसार, देश म कुल पशुधन सं या 536.76 िबिलयन है

कथन ­ II : 20व पशुधन गणना के अनुसार देश म गोवंशी पशु ओ ं क कुल सं या 193.46 िबिलयन है

उपयु कथन के आलोक म िन निलिखत िवक प म से सही उ र चुन :

[Question ID = 365][Question Description = 115_91_AGR_AUG22_Q15]
1. Both Statement I and Statement II are true
कथन I और II दोन सही ह

[Option ID = 1457]
2. Both Statement I and Statement II are false
कथन I और II दोन गलत ह

[Option ID = 1458]
3. Statement I is true but Statement II is false
कथन I स य है , िक तु कथन II गलत है |

[Option ID = 1459]
4. Statement I is false but Statement II is true
कथन I अ स य है , िक तु कथन II सही है

[Option ID = 1460]

16) Match List I with List II

List I List II
Crossbred Cattle Breeds used for crossing
A. Frieswal I. Holstein Friesian and Tharparkar
B. Karanfries II. Jersey and Non Descript Cattle
C. Karanswiss III. Holstein Friesian and Sahiwal
D. Tailor IV. Brown Swiss and Sahiwal
Choose the correct answer from the options given below:

सूची ­I को सूची ­II से सुमिे लत क िजए :

सूची ­I सूची ­II
गोवंशी पशु ओ ं क संकर न ल संकरण हेतु पयु न ल
A. फीजवाल I. हो सटीन फीिजयन व थारपारकर
B. करणफीज II. जस व अवग कृत गोवंश
C. करणि वस III. हो सटीन फीिजयन व साहीवाल
D. टेलर IV. बाउन ि वस व साहीवाल
नीचे िदए गए िवक प म से सही उ र चुिनए :

[Question ID = 366][Question Description = 116_91_AGR_AUG22_Q16]
1. A ‐ IV, B ‐ III, C ‐ I, D ‐ II [Option ID = 1461]
2. A ‐ III, B ‐ I, C ‐ IV, D ‐ II [Option ID = 1462]
3. A ‐ II, B ‐ I, C ‐ IV, D ‐ III [Option ID = 1463]
4. A ‐ III, B ‐ IV, C ‐ II, D ‐ I [Option ID = 1464]

17) How much covered area of floor is required for cow?
गाय के िलए फश का िकतना ढका हआ त
े आव यक है?

[Question ID = 367][Question Description = 117_91_AGR_AUG22_Q17]
1. 3.5 m2
3. 5 मी2

[Option ID = 1465]
2. 7 m2
7 मी2

[Option ID = 1466]
3. 10.5 m2
10.5 मी2

[Option ID = 1467]
4. 14 m2
14 मी2

[Option ID = 1468]

18) What is the pH of Good Quality silage?

अ छी गुणव ा वाली साइलेज का पी.एच. मान िकतना होता है?

[Question ID = 368][Question Description = 118_91_AGR_AUG22_Q18]
1. 3.7 – 4.2 [Option ID = 1469]
2. 4.2 – 4.5 [Option ID = 1470]
3. 4.5 – 4.8 [Option ID = 1471]
4. Higher than 4.8
4.8 से अिधक

[Option ID = 1472]

19) Read the following statements
A. Cellulose is more complex and less soluble carbohydrate.

B. No known enzyme of large animals can digest cellulose.

C. Cellulose is broken down by microbial enzyme cellulase.

D. Cellulose has a very important role as nutrient in case of carnivorous animals.

Choose the correct answer from the options given below:

िन निलिखत व य पढ़

A. से युलोज अिधक जिटल और कम घुलनशील काब हाइडेट है

B. बड़े पशु ओ ं का कोई ात एंजाइम से यूलोज को पचा नह सकता है

C. से युलोज को माइकोिबयल एंजाइम सेलुलेज ारा तोड़ा जाता है

D. मांसाहारी पशु ओ ं के मामले म पोषक त व के प म से युलोज क बहत मह वपूण भूिमका होती है

िन निलिखत िवक प म से सही उ र चुन:

[Question ID = 369][Question Description = 119_91_AGR_AUG22_Q19]
1. A, B and C only
A, B और C केवल

[Option ID = 1473]
2. A, C and D only
A, C और D केवल

[Option ID = 1474]
3. B, C and D only
B, C और D केवल

[Option ID = 1475]
4. A, B and D only
A, B और D केवल

[Option ID = 1476]

20) Given below are two statements, one is labelled as Assertion A and the other is labelled as Reason R
Assertion A : About 250 adult birds per hectare can be reared in free range system of poultry housing.

Reason R : Free range system of poultry housing is less capital intensive.

In light of the above statements, choose the correct answer from the options given below

नीचे दो कथन िदए गए ह : एक को अिभकथन (A) और दूसरे को तक (R) कहा गया है

अिभकथन (A) : कु कुट आवास क फी रज पणाली म पित हे टेयर लगभग 250 वय क पि य को पाला जा सकता है

तक (R) : कु कुट आवास क फी रज पणाली कम पूज
ं ी वाली होती है

उपयु कथन के आलोक म िन नांिकत िवक प म से सही उ र चुन :

[Question ID = 370][Question Description = 120_91_AGR_AUG22_Q20]
1. Both A and R are true and R is the correct explanation of A
(A) और (R) दोन सही ह और (R), (A) क सही या या है

[Option ID = 1477]
2. Both A and R are true but R is NOT the correct explanation of A
(A) और (R) दोन सही ह पर तु (R), (A) क सही या या नह है

[Option ID = 1478]
3. A is true but R is false

(A) सही है पर तु (R) सही नह ह

[Option ID = 1479]
4. A is false but R is true
(A) सही नह है पर तु (R) सही ह

[Option ID = 1480]

21) Given below are two statements
Statement I: Rickets and goiter are metabolic diseases.

Statement II: Milk fever and ketosis are deficiency diseases.

In light of the above statements, choose the correct answer from the options given below

नीचे दो कथन िदए गए ह :

कथन ­ I : रके स और गोइटर चयापचय संबंधी रोग ह

कथन ­ II : दु ध वर और क टोिसस यूनता ज य रोग ह

उपयु कथन के आलोक म िन निलिखत िवक प म से सही उ र चुन :

[Question ID = 371][Question Description = 121_91_AGR_AUG22_Q21]
1. Both Statement I and Statement II are true
कथन I और II दोन सही ह

[Option ID = 1481]
2. Both Statement I and Statement II are false
कथन I और II दोन गलत ह

[Option ID = 1482]
3. Statement I is true but Statement II is false
कथन I स य है , िक तु कथन II गलत है |

[Option ID = 1483]
4. Statement I is false but Statement II is true
कथन I अ स य है , िक तु कथन II सही है

[Option ID = 1484]

22) Match List I with List II

List I List II
Disease of Poultry Main Symptom
A. New Castle Disease I. Paralysis of one leg
B. Gumboro II. Raised skin lesions
C. Marek’s Disease III. Greenish diarrhea
D. Fowl Pox IV. Pasty diarrhea
Choose the correct answer from the options given below:

सूची ­I को सूची ­II से सुमिे लत क िजए :

सूची ­I सूची ­II
मुिगय के रोग मु य ल ण
A. यू कैसल रोग I. एक पै र का प ाघात
B. ग बोरो II. वचा के उठे हए घाव
C. मैरे स रोग III. हरा द त
D. मुग चेचक IV. िचपिचपा द त
नीचे िदए गए िवक प म से सही उ र चुिनए :

[Question ID = 372][Question Description = 122_91_AGR_AUG22_Q22]
1. A ‐ I, B ‐ II, C ‐ III, D ‐ IV [Option ID = 1485]
2. A ‐ I, B ‐ III, C ‐ IV, D ‐ II [Option ID = 1486]
3. A ‐ II, B ‐ IV, C ‐ III, D ‐ I [Option ID = 1487]
4. A ‐ III, B ‐ IV, C ‐ I, D ‐ II [Option ID = 1488]

23) What is the name of the process of making Paneer?

पनीर बनाने क पिकया का या नाम है?

[Question ID = 373][Question Description = 123_91_AGR_AUG22_Q23]
1. Concentration
सा दीकरण

[Option ID = 1489]
2. Coagulation
स्कंदन

[Option ID = 1490]
3. Fermentation
िक वन

[Option ID = 1491]
4. Phase inversion of fat
वसा का फेज इ वजन

[Option ID = 1492]

24) Given below are two statements
Statement I: Progesterone hormone is secreted by ovary in animals.

Statement II: Estrogen hormone is secreted by Anterior Pituitary in animals.

In light of the above statements, choose the correct answer from the options given below

नीचे दो कथन िदए गए ह :

कथन ­ I : पशु ओ ं म पोजे टेरोन हाम न अंडाशय ारा सािवत होता है

कथन ­ II : पशु ओ ं म ए टोजेन हाम न अगवत पीयूष गंिथ ारा सािवत होता है

उपयु कथन के आलोक म िन निलिखत िवक प म से सही उ र चुन :

[Question ID = 374][Question Description = 124_91_AGR_AUG22_Q24]
1. Both Statement I and Statement II are true
कथन I और II दोन सही ह

[Option ID = 1493]
2. Both Statement I and Statement II are false
कथन I और II दोन गलत ह

[Option ID = 1494]
3. Statement I is true but Statement II is false
कथन I स य है , िक तु कथन II गलत है |

[Option ID = 1495]
4. Statement I is false but Statement II is true
कथन I अ स य है , िक तु कथन II सही है

[Option ID = 1496]

25) Match List I with List II
List I List II
Animals Breathing rate per minute
A. Cow I. 10
B. Buffalo II. 8
C. Goat III. 15
D. Horse IV. 25
Choose the correct answer from the options given below:

सूची ­I को सूची ­II से सुमिे लत क िजए :

सूची ­I सूची ­II
पशु पित िमनट सन दर
A. गाय I. 10
B. भस II. 8
C. बकरी III. 15
D. घोडा IV. 25
नीचे िदए गए िवक प म से सही उ र चुिनए :

[Question ID = 375][Question Description = 125_91_AGR_AUG22_Q25]

1. A ‐ I, B ‐ II, C ‐ III, D ‐ IV [Option ID = 1497]
2. A ‐ I, B ‐ III, C ‐ IV, D ‐ II [Option ID = 1498]
3. A ‐ II, B ‐ III, C ‐ IV, D ‐ I [Option ID = 1499]
4. A ‐ III, B ‐ IV, C ‐ II, D ‐ I [Option ID = 1500]

26) How much area was used for growing food­grain crops in India during 2020–21?

भारत म 2020­21 के दौरान खा ा न फसल को उगाने के िलए िकतने त
े का उपयोग िकया गया था ?

[Question ID = 376][Question Description = 126_91_AGR_AUG22_Q26]
1. 126 million hectares
126 िमिलयन हे टेयर

[Option ID = 1501]
2. 136 million hectares
136 िमिलयन हे टेयर

[Option ID = 1502]
3. 129 million hectares
129 िमिलयन हे टेयर

[Option ID = 1503]
4. 132 million hectares
132 िमिलयन हे टेयर

[Option ID = 1504]

27) Where is the ICAR­ Indian Institute of Millets Research situated?

भाकृअनुप­भारतीय कद न अनुसध
ं ान सं थान कहाँ ि थत है?

[Question ID = 377][Question Description = 127_91_AGR_AUG22_Q27]
1. Bengaluru
बगलु

[Option ID = 1505]
2. Hyderabad
हैदराबाद

[Option ID = 1506]
3. Jodhpur
जोधपुर

[Option ID = 1507]
4. Nagpur
नागपुर

[Option ID = 1508]

28) Which is the most moisture stress sensitive growth stage of maize?
म का क सबसे अिधक नमी तनाव संवदे नशील वृि अव था कौन सी है?

[Question ID = 378][Question Description = 128_91_AGR_AUG22_Q28]
1. Knee high stage
घुटना उ च अव था

[Option ID = 1509]
2. Tasseling stage
टैसिलंग अव था

[Option ID = 1510]
3. Silking stage
िसि कंग अव था

[Option ID = 1511]
4. Milk stage
दूध अव था

[Option ID = 1512]

29) Given below are two statements
Statement I: Drip irrigation not only save water but also increase the crop yield from 20% to 100%.

Statement II: Even though, drip irrigation increases crop yield but it is not profitable as compared to sprinkler irrigation.

In light of the above statements, choose the most appropriate answer from the options given below

नीचे दो कथन िदए गए ह:

कथन I: िडप िसंचाई से न केवल पानी क बचत होती है बि क फसल क उपज 20% से 100% तक बढ़ जाती है

कथन II: भले ही िडप िसंचाई से फसल क पैदावार बढ़ती है लेिकन यह ि पंकलर िसंचाई क तुलना म लाभदायक नह है

उपरो कथन के आलोक म नीचे िदए गए िवक प म से सवा िधक उपयु उ र का चयन क िजए

[Question ID = 379][Question Description = 129_91_AGR_AUG22_Q29]
1. Both Statement I and Statement II are correct
कथन I और कथन II दोन सही ह

[Option ID = 1513]
2. Both Statement I and Statement II are incorrect
कथन I और कथन II दोन गलत ह

[Option ID = 1514]
3. Statement I is correct but Statement II is incorrect
कथन I सही है लेिकन कथन II गलत है

[Option ID = 1515]
4. Statement I is incorrect but Statement II is correct
कथन I गलत है लेिकन कथन II सही है

[Option ID = 1516]

30) How many micronutrients are essential for plants?
पौध के िलए िकतने सू म पोषक त व आव यक ह?

[Question ID = 380][Question Description = 130_91_AGR_AUG22_Q30]
1. 9 [Option ID = 1517]
2. 17 [Option ID = 1518]
3. 8 [Option ID = 1519]
4. 16 [Option ID = 1520]

31) Match List I with List II
List I List II
A. Azotobacter sp. I. Anaerobic composting
B. Aspergillus awamori II. Eisenia foetida
C. Night soil III. N­fixing bacteria
D. Vermicopost IV. P­solubilization
Choose the correct answer from the options given below:

सारणी I को सारणी II से िमलाये

सारणी I: सारणी II:
A. एज़ोटोबै टर प. I. अवायवीय खाद
B. ए परिगलस अवामोरी II. आइसेिनया फोएिटडा
C. रात क िम ी III. N­िफि संग बै टी रया
D. वम कोपो ट IV. P­घुलनशीलता
नीचे िदए गए िवक प म से सही उ र को चुने

[Question ID = 381][Question Description = 131_91_AGR_AUG22_Q31]
1. A‐III, B‐IV, C‐II, D‐I [Option ID = 1521]
2. A‐I, B‐III, C‐II, D‐IV [Option ID = 1522]
3. A‐III, B‐IV, C‐I, D‐II [Option ID = 1523]
4. A‐IV, B‐III, C‐II, D‐I [Option ID = 1524]

32) Read the following statements
A. Adding organic matter to the soil increase its CEC.

B. Higher content of kaolinite in a soil increase CEC of the soil.

C. Mg, Mo, Cl and K are mobile nutrients.

D. Addition of FYM can increase C sequestration by soil.

E. Cultivated soils have more SOC than forest soils.

Choose the correct answer from the options given below:

िन निलिखत कथन को पढ़

A. िम ी म काब िनक पदाथ िमलाने से इसका CEC बढ़ जाता है

B. िम ी म केओिलनाइट क उ च माता िम ी के CEC को बढ़ाती है

C. Mg, Mo, Cl और K गितशील पोषक त व ह

D. FYM को िम ी म डालने से C­अिधगहण बढ़ सकता है

E. खेत क िम ी म वन िम ी क तुलना म अिधक SOC होता है

नीचे िदए गए िवक प म से सही उ र चुिनए:

[Question ID = 382][Question Description = 132_91_AGR_AUG22_Q32]
1. A, B and C only
A, B और C केबल

[Option ID = 1525]
2. A, C and D only
A, C और D केबल

[Option ID = 1526]
3. C, D and E only
C, D और E केबल

[Option ID = 1527]
4. B, D and E only
B, D और E केबल

[Option ID = 1528]

33) How much pendimethalin (30 EC) is required for 5 ha area of soybean when rate of application of pendimethalin is 0.75 kg
a.i./ ha?

सोयाबीन के 5 हे टेयर त
े के िलए िकतने पिडमथेिलन (30 ईसी) क आव यकता होती है, जब पिडमथािलन के आवेदन क दर 0.75 िकलोग ाम सिकय संघटक / हे. है?

[Question ID = 383][Question Description = 133_91_AGR_AUG22_Q33]
1. 15.0 kg
15.0 िकलोगाम

[Option ID = 1529]
2. 12.5 kg
12.5 िकलोगाम

[Option ID = 1530]
3. 5.0 kg
5.0 िकलोगाम

[Option ID = 1531]
4. 10.0 kg
10.0 िकलोगाम

[Option ID = 1532]

34) Match List I with List II
List I List II
Weed Scientific name
A. Horse purslane I. Trianthema oleracea L.
B. Purslane II. Eleusine indica L.
C. Pigeon grass III. Trianthema portulacastrum L.
D. Goosegrass IV. Paspalum sanguinale Lamk
Choose the correct answer from the options given below:

सारणी I को सारणी II से िमलाये

सारणी I सारणी II
खरपतवार वै ािनक नाम

A. हॉस पसलेन I. िटएंथेमा ओलेरािसया एल.
B. पसलेन II. एलुसीन इंिडका एल.
C. कबूतर घास III. िटए थेमा पोटुलाकै टम एल.
D. हंसगास IV. पा पलम सगुइनाले लै को
नीचे िदए गए िवक प म से सही उ र को चुने

[Question ID = 384][Question Description = 134_91_AGR_AUG22_Q34]
1. A‐III, B‐I, C‐II, D‐IV [Option ID = 1533]
2. A‐I, B‐III, C‐IV, D‐II [Option ID = 1534]
3. A‐III, B‐I, C‐IV, D‐II [Option ID = 1535]
4. A‐I, B‐III, C‐II, D‐IV [Option ID = 1536]

35) What is the mean maximum temperature for grain development of wheat?
गेहँ के दाने के िवकास के िलए औसत अिधकतम तापमान या है?

[Question ID = 385][Question Description = 135_91_AGR_AUG22_Q35]
1. 15°C
15 िडगी सेि सयस

[Option ID = 1537]
2. 20°C
20 िडगी सेि सयस

[Option ID = 1538]
3. 25°C
25 िडगी सेि सयस

[Option ID = 1539]
4. 30°C
30 िडगी सेि सयस

[Option ID = 1540]

36) Match List I with List II

List I List II
Crop Disease
A. Rice I. Molya disease
B. Wheat II. Polysora rust
C. Barley III. False smut
D. Maize IV. Loose smut
Choose the correct answer from the options given below:

सूची I को सूची II के साथ सुमिे लत कर

सूची I सूची II
फसल रोग
A. धान I. मो या रोग
B. गेहं II. पोलीसोरा र ट
C. जौ III. फा स मट
D. म का IV. ढीली मट
नीचे िदए गए िवक प म से सही उ र चुिनए:

[Question ID = 386][Question Description = 136_91_AGR_AUG22_Q36]
1. A‐III, B‐IV, C‐I, D‐II [Option ID = 1541]
2. A‐I, B‐III, C‐IV, D‐II [Option ID = 1542]
3. A‐III, B‐IV, C‐II, D‐I [Option ID = 1543]
4. A‐IV, B‐III, C‐II, D‐I [Option ID = 1544]

37) Read the following statements

A. Groundnut is determinate in growth and flowering.

B. Groundnut is a day neutral plant.

C. Aflatoxin of groundnut is a serious problem caused by Aspergillus flavus fungi.

D. Groundnut is a C3 plant.

E. Phosphorous is important for root and kernel development.

Choose the correct answer from the options given below:

िन निलिखत कथन को पढ़

A. मूग
ं फली वृि और फूल आने म िनधा रत होती है

B. मूग
ं फली एक िदन तट थ पौधा है

C. मूग
ं फली का ए लाटॉि सन ए परिगलस लेवस कवक के कारण होने वाली एक गंभीर सम या है

D. मूग
ं फली एक C3 पौधा है

E. फा फोरस जड़ और िगरी के िवकास के िलए मह वपूण है

नीचे िदए गए िवक प म से सही उ र चुिनए:

[Question ID = 387][Question Description = 137_91_AGR_AUG22_Q37]
1. A, B, C and D only

A, B, C और D केबल

[Option ID = 1545]
2. A, C, D and E only

A, C, D और E केबल

[Option ID = 1546]
3. B, C, D and E only

B, C, D और E केबल

[Option ID = 1547]
4. A, B, D and E only

A, B, D और E केबल

[Option ID = 1548]

38) Given below are two statements, one is labelled as Assertion A and the other is labelled as Reason R

Assertion A: Boron application at flowering stage improve seed‐set, filling per cent, test weight and yield.

Reason R: Boron is very important nutrient for pollen germination and pollen tube development.

In light of the above statements, choose the most appropriate answer from the options given below

नीचे दो कथन िदए गए ह: एक को अिभकथन A और दूसरे को कारण R के प म लेबल िकया गया है

अिभकथन A: फूल आने क अव था म बोरॉन देने से बीज‐िनधारण, भराव पितशत, हज़ार दानो के वजन और उपज म सुधार होता है

कारण R: पराग के अंकुरण और पराग नली के िवकास के िलए बोरॉन बहत मह वपूण पोषक त व है

उपरो कथन के आलोक म नीचे िदए गए िवक प म से सवािधक उपयु उ र का चयन क िजए

[Question ID = 388][Question Description = 138_91_AGR_AUG22_Q38]
1. Both A and R are correct and R is the correct explanation of A

A और R दोन सही ह और R, A क सही या या करता है

[Option ID = 1549]
2. Both A and R are correct but R is NOT the correct explanation of A

A और R दोन सही ह लेिकन R, A क सही या या नह है

[Option ID = 1550]
3. A is correct but R is not correct

A सही है लेिकन R सही नह है

[Option ID = 1551]
4. A is not correct but R is correct

A सही नह है लेिकन R सही है

[Option ID = 1552]

39) Given below are two statements
Statement I: Cabbage is fifth largest vegetable crop of India.

Statement II: Madhya Pradesh has the highest productivity of cabbage in India.

In light of the above statements, choose the most appropriate answer from the options given below

नीचे दो व य िदए गए ह

व य I: प ागोभी भारत म सबसे यादा उगाई जाने वाली पांचवी स जी फसल है

व य II: भारत म प ागोभी क उ पादकता म य पदेश म सबसे यादा है

उपरो कथन के स दभ म नीचे िदए गए िवक प म से सबसे उपयु िवक प का चयन क िजये

[Question ID = 389][Question Description = 139_91_AGR_AUG22_Q39]
1. Both Statement I and Statement II are correct
व य I और व य II दोन ही सही ह

[Option ID = 1553]
2. Both Statement I and Statement II are incorrect
व य I और व य II दोन ही गलत ह

[Option ID = 1554]
3. Statement I is correct but Statement II is incorrect
व य I सही है लेिकन व य II गलत है

[Option ID = 1555]
4. Statement I is incorrect but Statement II is correct
व य I गलत है लेिकन व य II सही है

[Option ID = 1556]

40) Althea rosea belongs to which family?
अि थया रोसीया िकस प रवार से संबंिधत ह?

[Question ID = 390][Question Description = 140_91_AGR_AUG22_Q40]
1. Asteraceae
ए टेरस
े ी

[Option ID = 1557]
2. Malvaceae
मालवेसी

[Option ID = 1558]
3. Cruciferae
क ूिसफेरी

[Option ID = 1559]
4. Amranthaceae
एमेरे थेसी

[Option ID = 1560]

41) Given below are two statements
Statement I: Persian garden style and Japanese styles, both are based on their respective ideas of heaven.

Statement II: Persian and Japanese garden are of formal style.

In light of the above statements, choose the most appropriate answer from the options given below

नीचे दो व य िदए गए ह

व य I: पारसी एवं जापानी गाडन दोन ही वग क िवचारधारा पर आधा रत है

व य II: पारसी एवं जापानी गाडन दोन ही ओपचा रक शेली के गाडन है

उपरो कथन के स दभ म नीचे िदए गए िवक प म से सबसे उपयु िवक प का चयन क िजये

[Question ID = 391][Question Description = 141_91_AGR_AUG22_Q41]

1. Both Statement I and Statement II are correct
व य I और व य II दोन ही सही ह

[Option ID = 1561]
2. Both Statement I and Statement II are incorrect
व य I और व य II दोन ही गलत ह

[Option ID = 1562]
3. Statement I is correct but Statement II is incorrect
व य I सही है लेिकन व य II गलत है

[Option ID = 1563]
4. Statement I is incorrect but Statement II is correct
व य I गलत है लेिकन व य II सही है

[Option ID = 1564]

42) Match List I with List II

List I List II
Variety Resistant/tolerant
A. Swarna Pratibha I. Fusarium Wilt
B. Swarna Ajay II. Aphid
C. Utkal Madhuri III. Bacterial Wilt
D. Annamalai IV. Phomopsis Blight
Choose the correct answer from the options given below:

सूची I का सूची II से िमलान क िजये

सूची I सूची II

िक म पितरोधी / सहनशील
A. वण पितभा I. फुजे रयम िव ट

B. वण अजय II. एिफड

C. उ कल माधुरी III. जीवाणु लािन

D. अ नामलाई IV. फोमोि सस लाइट

नीचे िदए गए िवक प म से सही िवक प का चयन कर :

[Question ID = 392][Question Description = 142_91_AGR_AUG22_Q42]
1. A ‐ II, B ‐ IV, C ‐ I, D ‐ III [Option ID = 1565]
2. A ‐ III, B ‐ IV, C ‐ II, D ‐ I [Option ID = 1566]
3. A ‐ II, B ‐ I, C ‐ IV, D ‐ III [Option ID = 1567]
4. A ‐ III, B ‐ IV, C ‐ I, D ‐ II [Option ID = 1568]

43) Read following statements:
A. Pithiness in radish is more common in summer crop.

B. Pithiness in radish is more common in autumn crop.

C. Soaking of radish seed in NAA stimulate germination.

D. Radish is short duration and fast growing crop.

Choose the correct answer from the options given below having true statement:

िन निलिखत कथन को पिढ़ए:

A. मूली म िपिथनेस गम क फसल म अिधक होती है

B. मूली म िपिथनेस ऑटम क फसल म अिधक होती है

C. मूली के बीज को NAA म िभगोने से अंकुरण व रत होता है

D. मूली कम अविध एवं तीव वृि वाली फसल है

नीचे िदए गए िवक प म से सही कथन वाले िवक प का चयन करो:

[Question ID = 393][Question Description = 143_91_AGR_AUG22_Q43]
1. A, C and D only

केवल A, C और D

[Option ID = 1569]
2. A, B and C only
केवल A, B और C

[Option ID = 1570]
3. B, C and D only
केवल B, C और D

[Option ID = 1571]
4. A, B and D only
केवल A, B और D

[Option ID = 1572]

44) Which of the following is cause of greening disease of citrus?
साइटस के गीिनंग रोग का कारण कौन सा है?

[Question ID = 394][Question Description = 144_91_AGR_AUG22_Q44]
1. Fungi
कवक

[Option ID = 1573]
2. Bacteria
जीवाणु

[Option ID = 1574]
3. Virus
वायरस

[Option ID = 1575]
4. High Temperature
उ च तापमान

[Option ID = 1576]

45) Given below are two statements
Statement I: Arka Anmol is regular bearing mango cultivar and is free from spongy tissue.

Statement II: Arka Aruna is a selection from exotic mango cultivar.

In light of the above statements, choose the most appropriate answer from the options given below

नीचे दो व य िदए गए ह

व य I: अका अनमोल आम क िनयिमत फलन वाली एवं पंजी उ क से मु िक म है

व य II: अका अ णा िवदेशी िक म से चयिनत िक म है

उपरो कथन के स दभ म नीचे िदए गए िवक प म से सबसे उपयु िवक प का चयन क िजये

[Question ID = 395][Question Description = 145_91_AGR_AUG22_Q45]
1. Both Statement I and Statement II are correct
व य I और व य II दोन ही सही ह

[Option ID = 1577]
2. Both Statement I and Statement II are incorrect
व य I और व य II दोन ही गलत ह

[Option ID = 1578]
3. Statement I is correct but Statement II is incorrect
व य I सही है लेिकन व य II गलत है

[Option ID = 1579]
4. Statement I is incorrect but Statement II is correct
व य I गलत है लेिकन व य II सही है

[Option ID = 1580]

46) Match List I with List II

List I List II

Root stock Features

A. Rough Lemon I. Susceptible to tristeza

B. Sour Orange II. Resistant to quick decline

C. Rangpur Lime III. Resistant to gummosis

D. Sweet Orange IV. Have poor germination

Choose the correct answer from the options given below:

सूची I का सूची II से िमलान क िजये

सूची I सूची II

मूल वृ त िवशेषता

A. रफ लेमन I. टी टेज़ा से संवेदनशील

B. ख ा संतरा II. ि वक डी लाईन से पितरोधी

C. रंगपुर लाइम III. गमोिसस से पितरोधी

D. वीट ऑरज IV. कम अंकुरण पितशत

नीचे िदए गए िवक प म से सही िवक प का चयन कर :

[Question ID = 396][Question Description = 146_91_AGR_AUG22_Q46]
1. A ‐ I, B ‐ IV, C ‐ II, D ‐ III

[Option ID = 1581]
2. A ‐ I, B ‐ IV, C ‐ III, D ‐ II

[Option ID = 1582]
3. A ‐ III, B ‐ I, C ‐ IV, D ‐ II

[Option ID = 1583]
4. A ‐ III, B ‐ I, C ‐ II, D ‐ IV

[Option ID = 1584]

47) How many groups of varieties of gladiolus classified by The North American Gladiolus Council?

उ री अमे रक लैडीओलस प रषद ने लैडीओलस क िक म को िकतने समूह म वग कृत िकया है?

[Question ID = 397][Question Description = 147_91_AGR_AUG22_Q47]
1. 4 [Option ID = 1585]
2. 5 [Option ID = 1586]
3. 6 [Option ID = 1587]
4. 7 [Option ID = 1588]

48) Given below are two statements

Statement I: Ornamental crops accounts for about 75 percent global micro propagation industry.

Statement II: Micro propagation in vegetable crops is uneconomical for most of the crops.

In light of the above statements, choose the most appropriate answer from the options given below

नीचे दो व य िदए गए ह

व य I: सू म पवधन का 75 पितशत वैि क उ ोग सजावटी पौध का है

व य II: सि जयो म सू म पवधन अिधकतर फसल के िलए आिथक प से लाभदायक नह है

उपरो कथन के स दभ म नीचे िदए गए िवक प म से सबसे उपयु िवक प का चयन क िजये

[Question ID = 398][Question Description = 148_91_AGR_AUG22_Q48]
1. Both Statement I and Statement II are correct

व य I और व य II दोन ही सही ह

[Option ID = 1589]
2. Both Statement I and Statement II are incorrect

व य I और व य II दोन ही गलत ह

[Option ID = 1590]
3. Statement I is correct but Statement II is incorrect

व य I सही है लेिकन व य II गलत है

[Option ID = 1591]
4. Statement I is incorrect but Statement II is correct

व य I गलत है लेिकन व य II सही है

[Option ID = 1592]

49) Given below are two statements
Statement I: In jam making, pectin is the most essential constituent.

Statement II: Pectin is present in the cell walls of fruits.

In light of the above statements, choose the most appropriate answer from the options given below

नीचे दो व य िदए गए ह

व य I: जेम बनाने के िलए पेि टन अित आव यक संगटक है

व य II: पेि टन फल क कोिशका िभि म उपि थत होता है

उपरो कथन के स दभ म नीचे िदए गए िवक प म से सबसे उपयु िवक प का चयन क िजये

[Question ID = 399][Question Description = 149_91_AGR_AUG22_Q49]
1. Both Statement I and Statement II are correct
व य I और व य II दोन ही सही ह

[Option ID = 1593]
2. Both Statement I and Statement II are incorrect
व य I और व य II दोन ही गलत ह

[Option ID = 1594]
3. Statement I is correct but Statement II is incorrect
व य I सही है लेिकन व य II गलत है

[Option ID = 1595]
4. Statement I is incorrect but Statement II is correct
व य I गलत है लेिकन व य II सही है

[Option ID = 1596]

50) Given below are two statements
Statement I: Ripening in fruits can be retarded by low temperature.

Statement II: Ripening of fruits can be achieved by ethylene.

In light of the above statements, choose the most appropriate answer from the options given below

नीचे दो व य िदए गए ह

व य I: फल म प कवन को कम तापमान से रोका जा सकता है

व य II: ईथीलीन से फल को पकाया जा सकता है

उपरो कथन के स दभ म िनचे िदए गए िवक प मैसे सबसे उपयु िवक प का चयन क िजये

[Question ID = 400][Question Description = 150_91_AGR_AUG22_Q50]
1. Both Statement I and Statement II are correct
व य I और व य II दोन ही सही ह

[Option ID = 1597]
2. Both Statement I and Statement II are incorrect
व य I और व य II दोन ही गलत ह

[Option ID = 1598]
3. Statement I is correct but Statement II is incorrect
व य I सही है लेिकन व य II गलत है

[Option ID = 1599]
4. Statement I is incorrect but Statement II is correct
व य I गलत है लेिकन व य II सही है

[Option ID = 1600]

Topic:‐ ABC01_Biology

1) Species are considered as

पजाितयां मानी जाती है

[Question ID = 401][Question Description = 101_39_BIO_AUG22_Q01]
1. hypothetical units of classification devised by taxonomists.

टै सोनॉिम ट ारा िवकिसत वग करण क आभासीय इकाइयां

[Option ID = 1601]
2. real basic unit of classification.

वग करण क वा तिवक मूल इकाई

[Option ID = 1602]
3. artificial concept of human mind which can not be defined in absolute term.

मानव मि त क क कृितम अवधारणा, िजसे पूण अविध म प रभािषत नह िकया जा सकता

[Option ID = 1603]
4. local names of organisms.

जीव के थानीय नाम

[Option ID = 1604]

2) Gambusia is a

गंबिू शया एक ‐

[Question ID = 402][Question Description = 102_39_BIO_AUG22_Q02]
1. pest of fishes

मछिलय के पीडक

[Option ID = 1605]
2. parasitic fish

परजीवी मछली

[Option ID = 1606]
3. predator of mosquito larvae

म छर लावा का िशकारी

[Option ID = 1607]
4. that transimits yellow fever mosquito

म छर िजसके ारा पीला बुखार फैलता है

[Option ID = 1608]

3) Match List I with List II

List I List II

A. Lactobacillus I. Baking industry

B. Saccharomyces cerevisiae II. Production of Citric Acid

C. Propinibacterium shermaniiIII. Production of curd from milk

D. Aspergillus niger IV. Production of cheese

Choose the correct answer from the options given below:

सूची I के साथ सूची II सुमेिलत क िजए :

सूची I सूची II

A. ले टो बेसीलस I. बेिकंग उ ोग

B. सैकरोमाइसेस सेरेिविसया II. साइिटक एिसड का उ पादन

C. पोिपनीबै टी रयम शेरमनी III. दूध से दही का उ पादन

D. ए पिगलस नाइजर IV. पनीर का उ पादन

नीचे िदए गए िवक प म से सही जवाब चुन :

[Question ID = 403][Question Description = 103_39_BIO_AUG22_Q03]
1. A ‐II , B ‐III , C ‐I , D ‐IV

[Option ID = 1609]
2. A ‐IV , B ‐III , C ‐II , D ‐I

[Option ID = 1610]
3. A ‐III , B ‐I , C ‐IV , D ‐II

[Option ID = 1611]
4. A ‐ IV, B ‐I , C ‐II , D ‐III

[Option ID = 1612]

4) Select correct combinations which differentiate conventional breeding from genetic engineering

A. works by process of selection

B. permits the movement of genetic material between different varieties with in species

C. product emphasizes new characters

D. process occurs in nature

E. allows the movement of genetic material from one organism to other organisms

Choose the correct answer from the options given below:

आनुवांिशक इंजीिनय रंग से पारंप रक पजनन को अलग करने वाले सही संयोजन चुन ‐

A. चयन पिकया ारा काय करता है

B. एक जाित को िभ न िक म के बीच आनुवांिशक सामगी क आवाजाही कराना

C. उ पाद नए गुण पर जोर देता है

D. पिकया पकृित म होती है

E. एक जीव से दूसरे जीव म आनुवांिशक सामगी क आवाजाही क अनुमित देता है

नीचे िदए गए िवक प से जवाब चुन◌ः

[Question ID = 404][Question Description = 104_39_BIO_AUG22_Q04]
1. A, B and D only

A, B और D केवल

[Option ID = 1613]
2. B and D only

B और D केवल

[Option ID = 1614]
3. B, C and E only

B, C और E केवल

[Option ID = 1615]
4. A, B and E only

A, B और E केवल

[Option ID = 1616]

5) Given below are two statements

Statement I: Vaccine production includes the use of weakend pathogen to stimulate the immune system of an organism.

Statement II: Vaccine production is the introduction of any gene encoding immunogenic protein and expression in
mammalian cells using recombinent DNA technology.

In light of the above statements, choose the most appropriate answer from the options given below

नीचे दो व य िदए गए ह

व य I ‐ वै सीन उ पादन म एक जीव क पितर ा पणाली को उ िे जत करने के िलए कमजोर रोगज़नक़ का उपयोग शािमल है |

व य II ‐ वै सीन उ पादन िकसी भी जीन ए कोिडंग पितर ाज य पोटीन क शु आत और पुनः संयोजक डीएनए पौ ोिगक का उपयोग कर तनधारी
कोिशकाओं म अिभ यि है

उपयु व य के आलोक म िन नांिकत िवक प म से सही उ र चुन :

[Question ID = 405][Question Description = 105_39_BIO_AUG22_Q05]
1. Both Statement I and Statement II are correct

व य I और व य II दोन ही सही ह

[Option ID = 1617]
2. Both Statement I and Statement II are incorrect

व य I और व य II दोन ही गलत ह

[Option ID = 1618]
3. Statement I is correct but Statement II is incorrect

व य I सही है लेिकन व य II गलत है

[Option ID = 1619]
4. Statement I is incorrect but Statement II is correct

व य I गलत है लेिकन व य II सही है

[Option ID = 1620]

6) Which of the following is characterised by endoskeleton consisting of ossicles, a hard plate of Magnesium Carbonate and
Calcium Carbonate crystal?

िन निलिखत म से कौन सा अंतःकंकाल मै नीिशयम काब नेट और कैि शयम काब नेट िक टल क एक हाड लेट से बना होता है?

[Question ID = 406][Question Description = 106_39_BIO_AUG22_Q06]
1. Arthropods

संिधपाद

[Option ID = 1621]
2. Echinoderms

एिकनोड स

[Option ID = 1622]
3. Sponges

पंज

[Option ID = 1623]
4. Coelenterates

िसले टटे स

[Option ID = 1624]

7) Which of the following DOES NOT belong to kingdom Protista?

िन निलिखत म से कौन सा जगत पोित ता का नह है?

[Question ID = 407][Question Description = 107_39_BIO_AUG22_Q07]
1. Amoeba

एमीबा

[Option ID = 1625]
2. Slime moulds

लाइम मो ड

[Option ID = 1626]
3. Dinoflagelates

डायनो लैगल
े े स

[Option ID = 1627]
4. Mycoplasma

माइको ला म

[Option ID = 1628]

8) The Immunoglobulin present in the mother's milk is

मां के दूध म मौजूद इ यूनो लोबुिलन है

[Question ID = 408][Question Description = 108_39_BIO_AUG22_Q08]
1. Ig M

आईजी एम

[Option ID = 1629]
2. Ig D

आईजी डी

[Option ID = 1630]
3. Ig A

आईजी‐ए

[Option ID = 1631]
4. Ig E

आईजी‐ई

[Option ID = 1632]

9) Which property of water molecules enables it to function as a moderator of temperature for living organisms?

पानी के अणु ओ ं का कौन सा गुण इसे जीिवत जीव के िलए तापमान के िनयंतक के प म काय करने म स म बनाता है?

[Question ID = 409][Question Description = 109_39_BIO_AUG22_Q09]
1. High specific heat

उ च िविश गम

[Option ID = 1633]
2. High heat of vaporization

वा पीकरण क उ च गम

[Option ID = 1634]
3. Low surface tension

िन न सतही तनाव

[Option ID = 1635]
4. High cohesion

उ च संसजन

[Option ID = 1636]

10) Select the group of organisms belonging to the same phylum

एक ही फाइलम से संबंिधत जीव के समूह का चयन कर

[Question ID = 410][Question Description = 110_39_BIO_AUG22_Q10]
1. Sea anemone, Sea pen, Sea fan

सी एनीमोन, सी पेन, सी फैन

[Option ID = 1637]
2. Sea mouse, Sea urchin, Sea anemone

सी माउस, सी अिचन, सी एनीमोन

[Option ID = 1638]
3. Jelly fish, Cuttle fish, Silver fish

जेली िफश, कटल िफश, िस वर िफश

[Option ID = 1639]
4. Devil fish, Star fish, Silver fish

डैिवल िफश, टार िफश, िस वर िफश

[Option ID = 1640]

11) Which one of the following pair is NOT correctly matched?

िन न म से कौन सा जोड़ा सही ढंग से मेल नह खाता?

[Question ID = 411][Question Description = 111_39_BIO_AUG22_Q11]
1. Vitamin B12‐‐‐‐‐‐‐‐‐‐Pernicious anemia

िवटािमन बी 12‐‐‐‐‐‐‐‐‐‐ खतरनाक एनीिमया

[Option ID = 1641]
2. Vitamin B6‐‐‐‐‐‐‐‐‐‐Convulsions

िवटािमन बी6‐‐‐‐‐‐‐‐‐‐‐भूख न लगना

[Option ID = 1642]
3. Vitamin B1‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐Beriberi

िवटािमन बी1‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐बेरी‐बेरी

[Option ID = 1643]
4. Vitamin B2‐‐‐‐‐‐‐‐‐‐‐‐‐Pellagra

िवटािमन बी 2‐‐‐‐‐‐‐‐‐‐‐‐‐पेलागा

[Option ID = 1644]

12) A toxic insecticidal protein produced by Bacillus thuringienses kills certain insects but do not kill the bacteria
themselves because

एक िवषा क टनाशक पोटीन जो बैिसलस थु रंिगए स और कुछ क ट को मारते ह | लेिकन बै टी रया को वयं ख म नह करते ह य िक

[Question ID = 412][Question Description = 112_39_BIO_AUG22_Q12]
1. Protein enclosed in special sac

िवशेष थैली म संल न पोटीन

[Option ID = 1645]
2. Protein is immature in denatured form

पोटीन िनि कय अव था म

[Option ID = 1646]
3. Protein exist in Protoxin form

पोटीन पोटॉि सन अव था म

[Option ID = 1647]
4. Bacteria ressistant to the protein

पोटीन के िलए बै टी रया पितरोधी

[Option ID = 1648]

13) All living organism exhibits

A. Dynamic state

B. Regulatory mechanism

C. Exchange of matter

D. No equilibrium between anabolic and catabolic reactions

E. Steady state

Choose the correct answer from the options given below

सभी जीिवत पाणी पदिशत करते ह

A. गितशील अव था

B. िविनयामक तंत

C. सामगी का आदान‐पदान

D. एनाबोिलक और कैटाबोिलक के बीच संतुलन नह

E. ि थर अव था

नीचे िदए गए िवक प से जवाब चुन

[Question ID = 413][Question Description = 113_39_BIO_AUG22_Q13]
1. A, B, & C only

A, B, और C केवल

[Option ID = 1649]
2. A, C & E only

A, C और E केवल

[Option ID = 1650]
3. B, C & E only

B, C और E केवल

[Option ID = 1651]
4. C, D & E only

C, D और E केवल

[Option ID = 1652]

14) "Early oceans were a solution of organic molecules, a primitive soup, from which life arose", hypothesis was proposed
by

''आर भ म समुद काबिनक अणु ओ ं का घोल था, िजस पाचीन सुप से जीवन का उ व हआ'' िस ांत का पितपादन िन न ारा िकया गया ‐

[Question ID = 414][Question Description = 114_39_BIO_AUG22_Q14]
1. S. W. Fox

एस. ड यू. फॉ स

[Option ID = 1653]
2. Spallanzani

पलांजानी

[Option ID = 1654]
3. Melwin Calvin

मेलिवन कैि वन

[Option ID = 1655]
4. Haldane

हेलडेन

[Option ID = 1656]

15) Evolution of group of animals in different directions is ‐

िविभ न िदशाओं म पशु ओ ं के समूह का िवकास ‐

[Question ID = 415][Question Description = 115_39_BIO_AUG22_Q15]
1. Convergence

अिभसरण

[Option ID = 1657]
2. Parallel Evolution

समानांतर िवकास

[Option ID = 1658]
3. Adaptive Evolution

अनुकल
ू ी िवकास

[Option ID = 1659]
4. Progressive Evolution

पगितशील िवकास

[Option ID = 1660]

16) Match List I with List II

List I List II

A. Origin of mammals I. Paleozoic

B. Age of prokaryotic microbes II. Triassic period

C. C‐First tetrapods appearance III. Devonian period

D. Appearnce of bipedal human ancestorsIV. Eocene

V. Pliocene

Choose the correct answer from the options given below:

सूची ‐I को सूची ‐II से सुमेिलत क िजए :

सूची ‐I सूची ‐II

A. तनधा रय क उ पि I. पैिलयोज़ोइक

B. पोकै रयोिटक सुक जीवो का काल II. टाइऐिसक अविध

C. पहले चतुपाद का उ व III. िडवोिनयन अविध

D. पूवज म ि पाद अव था IV. इयोसीन

V. पलायोसीन

नीचे िदए गए िवक प म से सही उ र चुिनए :

[Question ID = 416][Question Description = 116_39_BIO_AUG22_Q16]
1. A ‐ II, B ‐ V, C ‐ III, D ‐ I

[Option ID = 1661]
2. A ‐ II, B ‐ I, C ‐ III, D ‐ V

[Option ID = 1662]
3. A ‐ IV, B ‐ V, C ‐ II, D ‐ I

[Option ID = 1663]
4. A ‐ II, B ‐ I, C ‐ V, D ‐ IV

[Option ID = 1664]

17) Arrange the PERIODS of geological time scale in ascending order (starting oldest one)
A. Devonian

B. Triassic

C. Jurassic

D. Silurian

E. Ordovician

Choose the correct answer from the options given below

भू‐ वै ािनक समय पैमाने क अविध को आरोही कम म यवि थत करना (सबसे पुरानी अविध से शु करना)

A. िडवोिनयन

B. टाइएिसक

C. जुरिे सक

D. िस यू रयन

E. आड िविसयन

नीचे िदए गए िवक प म से सही उ र चुन :

[Question ID = 417][Question Description = 117_39_BIO_AUG22_Q17]
1. E > D > A > B > C

[Option ID = 1665]
2. B > A > C > D > E

[Option ID = 1666]
3. C > B > A > D > E

[Option ID = 1667]
4. E > A> B > D> C

[Option ID = 1668]

18) Select the connecting link between chordates and non‐chordates ‐

कॉडट और नॉन‐कॉडट के बीच कनेि टंग िलंक का चयन कर ‐

[Question ID = 418][Question Description = 118_39_BIO_AUG22_Q18]
1. Peripatus

पेरीपटस

[Option ID = 1669]
2. Sphenodon

फेनोडन

[Option ID = 1670]
3. Balanoglossus

बैलानो लोसस

[Option ID = 1671]
4. Archaeopteryx

आिकयो टेरे स

[Option ID = 1672]

19) Select the homologous organ/s from the list‐

A. Bat's wing

B. Cat's paw

C. Butterfly wings

D. Lizard's tail

E. Wisdom tooth

Choose the correct answer from the options given below:

सूची म से सम प अंग चुन

A. चमगादड़ का पंख

B. िब ली क पंजा

C. िततली के पंख

D. िछपकली क पूंछ

E. अ कल दाड

नीचे िदए गए िवक प से जवाब चुन◌ः

[Question ID = 419][Question Description = 119_39_BIO_AUG22_Q19]
1. A and B only

A और B केवल

[Option ID = 1673]
2. A, D and E only

A, D और E केवल

[Option ID = 1674]
3. A, B, C and D only

A, B, C और D केवल

[Option ID = 1675]
4. B, D and E only

B, D तथा E केवल

[Option ID = 1676]

20) Thorns of Bougainvillea and tendril of Passiflora are

बोगनिविलया के कांटे और पेिस लोरा के टिडल ......... ह

[Question ID = 420][Question Description = 120_39_BIO_AUG22_Q20]
1. Analogous organs

अनु पता अंग

[Option ID = 1677]
2. Homologous organs

होमोलोगस अंग

[Option ID = 1678]
3. Vestigeal organs

अवशैषी अंग

[Option ID = 1679]
4. Endamic organs

थािनक अंग

[Option ID = 1680]

21) Fungi

A. Sacharomyces cerevisiae is used in baking and brewing industry

B. All have saprophytic mode of nutrition

C. Possess chlorophyll which may be masked by other pigments

D. The hyphal wall consists of cellulose (chitin)

E. Common mushrooms are fungi

Choose the correct answer from the options given below:

कवक

A. Sacharomyces cerevisiae का उपयोग बेिकंग और बइू ग
ं उ ोग म िकया जाता है

B. सभी म पोषण क मृतोपजीवी िवधा होती है

C. लोरोिफल होता है िजसे अ य रंजक ारा िछपाया जा सकता है

D. हाइपल दीवार म से युलोज (िचिटन) होता है

E. आम मश म कवक ह

नीचे िदए गए िवक प म से सही उ र चुिनए:

[Question ID = 421][Question Description = 121_39_BIO_AUG22_Q21]
1. A, B and D only

A, B और D केवल

[Option ID = 1681]
2. A, C and E only

A, C और E केवल

[Option ID = 1682]
3. B, C and D only

B, C और D केवल

[Option ID = 1683]
4. A, D and E only

A, D और E केवल

[Option ID = 1684]

22) The transverse section of a plant material shows the following anatomical features

a) epidermis

b)The vascular bundles are arranged in a ‘ring’ and

c) Each vascular bundle is conjoint, open with endarch protoxylem.

This plant material is a

पौधे क सामगी का अनुप थ अनुभाग िन निलिखत शारी रक िवशेषताओं को दशाता है‐

क) बा वचा

ख) संवहयी बंडल एक रंग म यवि थत िकए जाते ह और

ग) प येक संवहनी बंडल एंडाक पोटॉ साइलम के साथ खुला होता है

इस पौधे क सामगी को आप िकस प म पहचानगे?

[Question ID = 422][Question Description = 122_39_BIO_AUG22_Q22]
1. Monocotyledonous Stem

एकबीजपती तना

[Option ID = 1685]
2. Monocotyledonous Root

एकबीजपती जड़

[Option ID = 1686]
3. Dicotyledonous Stem

ि बीजपती तना

[Option ID = 1687]
4. Dicotyledonous Root

ि बीजपती जड़

[Option ID = 1688]

23) Which of the following are used as food?

िन निलिखत म से कौन सा भोजन के प म उपयोग िकया जाता है

[Question ID = 423][Question Description = 123_39_BIO_AUG22_Q23]
1. Agaricus and Morchella

अगरीकस और मोचला

[Option ID = 1689]
2. Aspergillus and Penicillium

ए पिजलस और पेिनिसिलयम

[Option ID = 1690]
3. Mucor and Rhizopus

यूकोर और राइज़ोपस

[Option ID = 1691]
4. Puccinia and Ustilago

प सीिनया और अ टीलगो

[Option ID = 1692]

24) Match List I with List II

List I List II
A. E.coli I. Agar‐agar production
B. Claviceps pupurea II. Alkaloid from this is used in cough medicines
C. Ephedra III. Alkaloid obtained is used during childbirth
D. Gelidium and Gracilaria IV. Assists digestion in human body
Choose the correct answer from the options given below:

सूची ‐I को सूची ‐II से सुमेिलत क िजए :

सूची ‐I सूची ‐II
A. E.coli I. अगार‐अगार उ पादन

II. इससे िमलने वाले अ कलॉइड का इ तेमाल खांसी
B. Claviceps pupurea
क दवा म िकया जाता है
III. पा अ कलॉइड का उपयोग ब चे के ज म के दौरान
C. Ephedra
िकया जाता है
D. Gelidium तथा Gracilaria IV. मानव शरीर म पाचन म सहायता करता है
नीचे िदए गए िवक प म से सही उ र चुिनए :

[Question ID = 424][Question Description = 124_39_BIO_AUG22_Q24]
1. A ‐ IV , B ‐ III , C ‐ II , D ‐ I

[Option ID = 1693]
2. A ‐ II , B ‐ III , C ‐ IV , D ‐ I

[Option ID = 1694]
3. A ‐ III , B ‐ IV , C ‐ I , D ‐ II

[Option ID = 1695]
4. A ‐ IV , B ‐ III , C ‐ I, D ‐ II

[Option ID = 1696]

25) Given below are two statements

Statement I: Plasmolysis occurs when water moves out of the cell and the cell membrane of the plant cell shrinks away from
the cell wall

Statement II: If the external solution is more dilute than the cytoplasm, it is said to be HYPOTONIC

In light of the above statements, choose the correct answer from the options given below

नीचे दो व य िदए गए ह

व य‐ I : ला मोिलिसस तब होता है जब पानी कोिशका से बाहर िनकल जाता है और पादप कोिशका क कोिशका िझ ली कोिशका िभि से दूर िसकुड़ जाती है

व य‐II : यिद बा िवलयन साइटो ला म से अिधक तनु है, तो वह अ पपरासारी कहलाता है

उपरो दो व य के कम म िन न म से सही उ र का चयन कर :

[Question ID = 425][Question Description = 125_39_BIO_AUG22_Q25]
1. Both Statement I and Statement II are true

व य‐I और व य‐II दोन ही सही ह

[Option ID = 1697]
2. Both Statement I and Statement II are false

व य I और व य II दोन ही झूठे ह

[Option ID = 1698]
3. Statement I is true but Statement II is false

व य I सच लेिकन व य II गलत है

[Option ID = 1699]
4. Statement I is false but Statement II is true

व य‐I गलत है लेिकन व य‐II सच है

[Option ID = 1700]

26) The following features are seen in the flowers of a plant:

a) Male and Female reproductive organs are found on separate flowers,

b) The male flowers have long filaments, terminating into exposed anther lobes,

c) The female flowers have long feather‐like stigma.

The flowers of this plant are most likely to be pollinated by

पौधे के फूल म िन निलिखत िवशेषताएं िदखाई देती ह :

a) नर और मादा पजनन अंग पर अलग‐अलग फूल पर पाए जाते ह

b) नर फूल म लंबे तंतु होते ह, जो खुले परागकोश ख ड म समा होते ह

c) मादा फूल म लंबे पंख जैसे वितकाग होते ह

इस पौधे के फूल के परागण िन न से होने क संभावना है :

[Question ID = 426][Question Description = 126_39_BIO_AUG22_Q26]
1. Water

जल

[Option ID = 1701]
2. Wind

हवा

[Option ID = 1702]
3. Bats

चमगादड़

[Option ID = 1703]
4. Birds

पि य

[Option ID = 1704]

27) Which of the following is NOT an application of tissue culture?

िन निलिखत म से कौन सा ऊतक संवधन का अनुपयोग नह है?

[Question ID = 427][Question Description = 127_39_BIO_AUG22_Q27]
1. Rapid Clonal Propagation

व रत लोनल पसार

[Option ID = 1705]
2. Somaclonal variations

सोमे लोनल िभ नता

[Option ID = 1706]
3. Embryo Rescue

भूण बचाव

[Option ID = 1707]
4. Transgenic Plants

टांसजेिनक पौधे

[Option ID = 1708]

28) Bt cotton is a

बीटी कपास एक

[Question ID = 428][Question Description = 128_39_BIO_AUG22_Q28]
1. Cloned Plant

लोन िकए गए पौधे

[Option ID = 1709]
2. Hybrid Plant

हाइिबड पादप

[Option ID = 1710]
3. Mutated Plant

प रवितत पादप

[Option ID = 1711]
4. Transgenic Plant

टांसजेिनक पादप

[Option ID = 1712]

29) Sequentially arrange the following stages nodule formation in plants?

A. Bacteria cause the cortical and pericycle cells to divide, forming a nodule

B. Nodule has vascular connections continuous with those of the root

C. Rhizobium bacteria contact a susceptible root hair

D. Infection thread carries bacteria to inner cortex

E. Successful infection of root hair causes it to curl

Choose the correct answer from the options given below

पौध म नो यूल के गठन के पमुख चरण को कमानुसार यवि थत कर :

A. बै टी रया कॉिटकल और पेरीसाइिकल कोिशकाओं को िवभािजत करने का कारक बनते ह तथा एक नो यूल बनाते ह

B. नो यूल म संवहनी संबंध जड़ के साथ िनरंतर होते ह

C. राइजोिबयम बै टी रया संवेदनशील जड़ के रेशे से संपक करते ह

D. संकमण धागा बै टी रया को आंत रक पांत था म ले जाता है

E. जड़ के रेश के सफल संकमण के कारण वे घुमावदार हो जाते ह

नीचे िदए गए िवक प म से सही उ र चुिनए

[Question ID = 429][Question Description = 129_39_BIO_AUG22_Q29]
1. A, B, C, D, E

[Option ID = 1713]
2. C, A, B, E, D

[Option ID = 1714]
3. A, C, D, B, E

[Option ID = 1715]
4. C, E, D, A, B

[Option ID = 1716]

30) Which of the following is used as a biocontrol agent against Lepidopteran larvae?

िन निलिखत म से कौन लेपीडोपटेरन लारवे के िखलाफ बायोकंटोल एजट के प म उपयोग िकया जाता है?

[Question ID = 430][Question Description = 130_39_BIO_AUG22_Q30]
1. Trichoderma

ितकोडमा

[Option ID = 1717]
2. Streptococcus

टे टोकॉकस

[Option ID = 1718]
3. Bacillus thurigiensis

बैिसलस थु रजिसस

[Option ID = 1719]
4. Saccharomyces cerevisiae

सैकेरोमाइसेस सेरिे विसया

[Option ID = 1720]

31) Sliding filament model of muscle contraction

A. the area adjacent to the Z‐line, where actin myofilaments are not superimposed by myosin myofilaments is I‐band.

B. expansion and contraction only occur within the A band, whereas I and H‐bands remain constant.

C. M‐line is at the center of a sarcomere to which myosin myofilaments bind

D. without ATP, muscles would remain in their contracted state, rather than in their relaxed state

E. thick filaments are composed primarily of actin, tropomyosin, and troponin

Choose the correct answer from the options given below:

मांसपेिशय के संकच
ु न का लाइिडंग िफलामट मॉडल

A. जेड‐लाइन के बगल का ेत, जहां मायोिसन मायोिफलमट ारा एि टन मायोिफलमट अिधरोिपत नह िकया जाता है, वह आई‐ब ड है

B. िव तार और संकच
ु न केवल ए ब ड के भीतर होता है, जबिक आई और एच‐ब ड ि थर रहते ह

C. एम‐रेखा, मायोिसन और मायोिफलामट के जोड़ वाले साक िमयर के कद पर होती है

D. एटीपी के िबना मांसपेिशयां अपनी िशिथल अव था म रहने के बजाय अपनी अनुबंिधत अव था म रहती ह

E. मोटाई वाले िफलामट मु य प से एि टन, टोपोमायोिसन और टोपोिनन से बने होते ह

नीचे िदए गए िवक प से जवाब चुन :

[Question ID = 431][Question Description = 131_39_BIO_AUG22_Q31]
1. A, C and D only

A, C और D केवल

[Option ID = 1721]
2. B, D and E only

B, D और E केवल

[Option ID = 1722]
3. C, D and E only

C, D और E केवल

[Option ID = 1723]
4. A, B and D only

A, B और D केवल

[Option ID = 1724]

32) During the parturition, the baby’s head is pushing against the cervix causing the cervix wall to stretch. This stretching
causes nerve impulses to be sent to the hypothalamus which directs the posterior pituitary to release oxytocin in the blood.
Oxytocin stimulates the uterus to contract which pushes the baby’s head deeper into the cervix, stretching it further. This
situation is a description of which of the following?

पसव के दौरान, ब चे का िसर गभाशय गीवा के सामने धकेल रहा है िजससे गीवा क दीवार फैल जाती है यह िखंचाव तंितका आवेग को हाइपोथैलेमस म भेजता है जो
पीछे के िप यूटरी को र म ऑ सीटोिसन जारी करने का िनदश देता है ऑ सीटोिसन गभाशय को संकिु चत करने के िलए पो सािहत करता है जो ब चे के िसर को
गभाशय गीवा म गहराई से धकेल देता है, इसे आगे बढ़ाता है यह ि थित िन निलिखत म से िकस का वणन करती है?

[Question ID = 432][Question Description = 132_39_BIO_AUG22_Q32]
1. negative feedback

नकारा मक पितिकया

[Option ID = 1725]
2. positive feedback

सकारा मक पितिकया

[Option ID = 1726]
3. homeostasis

सम थैितक

[Option ID = 1727]
4. an afferent pathway to an integrating centre

एक कृत कद तक पहच
ं ने का रा ता

[Option ID = 1728]

33) Which of the following describes the DNA content of human female gametes before the attainment of puberty?

िन निलिखत म से कौन सा यौवन पा करने से पहले मानव मिहला गैमेट क डीएनए सामगी का वणन करता है?

[Question ID = 433][Question Description = 133_39_BIO_AUG22_Q33]
1. 46 chromosomes, 92 chromatids

46 कोमोसोम, 92 कोमेिट स

[Option ID = 1729]
2. 23 chromosomes, 23 chromatids

23 कोमोसोम, 23 कोमेिट स

[Option ID = 1730]
3. 23 chromosomes, 46 chromatids

23 कोमोसोम, 46 कोमेिट स

[Option ID = 1731]
4. 46 chromosomes, 46 chromatids

46 कोमोसोम, 46 कोमेिट स

[Option ID = 1732]

34) Cancellous bone contains

जालीदार अि थ म होता है

[Question ID = 434][Question Description = 134_39_BIO_AUG22_Q34]
1. lamellae and osteocytes but no trabeculae

लेमल
े ा और ऑि टयोसाइट लेिकन कोई टैबे यूला नह

[Option ID = 1733]
2. trabeculae, canaliculi and osteons

ु े, कैनािलकुली और ऑि टयन
टाबेकल

[Option ID = 1734]
3. haversian systems and canaliculi but no osteons

हेविसयन तंत और कैनािलकुली लेिकन ऑि टयन नह

[Option ID = 1735]
4. trabeculae and lamellae but no osteons

टाबेकल
ु ा और लेमल
े ा लेिकन ऑि टयन नह

[Option ID = 1736]

35) Transmission of sound waves from the outer ear to the inner ear

A. auditory canal

B. cochlea

C. stapes

D. tympanic membrane

E. malleus

Choose the correct answer from the options given below

बाहरी कान से आंत रक कान तक विन तरंग का संचरण

A. शवण नाल

B. काकिलया

C. टे स

D. िट पैिनक िझ ली

E. मैिलयस

नीचे िदए गए िवक प से जवाब चुन

[Question ID = 435][Question Description = 135_39_BIO_AUG22_Q35]
1. D, B, A, E, C

[Option ID = 1737]
2. A, E, C, D, B

[Option ID = 1738]
3. D, C, E, B, A

[Option ID = 1739]
4. A, D, E, C, B

[Option ID = 1740]

36) Match List I with List II

List I List II

A. Kyoto I. reconcile worldwide economic development with

protocol protection of the environment

B. The II. measures to protect human health and the
Montreal environment resulting from modifications to the
protocol ozone layer

C. Vienna
III. limit and reduce greenhouse gases emissions
convention

D. Rio de
IV. phasing out the production and consumption of
Janeiro
ozone‐depleting substances
conference

V. proposal to construct wildlife sanctuaries

Choose the correct answer from the options given below:

सूची ‐I को सूची ‐II से सुमेिलत क िजए :

सूची ‐I सूची ‐II

I. पयावरण क सुर ा के साथ िव यापी आिथक िवकास म
A. योटो पोटोकॉल
सामंज य थािपत करता है

II. ओजोन परत म संशोधन के प रणाम व प मानव वा य और
B. मॉि टयल पोटोकॉल
पयावरण क र ा के उपाय

C. िवयना क वशन III. गीनहाउस गैस के उ सजन को सीिमत और कम कर

D. रयो डी जने रयो IV. ओजोन‐ यकारी पदाथ के उ पादन और खपत को चरणब
स मेलन तरीके से समा करना

V. व यजीव अ यार य बनाने का प ताव

नीचे िदए गए िवक प म से सही उ र चुिनए :

[Question ID = 436][Question Description = 136_39_BIO_AUG22_Q36]
1. A ‐II , B ‐I , C ‐III , D ‐V

[Option ID = 1741]
2. A ‐III , B ‐IV , C ‐II , D ‐I

[Option ID = 1742]
3. A ‐IV , B ‐III , C ‐V , D ‐II

[Option ID = 1743]
4. A ‐I , B ‐III , C ‐II , D ‐IV

[Option ID = 1744]

37) Regarding climatic factors that influence decomposition, select the correct statement

िवघटन को पभािवत करने वाले जलवायु कारक के संबंध म, सही बयान का चयन कर

[Question ID = 437][Question Description = 137_39_BIO_AUG22_Q37]
1. Cool and moist environment favour decomposition

ठंडा और नम वातावरण िवघटन के अनुकल
ू है

[Option ID = 1745]
2. Warm and moist environment inhibit decomposition

गम और नम वातावरण िवघटन को रोकता है

[Option ID = 1746]
3. Low temperature and anaerobiosis inhibit decomposition

कम तापमान और अवायवीयता िवघटन को रोकता है

[Option ID = 1747]
4. High temperature and anaerobiosis inhibit decomposition

उ च तापमान और अवायवीयता िवघटन को रोकता है

[Option ID = 1748]

38) Glucose is NOT normally found in the urine because it

मूत म आमतौर पर लूकोज नह पाया जाता है य िक यह

[Question ID = 438][Question Description = 138_39_BIO_AUG22_Q38]
1. does not pass through the walls of the glomerulus

लोमे लस क दीवार से नह गुजरता है

[Option ID = 1749]
2. is kept in the blood by colloid osmotic pressure

कोलाइड ऑ मोिटक दबाव ारा र म रखा जाता है

[Option ID = 1750]
3. is reabsorbed by the tubule cells

नली कोिशकाओं ारा पुनः अवशोिषत िकया जाता है

[Option ID = 1751]
4. is removed by the body cells before the blood reaches the kidney

र गुद तक पहच
ं ने से पहले शरीर क कोिशकाओं ारा हटाया जाता है

[Option ID = 1752]

39) Given below are two statements, one is labelled as Assertion A and the other is labelled as Reason R

Assertion (A): Primary succession is a slow process

Reason (R): To establish a biotic community, fertile soil must be formed

In light of the above statements, choose the correct answer from the options given below

नीचे दो कथन िदए गए ह : एक को अिभकथन (A) और दूसरे को तक (R) कहा गया है

अिभकथन (A) : पाथिमक अनुकम
ृ न एक धीमी पिकया है

तक (R) : जैिवक समुदाय क थापना के िलए उपजाऊ िम ी का िनमाण आव यक है

उपयु कथन के आलोक म िन नांिकत िवक प म से सही उ र चुन :

[Question ID = 439][Question Description = 139_39_BIO_AUG22_Q39]
1. Both A and R are true and R is the correct explanation of A

(A) और (R) दोन सही ह और (R), (A) क सही या या है

[Option ID = 1753]
2. Both A and R are true but R is NOT the correct explanation of A

(A) और (R) दोन सही ह पर तु (R), (A) क सही या या नह है

[Option ID = 1754]
3. A is true but R is false

(A) सही है पर तु (R) सही नह ह

[Option ID = 1755]
4. A is false but R is true

(A) सही नह है पर तु (R) सही ह

[Option ID = 1756]

40) If the sun were to suddenly stop providing energy to earth, most ecosystems would vanish. Which of the following
ecosystems would likely survive the longest after this hypothetical disaster?

अगर सूय ने अचानक पृ वी को ऊजा देना बंद कर िदया, तो अिधकांश पा रि थितक तंत गायब हो जाएंगे इस का पिनक आपदा के बाद िन निलिखत पा रि थितक
पणािलय म से कौन सा सबसे लंबे समय तक जीिवत रहेगा?

[Question ID = 440][Question Description = 140_39_BIO_AUG22_Q40]
1. tropical rain forest

उ णकिटबंधीय वषा वन

[Option ID = 1757]
2. benthic ocean

ब िथक महासागर

[Option ID = 1758]
3. tundra

टुड
ं ा

[Option ID = 1759]
4. grass land

घासभूिम

[Option ID = 1760]

41) A DNA double helix is 340nm long. The number of nucleotides in this DNA is

डीएनए डबल हेिल स 340 nm लंबे समय तक इस डीएनए म यूि लयोटाइड क सं या है

[Question ID = 441][Question Description = 141_39_BIO_AUG22_Q41]
1. 1000

[Option ID = 1761]
2. ​2000

[Option ID = 1762]
3. 200

[Option ID = 1763]
4. 20

[Option ID = 1764]

42) In a DNA sample, the ratio of the Adenine + Guanine and Thymine + Cytosine is 0.9. Calculate the same ratio in
complementary DNA strands.

डीएनए नमूने म, एडेिनन + वािनन और थायमाइन + साइटोिसन का अनुपात 0.9 है पूरक डीएनए ट ड म समान अनुपात क गणना कर

[Question ID = 442][Question Description = 142_39_BIO_AUG22_Q42]
1. 0.9

[Option ID = 1765]
2. ​1.11

[Option ID = 1766]
3. 0.14

[Option ID = 1767]
4. 2

[Option ID = 1768]

43) What is the number of nitrogenous bases if the length of the E. coli DNA is 5.78mm?

यिद डीएनए क लंबाई 5.78 िममी है तो नाइटोजन ार क सं या िकतनी है?

[Question ID = 443][Question Description = 143_39_BIO_AUG22_Q43]
1. 16 x 10‐9

[Option ID = 1769]
2. 17 x 10‐9

[Option ID = 1770]
3. ​17 x 10‐6

[Option ID = 1771]
4. 16 x 10‐6

[Option ID = 1772]

44) Sphincter of Oddi is present in

फ टर ऑफ आडी पाया जाता है

[Question ID = 444][Question Description = 144_39_BIO_AUG22_Q44]
1. the mucosa of stomach

अमा म क े मा िझ ली

[Option ID = 1773]
2. the submucosa of duodenum

यूिडनम क उप े मा िझ ली

[Option ID = 1774]
3. the hepatic lobule

हैि टक लो यूल

[Option ID = 1775]
4. the junction of hepato‐ pancreatic duct

है टो ‐ पैनिकयास के जोड़ पर

[Option ID = 1776]

45) The thalloid stage of gametophyte in mosses is

काई के यु मकोदिमद क थाईलायड तर म

[Question ID = 445][Question Description = 145_39_BIO_AUG22_Q45]
1. Gemma cup

मुकल
ु कप

[Option ID = 1777]
2. Protonema

पोटीनीमा

[Option ID = 1778]
3. Prothallus

पोथैलस

[Option ID = 1779]
4. Mycorrhiza

कवकमूल

[Option ID = 1780]

46) How long would the peptide be that is translated from this mRNA sequence:

5’AUGGUUAAUAACACAUGAGGCCUGAAC– 3’?

इस एमआरएनए अनुकम से पे टाइड कब तक अनुवािदत िकया जाता है :

5‐AUGGUUAAUAACACAUGAGGCCUGAAC‐3 '?

[Question ID = 446][Question Description = 146_39_BIO_AUG22_Q46]
1. 5

[Option ID = 1781]
2. 6

[Option ID = 1782]
3. 9

[Option ID = 1783]
4. 4

[Option ID = 1784]

47) A normal mRNA that reads 5’–UGCCAUGGUAAUAACACAUGAGGCCUGAAC–3’ has an insertion mutation that changes the
sequence to 5’– UGCCAUGGUUAAUAACACAUGAGGCCUGAAC– 3’. Which of the following is the correct sequence of amino
acids, if the mutated mRNA is translated?

एक सामा य एमआरएनए जो 5 '‐UGCCAUGGUAAUAACACAUGAGGCCUGAAC‐3' पढ़ता है उसम एक पिवि उ प रवतन होता है जो अनुकम को 5 '‐
UGCCAUGGUUAAUAACACAUGAGGCCUGAAC‐3' म बदलता है यिद उ प रवितत एमआरएनए का अनुवाद िकया जाता है तो िन निलिखत म से कौन सा
सही अनुकम अमीनो एिसड का है?

[Question ID = 447][Question Description = 147_39_BIO_AUG22_Q47]
1. Met – Val – Ile – Thr – His – Glu – Ala

[Option ID = 1785]
2. ​Met – Val – Asn – Asn – Thr

[Option ID = 1786]
3. Ala – Met – Val – Asn – Asn – Thr

[Option ID = 1787]
4. Ala – Met – Val – Ile – Thr – His – Glu – Ala

[Option ID = 1788]

48) For an experiment, a scientist chose a mRNA which is complementary to the DNA template strand and the DNA
template strand is complementary to coding strand. Would you expect the base sequences of mRNA and DNA non‐template
strand identical?

एक पयोग के िलए, एक वै ािनक ने एक एमआरएनए का चयन िकया जो डीएनए टे पलेट ट ड के पूरक है और डीएनए टे पलेट ट ड कोिडंग ट ड के पूरक है या
आप एमआरएनए और डीएनए गैर‐टे पलेट ट ड के समान के आधार अनुकम क अपे ा करगे?

[Question ID = 448][Question Description = 148_39_BIO_AUG22_Q48]
1. No, they cannot be identical because the T nucleotide in DNA is replaced with the U nucleotide in RNA.

नह , वे समान नह हो सकते य िक डीएनए म टी यूि लयोटाइड को आरएनए म यू यूि लयोटाइड से पित थािपत िकया जाता है

[Option ID = 1789]
2. Yes, they can be identical if demethylation of the U nucleotide in RNA occurs, yielding a T nucleotide.

हां, वे समान हो सकते ह यिद आरएनए म यू यूि लयोटाइड का डीमेथाइलेशन होता है, जो एक टी यूि लयोटाइड उ प न करता है

[Option ID = 1790]
3. Yes, they can be identical if methylation of the U nucleotide in RNA occurs, yielding a T nucleotide.

हां, वे समान हो सकते ह यिद आरएनए म यू यूि लयोटाइड का िमथाइलेशन होता है, िजससे टी यूि लयोटाइड उ प न होता है

[Option ID = 1791]
4. No, they cannot be identical because the T nucleotide in RNA is replaced with the U nucleotide in DNA.

नह , वे समान नह हो सकते य िक आरएनए म टी यूि लयोटाइड को डीएनए म यू यूि लयोटाइड से पित थािपत िकया जाता है

[Option ID = 1792]

49) Which structure‐function pair is mismatched?

कौन सी संरचना‐काय जोड़ी बेमेल है?

[Question ID = 449][Question Description = 149_39_BIO_AUG22_Q49]
1. Smooth endoplasmic reticulum ‐ synthesis of lipids

सपाट/ मूथ एंडो लाि मक रेिटकुलम‐िलिपड का सं ष
े ण

[Option ID = 1793]
2. Golgi apparatus ‐ synthesis of polysaccharides

गोलगी उपकरण‐पॉलीसैकराइ स का सं ष
े ण

[Option ID = 1794]
3. Peroxisome ‐ Cellular respiration

पेरोि ससोम‐कोिशक य सन

[Option ID = 1795]
4. Vacuole ‐ water balance

वै यूकोल‐जल संतल
ु न

[Option ID = 1796]

50) Given below are two statements
Statement I: The Golgi apparatus consists of a group of associated, flattened membranous sacs—cisternae—looking like a
stack of pita bread.

Statement II: The membrane of each cisterna in a stack separates its internal space from the cytosol.

In light of the above statements, choose the correct answer from the options given below

नीचे दो कथन िदए गए ह :

कथन ‐ I : गो गी तंत म संब , चपटी िझ लीदार थैली‐िस टन‐पीटा ब ेड के ढेर क तरह िदखने वाले समूह का एक समूह होता है

कथन ‐ II : टैक म प येक िस टन क िझ ली अपने आंत रक थान को साइटोसोल से अलग करती है

उपयु कथन के आलोक म िन निलिखत िवक प म से सही उ र चुन :

[Question ID = 450][Question Description = 150_39_BIO_AUG22_Q50]
1. Both Statement I and Statement II are true

कथन I और II दोन सही ह

[Option ID = 1797]
2. Both Statement I and Statement II are false

कथन I और II दोन गलत ह

[Option ID = 1798]
3. Statement I is true but Statement II is false

कथन I स य है , िक तु कथन II गलत है |

[Option ID = 1799]
4. Statement I is false but Statement II is true

कथन I अ स य है , िक तु कथन II सही है

[Option ID = 1800]

Topic:‐ ABC01_Chemistry

1) A salt is considered sparingly soluble if its

एक लवण अ पिवलेय माना जाता है यिद इसक

[Question ID = 451][Question Description = 101_40_CHE_SEP22_Q01]
1. Solubility <0.01M

िवलेयता < 0.01M

[Option ID = 1801]
2. Solubility = 0.01M

िवलेयता = 0.01M

[Option ID = 1802]
3. Solubility > 0.1M

िवलेयता > 0.1M

[Option ID = 1803]
4. 0.01M< solubility < 0.01M

0.01M < िवलेयता < 0.01M

[Option ID = 1804]

2) The conductance in electrolytes is due to

ु अपघ य म चालकता िकसके कारण होती है :
िव त

[Question ID = 452][Question Description = 102_40_CHE_SEP22_Q02]
1. Flow of free mobile electrons

मु मोबाइल इले टॉन के गमन से

[Option ID = 1805]
2. Movement of ions

आयन के गमन से

[Option ID = 1806]
3. Movement of uncharged species

उदासीन जाितय के गमन से

[Option ID = 1807]
4. Movement of cations only

केवल धनायन के गमन से

[Option ID = 1808]

3)

[Question ID = 453][Question Description = 103_40_CHE_SEP22_Q03]
1. ΔS=0

[Option ID = 1809]

2. ΔS > 0

[Option ID = 1810]
3. ΔS < 0

[Option ID = 1811]
4. ΔS is not defined

ΔS प रभािषत नह है

[Option ID = 1812]

4) The vapour pressure of chloroform and ethylene glycol at 400 K are 300 mm Hg and 500 mm Hg, respectively. Find the
vapour pressure of the solution prepared by mixing 50 g of chloroform and 25 g of ethylene glycol at 400 K.

400 K ताप पर लोरोफॉम और एिथलीन लाइकॉल का वा प दाब कमशः 300 mm Hg और 500 mm Hg है 50 g लोरोफॉम और 25 g एिथलीन लाइकॉल
को 400 K ताप पर िमलाकर तैयार िवलयन का वा प दाब ात क िजए

[Question ID = 454][Question Description = 104_40_CHE_SEP22_Q04]
1. 347.9 mm Hg

[Option ID = 1813]
2. 423.78 mm Hg

[Option ID = 1814]
3. 229.31 mm Hg

[Option ID = 1815]
4. 401.82 mm Hg

[Option ID = 1816]

5) One gets the straight line in Freundlich adsorption isotherm is by plotting:

फॉय डिलक अिधशोषण समतापी म सीधी रेखा.....................आलेखन ारा पा होती है

[Question ID = 455][Question Description = 105_40_CHE_SEP22_Q05]
1. Ln(x/m) vs P

[Option ID = 1817]
2. Log (x/m) vs log P

[Option ID = 1818]
3. m/x vs P

[Option ID = 1819]
4. x/m vs 1/P

[Option ID = 1820]

6) In the first order reaction, the concentration of reactant decreases from 500 mol/dm3 to 10 mol/dm3 in 4.0 × 103 sec.
The rate constant of the reaction is :

पथम कोिट क अिभिकया म, अिभकारक क सा दता 4.0 × 103 सेक ड म 500 mol/dm3 से घटकर 10 mol/dm3 हो जाती है अिभिकया का वेग ि थरांक है‐

[Question ID = 456][Question Description = 106_40_CHE_SEP22_Q06]
1. 0.978 × 10‐3 sec‐1

[Option ID = 1821]
2. 0.978 × 10‐3 mol L‐1 sec‐1

[Option ID = 1822]
3. 0.432× 103 sec‐1

[Option ID = 1823]
4. 0.432× 103 mol L‐1 sec‐1

[Option ID = 1824]

7) Mark the incorrect statement about zero order reaction

शू य कोिट क अिभिकया के बारे म अस य कथन को िचि हत कर‐

[Question ID = 457][Question Description = 107_40_CHE_SEP22_Q07]
1. The concentration of reactant decreases linearly with time

अिभकारक क सांदता समय के साथ रैिखक प से घटती जाती है

[Option ID = 1825]

2. The concentration of reactant increases linearly with time

अिभकारक क सांदता समय के साथ रैिखक प से बढ़ती जाती है

[Option ID = 1826]
3. Half‐life is directly proportional to initial concentration of reactant

अध‐आयु अिभकारक क पारि भक सांदता के समानुपाती होती है

[Option ID = 1827]
4. The unit of rate constant, k is mol L‐1 time‐1

वेग ि थरांक क इकाई mol L‐1 time‐1 है

[Option ID = 1828]

8) An element possesses fcc structure with an edge length of 288 pm. The density of the element is 4.5 g/cm3 . How many
atoms are present in 155 g of the element?

एक त व क 288 pm िकनारे क लंबाई के साथ fcc संरचना होती है त व का घन व 4.5 g/cm3 है 155g त व म िकतने परमाणु मौजूद ह?

[Question ID = 458][Question Description = 108_40_CHE_SEP22_Q08]
1. 24.16 × 1023 atoms

24.16 × 1023 परमाणु

[Option ID = 1829]
2. 57.64 × 1023 atoms

57.64 × 1023 परमाणु

[Option ID = 1830]
3. 24.16 × 1020 atoms

24.16 × 1020 परमाणु

[Option ID = 1831]
4. 57.64 × 1020 atoms

57.64 × 1020 परमाणु

[Option ID = 1832]

9) Which among the following shows Antiferromagnetism?

ं क व िदखाता है ?
िन निलिखत म से कौन सा पितलोहचुब

[Question ID = 459][Question Description = 109_40_CHE_SEP22_Q09]
1. H 2O

[Option ID = 1833]
2. NaCl

[Option ID = 1834]
3. C6H 6

[Option ID = 1835]
4. MnO

[Option ID = 1836]

10) Which of the following option has lowest degree of ionization?

िन निलिखत िवक प म से िकसम यूनतम आयनीकरण है‐

[Question ID = 460][Question Description = 110_40_CHE_SEP22_Q10]
1. 0.0001 M HCl

[Option ID = 1837]
2. 0.001 M HCl

[Option ID = 1838]
3. 0.01 M HCl

[Option ID = 1839]
4. 0.1 M HCl

[Option ID = 1840]

11) Choose the correct option for the compound whose 0.5 M solution is acidic in nature.

िदए गए िवक प म से सही यौिगक को चुन िजसका 0.5M िवलयन अ लीय पकृित का है :

[Question ID = 461][Question Description = 111_40_CHE_SEP22_Q11]
1. Ammonium acetate

अमोिनयम एिसटेट

[Option ID = 1841]
2. Sodium acetate

सोिडयम एसीटेट

[Option ID = 1842]
3. Sodium chloride

सोिडयम लोराइड

[Option ID = 1843]
4. Slaked lime

ले ड चूना

[Option ID = 1844]

12) According to the Avogadro's law, what is the relation between volume of 1 kg mol of oxygen and volume of 1 kg mol of
nitrogen, at normal pressure and temperature? ( mass of 1 kg mol of oxygen is 32 kg and mass of 1 kg mol of nitrogen is
28 kg)

अवोगाद ो के िनयम के अनुसार, सामा य दाब और ताप पर 1 kg mol ऑ सीजन के आयतन और 1 kg mol नाइटोजन के आयतन के बीच या संबंध है? (1 kg mol
ऑ सीजन का द यमान 32 kg और नाइटोजन के 1 kg mol का द यमान 28 kg है)

[Question ID = 462][Question Description = 112_40_CHE_SEP22_Q12]
1. Volume of 1 kg mol of oxygen is double of nitrogen
1 kg mol ऑ सीजन का आयतन नाइटोजन के 1 kg mol के आयतन का दोगुना होता है

[Option ID = 1845]
2. Volume of 1 kg mol of oxygen is less than that of nitrogen
1 kg mol ऑ सीजन का आयतन नाइटोजन के 1 kg mol के आयतन से कम होता है

[Option ID = 1846]
3. Volume of 1 kg mol of oxygen is same as that of nitrogen
1 kg mol ऑ सीजन का आयतन नाइटोजन के 1 kg mol के आयतन के बराबर होता है

[Option ID = 1847]
4. Volume of 1 kg mol of oxygen is triple of nitrogen
1 kg mol ऑ सीजन का आयतन नाइटोजन के 1 kg mol के आयतन का तीन गुना होता है

[Option ID = 1848]

13) The value of Kc of the reaction 2A ⇌ B+C is 2x10‐3. At a given time, the composition of reaction mixture is [A] = [B] =
[c] = 3x10‐4 M.

Select the correct options.

Kc का मान अिभिकया 2A ⇌ B+C is 2x10 ‐3 के िलए है िकसी समय पर रासायिनक िमशण का संगटन [A] = [B] = [C] = 3x10‐4 M है

िन न म से सही िवक प चुन :

[Question ID = 463][Question Description = 113_40_CHE_SEP22_Q13]
1. Qc < Kc

[Option ID = 1849]
2. Qc > Kc

[Option ID = 1850]
3. Qc = Kc

[Option ID = 1851]
4. Qc ≠ Kc

[Option ID = 1852]

14) Consider the following statements

i. Positive entropy change is possible at any temperature

ii. Combustion of methane is an endothermic process

iii. q = 0 for a cyclic process

iv. q = 0 for an adiabatic process

Select the correct option for true statement(s):

िन निलिखत कथन पर िवचार कर :

i. िकसी भी ताप पर धना मक ए टापी प रवतन संभव है

ii. मेथेन का दहन एक ऊ माशोषी पिकया है

iii. q = 0 चकीय पिकया के िलए

iv. q = 0 ो म पिकया के िलए

िन न म से सही कथन चुन :

[Question ID = 464][Question Description = 114_40_CHE_SEP22_Q14]
1. iii and iv Only

केवल iii और iv

[Option ID = 1853]
2. ii, iii and iv Only

केवल ii, iii और iv

[Option ID = 1854]
3. i, iii and iv Only

केवल i, iii और iv

[Option ID = 1855]
4. iv Only

केवल iv

[Option ID = 1856]

15) Values of the standard reduction potential of three metallic ions P, Q and R are 0.77, ‐2.93 and ‐0.13, respectively.
The correct order of stronger reducing agent is:

तीन धातु आयन P, Q और R के मानक अपचयन िवभव के मान कमशः 0.77, ‐2.93 और ‐0.13 ह पबल अपचायक का सही कम है :

[Question ID = 465][Question Description = 115_40_CHE_SEP22_Q15]
1. R > Q > P

[Option ID = 1857]
2. P > Q > R

[Option ID = 1858]
3. Q > R > P

[Option ID = 1859]
4. R > P > Q

[Option ID = 1860]

16) Which statement is ‘true’ for equilibrium constant, Keq of a specific reaction?

िकसी िविश अिभिकया के सा याव था ि थरांक Keq के िलए कौन सा कथन 'स य' है?

[Question ID = 466][Question Description = 116_40_CHE_SEP22_Q16]
1. It may be changed by the addition of a catalyst.

इसे उ परे क डालकर के बदला जा सकता है

[Option ID = 1861]
2. It increases if the concentration of one of the products is increased.

यह बढ़ जाती है अगर उ पाद म से एक क सांदता बढ़ जाती है

[Option ID = 1862]
3. It changes with changes in the temperature.

यह तापमान म बदलाव के साथ बदलती है

[Option ID = 1863]
4. It increases if the concentration of one of the reactants is increased.

यिद िकसी एक अिभकारक क सांदता बढ़ा दी जाए तो यह बढ़ जाती है

[Option ID = 1864]

17) Select the incorrect option.

िन निलिखत म से अस य िवक प चुन :

[Question ID = 467][Question Description = 117_40_CHE_SEP22_Q17]
1. Molecularity and order of an elementary reaction are same

आि वकता तथा कोिट पाथिमक अिभिकय क समान होती है

[Option ID = 1865]
2. k = Ae‐Ea/RT

[Option ID = 1866]
3. k = PZAB e‐Ea/RT

[Option ID = 1867]
4. B is a steric factor

B एक ितिवम कारक है

[Option ID = 1868]

18) Millikan’s Oil drop Method was used to determine:

िमिलकन क तेल क बूदं िविध का उपयोग ‐‐‐‐‐‐‐‐‐ िनधारण करने के िलए िकया गया था‐

[Question ID = 468][Question Description = 118_40_CHE_SEP22_Q18]
1. Neutrons

यूटॉन

[Option ID = 1869]
2. Protons

पोटॉन

[Option ID = 1870]
3. Positron

पाजीटॉन

[Option ID = 1871]
4. Charge on the electrons

इले टॉन पर आवेश

[Option ID = 1872]

19) Which of the following metals are refined by electrolytic refining method?

A. Cu

B. Ni

C. Zn

D. Fe

Choose the correct option:

िन निलिखत म कौन सी धातु वै ुत अपघटनी िविध ारा शोिधत क जाती है / ह ?

A. Cu

B. Ni

C. Zn

D. Fe

सही िवक प को चुन :

[Question ID = 469][Question Description = 119_40_CHE_SEP22_Q19]

1. A and B only

केवल A और B

[Option ID = 1873]
2. A and C only

केवल A और C

[Option ID = 1874]
3. C and D only

केवल C और D

[Option ID = 1875]
4. B and C only

केवल B और C

[Option ID = 1876]

20) On considering the ores of Fe and Cu

A. Malachite

B. Calamine

C. Bauxite

D. Siderite

Choose the correct option have the ores of Fe and Cu.

Fe और Cu के अय क को पहचान :

A. मेलाकाइट

B. कैलामाइन

C. बॉ साइट

D. िसडेराइट

नीचे िदए गए िवक प म से Cu और Fe दोन के अय क के िलए िवक प है :

[Question ID = 470][Question Description = 120_40_CHE_SEP22_Q20]
1. A and B only

केवल A और B

[Option ID = 1877]
2. B and C only

केवल B और C

[Option ID = 1878]
3. A and D only

केवल A और D

[Option ID = 1879]
4. B and D only

केवल B और D

[Option ID = 1880]

21) Which of the following is correct for the number of bonds present in pyrophosphorous acid?

पायरोफॉ फोरस अ ल म मौजूद बंध क सं या के िलए िन निलिखत म से कौन सा िवक प सही है?

[Question ID = 471][Question Description = 121_40_CHE_SEP22_Q21]
1. 1 P‐OH, 2 P‐H, 1 P=O

[Option ID = 1881]
2. 2 P‐OH, 2 P‐H, 2 P=O

[Option ID = 1882]
3. 2 P‐OH, 1 P‐H, 1 P=O

[Option ID = 1883]
4. 4 P‐OH, 2 P‐H, 1 P=O

[Option ID = 1884]

22) Given below are two statements, one is labelled as Assertion A and the other is labelled as Reason R

Assertion A : Oxygen has less negative electron gain enthalpy than sulphur

Reason R : Electronegativity of oxygen is more than sulphur.

In light of the above statements, choose the correct answer from the options given below

नीचे दो कथन िदए गए ह : एक को अिभकथन (A) और दूसरे को तक (R) कहा गया है

अिभकथन (A) : ऑ सीजन क इले टॉन लि ध ए थै पी स फर क तुलना म कम ऋणा मक होती है

तक (R) : ऑ सीजन क िव त
ु ऋणा मकता स फर से अिधक होती है

उपयु कथन के आलोक म िन नांिकत िवक प म से सही उ र चुन :

[Question ID = 472][Question Description = 122_40_CHE_SEP22_Q22]
1. Both A and R are correct and R is the correct explanation of A

(A) और (R) दोन सही ह और (R), (A) क सही या या है

[Option ID = 1885]
2. Both A and R are correct but R is NOT the correct explanation of A

(A) और (R) दोन सही ह पर तु (R), (A) क सही या या नह है

[Option ID = 1886]
3. A is correct but R is not correct

(A) सही है पर तु (R) सही नह ह

[Option ID = 1887]
4. A is not correct but R is correct

(A) सही नह है पर तु (R) सही ह

[Option ID = 1888]

23) Match List I with List II

List I List II

A. PCl3 I. Tetrahedral

B. H3PO2 II. Pyramidal

C. XeF4 III. Bent T

IV. Square
D. ICl3
Planar

Choose the correct answer from the options given below:

सूची ‐I को सूची ‐II से सुमेिलत क िजए :

सूची ‐I सूची ‐II

A. PCl3 I. चतु फलक य

B. H3PO2 II. िपरािमडीय

C. XeF4 III. बंिकत T

D. ICl3 IV. वग समतलीय

नीचे िदए गए िवक प म से सही उ र चुिनए :

[Question ID = 473][Question Description = 123_40_CHE_SEP22_Q23]
1. A‐I, B‐III, C‐IV, D‐II

[Option ID = 1889]
2. A‐I, B‐IV, C‐III, D‐II

[Option ID = 1890]
3. A‐II, B‐I, C‐IV, D‐III

[Option ID = 1891]
4. A‐II, B‐III, C‐IV, D‐I

[Option ID = 1892]

24) The compound of transition metals have good catalytic properties due to:

A. smaller size of the metal ions

B. high ionic charges

C. ability to adopt multiple oxidation states

D. higher melting point

Choose the correct answer from the options given below:

संकमण धातु ओ ं के यौिगक का उनक अ छे उ परे क गुणधम का कारण है :

A. धातु आयन के छोटे आकार के कारण

B. उ च आयिनक आवेश के कारण

C. कई ऑ सीकरण अव थाओं को अपनाने क मता के कारण

D. उ च गलनांक के कारण

नीचे िदए गए िवक प म से सही उ र चुन :

[Question ID = 474][Question Description = 124_40_CHE_SEP22_Q24]
1. A and B only

केवल A और B

[Option ID = 1893]
2. C and D only

केवल C और D

[Option ID = 1894]
3. C only

केवल C

[Option ID = 1895]
4. D only

केवल D

[Option ID = 1896]

25) Which one of the following is amphoteric oxide?

िन निलिखत म से कौन सा उभयधम ऑ साइड है?

[Question ID = 475][Question Description = 125_40_CHE_SEP22_Q25]
1. V2O5

[Option ID = 1897]
2. CrO3

[Option ID = 1898]
3. Mn2O7

[Option ID = 1899]
4. V2O3

[Option ID = 1900]

26) The electronic configuration of Promethium (Atomic number 61) is:

पोमेिथयम (परमाणु कमांक 61) का इले टॉिनक िव यास है:

[Question ID = 476][Question Description = 126_40_CHE_SEP22_Q26]
1. [Xe] 4f5 5d0 6s2

[Option ID = 1901]
2. [Xe] 4f7 5d0 6s1

[Option ID = 1902]
3. [Xe] 4f5 5d1 6s1

[Option ID = 1903]
4. [Xe] 4f5 5d2 6s0

[Option ID = 1904]

27) Given below are two statements, one is labelled as Assertion A and the other is labelled as Reason R

Assertion A : Zinc is not a transition metal.

Reason R : Zn2+ has completely filled d orbitals.

In light of the above statements, choose the correct answer from the options given below

नीचे दो कथन िदए गए ह : एक को अिभकथन (A) और दूसरे को तक (R) कहा गया है

अिभकथन (A) : िजंक एक संकमण धातु नह है

तक (R) : Zn2+ म d ऑिबट स पूरी तरह से भरा होता है

उपयु कथन के आलोक म िन नांिकत िवक प म से सही उ र चुन :

[Question ID = 477][Question Description = 127_40_CHE_SEP22_Q27]
1. Both A and R are true and R is the correct explanation of A

(A) और (R) दोन सही ह और (R), (A) क सही या या है

[Option ID = 1905]
2. Both A and R are true but R is NOT the correct explanation of A

(A) और (R) दोन सही ह पर तु (R), (A) क सही या या नह है

[Option ID = 1906]
3. A is true but R is false

(A) सही है पर तु (R) सही नह ह

[Option ID = 1907]
4. A is false but R is true

(A) सही नह है पर तु (R) सही ह

[Option ID = 1908]

28) Identify the correct option from the following in which all molecules exhibit zero dipole moment:

िन निलिखत म से सही िवक प क पहचान कर िजसम सभी अणु शू य ि धव
ु आघूण पदिशत करते ह

[Question ID = 478][Question Description = 128_40_CHE_SEP22_Q28]
1. NF3, CO2, CCl4

[Option ID = 1909]
2. BF3, H2S, CCl4

[Option ID = 1910]
3. BF3, CO2, CCl4

[Option ID = 1911]
4. BF3, CO2, CHCl3

[Option ID = 1912]

29) On considering the following compounds:

A. Na2HPO4

B. Na6P6O 18

C. Ca3(PO4) 2

D. Na2CO3

Choose the correct answer for water softening reagents.

िन निलिखत यौिगक को यान देते हए :

A. Na2HPO4

B. Na6P6O 18

C. Ca3(PO4) 2

D. Na2CO3

जल मृदुकरण अिभकमक के िलए सही िवक प चुन :

[Question ID = 479][Question Description = 129_40_CHE_SEP22_Q29]
1. A and B only

केवल A और B से

[Option ID = 1913]
2. B and C only

केवल B और C से

[Option ID = 1914]
3. A and D only

केवल A और D से

[Option ID = 1915]
4. B and D only

केवल B और D से

[Option ID = 1916]

30) Given below are two statements, one is labelled as Assertion A and the other is labelled as Reason R

Assertion A : Beryllium carbonate is kept in the atmosphere of carbon dioxide.

Reason R : Beryllium carbonate decomposes on heating to give beryllium metal and carbon dioxide.

In light of the above statements, choose the correct answer from the options given below

नीचे दो कथन िदए गए ह : एक को अिभकथन (A) और दूसरे को तक (R) कहा गया है

अिभकथन (A) : बे रिलयम काब नेट काबन डाइऑ साइड के वातावरण म रखा जाता है

तक (R) : बे रिलयम काब नेट गम करने पर िवघिटत होकर बे रिलयम धातु और काबन डाइऑ साइड देता है

उपयु कथन के आलोक म िन नांिकत िवक प म से सही उ र चुन :

[Question ID = 480][Question Description = 130_40_CHE_SEP22_Q30]
1. Both A and R are true and R is the correct explanation of A

(A) और (R) दोन सही ह और (R), (A) क सही या या है

[Option ID = 1917]
2. Both A and R are true but R is NOT the correct explanation of A

(A) और (R) दोन सही ह पर तु (R), (A) क सही या या नह है

[Option ID = 1918]
3. A is true but R is false

(A) सही है पर तु (R) सही नह ह

[Option ID = 1919]
4. A is false but R is true

(A) सही नह है पर तु (R) सही ह

[Option ID = 1920]

31) What is the mass percent of carbon in carbon dioxide?

काबन डाइऑ साइड म काबन का द यमान पितशत िकतना है?

[Question ID = 481][Question Description = 131_40_CHE_SEP22_Q31]
1. 0.034%

[Option ID = 1921]

2. 3.4%

[Option ID = 1922]
3. 28.7%

[Option ID = 1923]
4. 27.27%

[Option ID = 1924]

32) Oxidation state of Cl in species produced on disproportionation reaction of are:

क असमानुपाती अिभिकया से िमली जाितय म Cl क ऑ सीकरण अव था है‐

[Question ID = 482][Question Description = 132_40_CHE_SEP22_Q32]
1. +1, +5

[Option ID = 1925]
2. ‐1, +5

[Option ID = 1926]
3. +1, +7

[Option ID = 1927]
4. ‐1, +7

[Option ID = 1928]

33) Which of the following complex is used for the treatment of lead poisoning?

ु का उपयोग सीसा िवषा ता के उपचार के िलए िकया जाता है?
िन निलिखत म से िकस संकल

[Question ID = 483][Question Description = 133_40_CHE_SEP22_Q33]
1. D–penicillamine

D– पेिनिसलऐिमन

[Option ID = 1929]
2. EDTA

[Option ID = 1930]
3. Cis–platin

Cis– लैिटन

[Option ID = 1931]
4. Desferrioxime B

डे फे रओ साइम B

[Option ID = 1932]

34) The crystal system of Cinnabar is:

िसनबार का िक टल तंत है‐

[Question ID = 484][Question Description = 134_40_CHE_SEP22_Q34]
1. Trigonal

ितकोणी

[Option ID = 1933]
2. Tetrahedral

चतु फलक य

[Option ID = 1934]
3. Cubic

घनीय

[Option ID = 1935]
4. Triclinic

ितनता

[Option ID = 1936]

35)

[Question ID = 485][Question Description = 135_40_CHE_SEP22_Q35]
1. 15

[Option ID = 1937]
2. 16

[Option ID = 1938]
3. 14

[Option ID = 1939]
4. 17

[Option ID = 1940]

36)

[Question ID = 486][Question Description = 136_40_CHE_SEP22_Q36]
1. iii) only

केवल iii)

[Option ID = 1941]
2. i) and ii) only

केवल i) और ii)

[Option ID = 1942]
3. ii) only

केवल ii)

[Option ID = 1943]
4. i), ii) and iii)

i), ii) और iii)

[Option ID = 1944]

37) Choose the correct option for the feasible reaction.

स भािवत अिभिकया के िलए सही िवक प को चुन :

[Question ID = 487][Question Description = 137_40_CHE_SEP22_Q37]

1.

[Option ID = 1945]

2.

[Option ID = 1946]

3.

[Option ID = 1947]

4.

[Option ID = 1948]

38)

[Question ID = 488][Question Description = 138_40_CHE_SEP22_Q38]
1. Nucleophilic addition reaction

नािभकरागी योगज अिभिकया

[Option ID = 1949]
2. Electrophilic addition reaction

इले टॉनरागी योगज अिभिकया

[Option ID = 1950]
3. Electrophilic substitution reaction

इले टॉनरागी पित थापन अिभिकया

[Option ID = 1951]
4. Free radical addiction reaction

मु मूलक योगज अिभिकया

[Option ID = 1952]

39)

[Question ID = 489][Question Description = 139_40_CHE_SEP22_Q39]

1.

[Option ID = 1953]

2.

[Option ID = 1954]

3.

[Option ID = 1955]

4.

[Option ID = 1956]

40) Select the correct statement for CH3F, CH3Cl, CH3Br and CH3I.

CH3F, CH3Cl, CH3Br और CH3I के िलए सही कथन को चुन :

[Question ID = 490][Question Description = 140_40_CHE_SEP22_Q40]
1. Dipole moment of I‐CH3 is maximum

CH3‐ I का ि धुव आघूण अिधकतम है

[Option ID = 1957]
2. C‐X Bond enthalpy of F‐CH3 is maximum

CH3‐F क बंधन ए थै पी अिधकतम है

[Option ID = 1958]
3. Dipole moment of C‐X for CH3‐Cl is more than CH3‐Br

C‐X ि धुव आघूण CH3‐Cl के िलए CH3‐Br से अिधक है

[Option ID = 1959]
4. Dipole moment of C‐X for CH3‐CH3‐F is more than CH3‐Cl

C‐X ि धुव आघूण CH3‐F के िलए CH3‐Cl से अिधक है

[Option ID = 1960]

41)

[Question ID = 491][Question Description = 141_40_CHE_SEP22_Q41]
1. i‐c, ii‐d, iii‐a, iv‐b

[Option ID = 1961]
2. i‐b, ii‐c, iii‐a, iv‐d

[Option ID = 1962]

3. i‐b, ii‐d, iii‐a, iv‐c

[Option ID = 1963]
4. i‐c, ii‐a, iii‐d, iv‐b

[Option ID = 1964]

42)

[Question ID = 492][Question Description = 142_40_CHE_SEP22_Q42]
1. A [Option ID = 1965]
2. C [Option ID = 1966]
3. D [Option ID = 1967]
4. B [Option ID = 1968]

43) Select the incorrect reaction.

गलत अिभिकया को चुन :

[Question ID = 493][Question Description = 143_40_CHE_SEP22_Q43]

1.

[Option ID = 1969]

2.

[Option ID = 1970]

3.

[Option ID = 1971]

4.

[Option ID = 1972]

44) Which one of the following is the strongest acid?

िन निलिखत म से कौन सा सबसे पबल अ ल है?

[Question ID = 494][Question Description = 144_40_CHE_SEP22_Q44]
1. N, N‐Dimethylaniline

N, N‐डाइमेिथलऐिनलीन

[Option ID = 1973]
2. N‐Methylaniline

N‐मेिथलऐिनलीन

[Option ID = 1974]
3. Methanamine

मेथन
े ऐिमन

[Option ID = 1975]
4. N‐Methylmethanamine

मेिथलमेथन
े ऐिमन

[Option ID = 1976]

45)

[Question ID = 495][Question Description = 145_40_CHE_SEP22_Q45]

1.

[Option ID = 1977]

2.

[Option ID = 1978]

3.

[Option ID = 1979]

4.

[Option ID = 1980]

46) Choose the correct statement.

स य कथन को चुन‐

[Question ID = 496][Question Description = 146_40_CHE_SEP22_Q46]
1. Monosaccharides are held together by peptide linkages to form disaccharides or polysaccharides.

मोनोसैकराइड पे टाइड ब ध ारा जुड़कर डाइसैकराइड या पॉलीसैकरै ाइड बनाते ह

[Option ID = 1981]
2. Disaccharides are held together by peptide linkages to form Monosaccharide or polysaccharides.

डाइसैकराइड पे टाइड ब ध ारा जुड़कर मोनोसैकराइड या पॉलीसैकरै ाइड बनाते ह

[Option ID = 1982]
3. Monosaccharides are held together by phosphodiester linkages to form disaccharides or polysaccharides.

मोनोसैकरे ाइड फॉ फोडाइ टर ब ध ारा जुड़कर डाइसैकराइड या पॉलीसैकरै ाइड बनाते ह

[Option ID = 1983]
4. Monosaccharides are held together by glycosidic linkages to form disaccharides or polysaccharides.

मोनोसैकरे ाइड लाइसाइडी ब ध ारा जुड़कर डाइसैकराइड या पॉलीसैकरै ाइड बनाते ह

[Option ID = 1984]

47) Which of the following amino‐acid is not an essential amino‐acid?

िन निलिखत म से कौन सा ऐमीनो अ ल आव यक ऐमीनो अ ल नह है ?

[Question ID = 497][Question Description = 147_40_CHE_SEP22_Q47]
1. Cysteine

िस टीन

[Option ID = 1985]
2. Lysine

लाइसीन

[Option ID = 1986]
3. Methionine

मेथाइओिनन

[Option ID = 1987]
4. Histidine

िहि टडीन

[Option ID = 1988]

48) Select the correct statement:

सही कथन को चुन :

[Question ID = 498][Question Description = 148_40_CHE_SEP22_Q48]
1. The maximum limit of nitrate in drinking water is 200 ppm.

पीने वाले पानी म नाइटटे क अिधकतम सीमा 200 ppm होती है

[Option ID = 1989]
2. Methane reacts with ozone to give formic acid only.

मेथन
े ओजोन से अिभिकया करके केवल फािमक अ ल देती है

[Option ID = 1990]
3. These days, the pesticide industry has shifted its attention to germicides such as sodium chlorate (NaClO3), sodium arsinite (Na3AsO3).

आजकल क टनाशक उ ोग ने अपना यान सोिडयम लोरेट (NaClO3), सोिडयम आिसनेट (Na3AsO3) जैसे क टाणुनाशक क ओर थानांत रत कर िदया है

[Option ID = 1991]
4. Most herbicides are toxic to mammals but are not as persistent as organochlorides.

अिधकांश शाकनाशी तनधा रय के िलए िवषैले होते ह लेिकन काब‐ लोराइ स क तरह थायी नह होते ह

[Option ID = 1992]

49) Select the correct statement for rubber.

रबर के िलए सही कथन को चुन :

[Question ID = 499][Question Description = 149_40_CHE_SEP22_Q49]
1. Natural rubber becomes hard at high temperature (>335K) and brittle at low temperature (<283K)

पाकृितक रबर उ च ताप पर कठोर (>335K) और िन न ताप पर (<283k) छड़भंगुर हो जाता है

[Option ID = 1993]
2. Natural rubber is insoluble in non‐polar solvents.

पाकृितक रबर अधुवीय िवलायक म अघुलनशील होता है

[Option ID = 1994]
3. Natural rubber has high water absorption capacity

पाकृितक रबर क उ च जल अवशोषण मता होती है

[Option ID = 1995]
4. 15% of sulphur is used as a cross linking agent to manufacture rubber tyres.

टायर बनाने के िलए पयु होने वाली रबर के उ पादन म 15% स फर का उपयोग ितयक बंधक के िलए िकया जाता है

[Option ID = 1996]

50) The pH of acid rain is around:

अ लीय वषा का pH लगभग होता है­

[Question ID = 500][Question Description = 150_40_CHE_SEP22_Q50]
1. 5.6 [Option ID = 1997]
2. 7.1 [Option ID = 1998]
3. 2.0 [Option ID = 1999]
4. 6.8 [Option ID = 2000]