Tamil Nadu 12th Std Model Question Paper 2026 Zoology

Tamil Nadu Board Model Question Paper

No. of Printed Pages : 11
8337
£vÄ Gs
A Register Number

!8337Zoology! PART - III
»[Q¯À / ZOOLOGY
( uªÌ ©ØÖ® B[Q» ÁÈ / Tamil & English Version )

Põ» AÍÄ : 3.00 ©o ÷|µ® ] [ ö©õzu ©v¨ö£sPÒ : 70
Time Allowed : 3.00 Hours ] [ Maximum Marks : 70

AÔÄøµPÒ : (1) AøÚzx ÂÚõUPЮ \›¯õP £vÁõQ EÒÍuõ Gߣøu \›£õºzxU
öPõÒÍÄ®. Aa_¨£vÂÀ SøÓ°¸¨¤ß AøÓ PsPõo¨£õÍ›h®
EhÚi¯õP öu›ÂUPÄ®.
(2) }»® AÀ»x P¸¨¦ ø©°øÚ ©mk÷© GÊxÁuØS®
AiU÷PõikÁuØS® £¯ß£kzu ÷Ásk®. £h[PÒ ÁøµÁuØS
ö£ß]À £¯ß£kzuÄ®.

Instructions : (1) Check the question paper for fairness of printing. If there is any lack of fairness,
inform the Hall Supervisor immediately.

(2) Use Blue or Black ink to write and underline and pencil to draw diagrams.

£Sv & I / PART - I
SÔ¨¦ : (i) AøÚzx ÂÚõUPÐUS® Âøh¯ÎUPÄ®. 15x1=15

(ii) öPõkUP¨£mkÒÍ |õßS ©õØÖ ÂøhPÎÀ ªPÄ® Hئøh¯
Âøhø¯z ÷uº¢öukzxU SÔ±mkhß Âøh°øÚ²® ÷\ºzx GÊuÄ®.
Note : (i) Answer all the questions.

(ii) Choose the most appropriate answer from the given four alternatives and write
the option code and the corresponding answer.

[ v¸¨¦P / Turn over

8337 2

1. J¸Á¸US Ai¨£mk Põ¯® HØ£kQÓx. v_ ]øuÂÚõÀ E¸ÁõS® C¢u Põ¯®
__________ US GkzxUPõmhõS®.

(A) ÷£÷Põø\m÷hõ]ì (B) C¯¢vµ uøhUPõ¨¦
(C) ÃUP® (D) EhØö\¯À \õº¢u uøhUPõ¨¦
A person is injured and got swelling. The swelling, due to the infection of tissue is an
example of :
(a) Phagocytosis (b) Mechanical barrier

(c) Inflammation (d) Physiological barrier

2. •uß •u¼À ö£õ¸Ò PshÔ¯¨£mh ÷Põhõß __________ BS®. Cx __________
Aª÷Úõ Aª»zvØPõÚ SÔ±k BS®.
(A) UUU, L¤øÚÀ A»øÚß (B) AAA, ¦÷µõø»ß
(C) TTT, AºâøÚß (D) GGG, A»øÚß
The first codon to be deciphered was ____________ which codes for __________.

(a) UUU, Phenylalanine (b) AAA, Proline

(c) TTT, Arginine (d) GGG, Alanine

3. uÁÓõP ö£õ¸¢v²ÒÍÁØøÓ ÷uº¢öuk.
(A) QøÍßLö£Àhº ]sm÷µõ® & XXY ö£sPÒ

(B) hÄs ]sm÷µõ® & 21 iøµ÷\õª

(C) hºÚº ]sm÷µõ® & XO ö£sPÒ

(D) £mhõÆ ]sm÷µõ® & 13 iøµ÷\õª

Find out the wrongly matched pair.

(a) Klinefelter’s Syndrome - XXY Female
(b) Down’s Syndrome - Trisomy-21

(c) Turner’s Syndrome - XO Female

(d) Patau’s Syndrome - Trisomy-13

A

3 8337

4. {¯õshºuõÀ ©ÛuÛß ‰øÍ AÍÄ :
(A) 900 P.ö\.«. (B) 650 - 800 P.ö\.«.
(C) 1400 P.ö\.«. (D) 1200 P.ö\.«.
The Neanderthal man had the brain capacity of :
(a) 900 cc (b) 650-800 cc
(c) 1400 cc (d) 1200 cc

5. RÌ EÒÍ SÊUPÐÒ, £õUj›¯ £õÀÂøÚ ÷|õ´U SÊøÁU SÔ¨¤kP.
(A) Qµ¢v, öPõ÷Úõ›¯õ, iøµ÷Põ÷©õÛ¯õêì
(B) Qµ¢v, öÁmøh÷|õ´ ©ØÖ® ÷Pßii¯õêì
(C) Qµ¢v, iøµ÷Põ÷©õÛ¯õêì, ö£iS÷»õêì
(D) Qµ¢v, QÍõªi¯õêì, öÁmøh÷|õ´
Which one of the following groups includes sexually transmitted diseases caused by bacteria
only ?
(a) Syphilis, gonorrhoea and trichomoniasis
(b) Syphilis, gonorrhoea and candidiasis
(c) Syphilis, trichomoniasis and pediculosis
(d) Syphilis, chlamydiasis and gonorrhoea

6. Gø»\õ •ußø©¯õP __________ £¯ß£kQÓx.
(A) ¸®£zuUP £s¦PøÍ öPõsh »[SPøÍz ÷uºÄ ö\´¯
(B) vjº ©õØÓ[PøÍU PshÔ¯
(C) ¸®£zuUP £s¦PøͲøh¯ uõÁµ[PøÍz ÷uºÄ ö\´¯
(D) ÷|õ´UQ¸ªPøÍU PshÔ¯
ELISA is mainly used for :
(a) Selecting animals having desired traits
(b) Detection of mutations
(c) Selecting plants having desired traits
(d) Detection of pathogens

A [ v¸¨¦P / Turn over

8337 4

7. SÇ¢øu ¤Ó¨¦US¨¤ß £õÀ _µzuø»z öuõh[Q øÁ¨£x® öuõhºa]¯õPa _µUP
øÁUPÄ® EuÄ® •UQ¯ íõº÷©õß :

(A) ¦÷µõ»õUiß (B) Dìm÷µõáß

(C) BUê÷hõ]ß (D) FSH

The most important hormone in initiating and maintaining lactation after birth is :

(a) Prolactin (b) Oestrogen

(c) Oxytocin (d) FSH

8. TØÖ : öÁ¨£©sh» £SvPÎÀ {»Ä® _ØÖa`ÇÀ ußø©PÒ
E°›Ú[PÎß ]ØÔÚ©õUPÀ ©ØÖ® £ÀÁøPz ußø©USa
\õuP©õP EÒÍÚ.

Põµn® : £¸ÁPõ»®, um£öÁ¨£{ø», Dµ¨£u®, JÎUPõ»® BQ¯øÁ
HÓUSøÓ¯ {ø»¯õPÄ®, EP¢uuõPÄ® EÒÍx.

(A) TØÖ \› BÚõÀ Põµn® uÁÖ.

(B) Põµn® ©ØÖ® TØÖ Cµsk® \›, Põµn® TØøÓ \›¯õP ÂÍUSQÓx.

(C) TØÖ ©ØÖ® Põµn® Cµsk® uÁÖ.

(D) Põµn® ©ØÖ® TØÖ \› BÚõÀ Põµn® TØøÓ \›¯õP ÂÍUPÂÀø».

Assertion : The Environmental conditions of the Tropics are favourable for speciation
and diversity of organisms.

Reason : The climate seasons, temperature, humidity and photo period are more or
less stable and congenial.

(a) Assertion is true, but Reason is false.

(b) Both Assertion and Reason are true and Reason explains Assertion correctly.

(c) Both Assertion and Reason are false.

(d) Both Assertion and Reason are true but Reason is not the correct explanation of
Assertion.

A

5 8337

9. RÌUPõq® Áøµ£h® _ØÖa`ÇÀ E°µØÓ PõµoPÐU÷PØ£ E°›Ú[PÎß
GvºÂøÚø¯U SÔUQÓx. CvÀ A, B ©ØÖ® C GÚU SÔUP¨£mkÒÍÁØøÓU
PshÔP.

A B C
(A) £Sv JÊ[Pø©Áõß JÊ[Pø©Áõß Jzuø©Áõß
(B) Jzuø©Áõß JÊ[Pø©Áõß £Sv JÊ[Pø©Áõß
(C) JÊ[Pø©Áõß Jzuø©Áõß £Sv JÊ[Pø©Áõß
(D) JÊ[Pø©Áõß £Sv JÊ[Pø©Áõß Jzuø©Áõß
The figure given below is a diagrammatic representation of response of organisms to abiotic
factors. What do A, B and C represent respectively ?

A B C
(a) Partial Regulator Regulator Conformer
(b) Conformer Regulator Partial Regulator
(c) Regulator Conformer Partial Regulator
(d) Regulator Partial Regulator Conformer

A [ v¸¨¦P / Turn over

8337 6

10. £õUj›¯õÂÀ £õÀ CÚ¨ö£¸UP® RÌUPsh G¢u •øÓ°À |øhö£ÖQÓx ?
(A) CønuÀ (B) ÷Pªm E¸ÁõUP®
(C) `ì÷£õº E¸ÁõUP® (D) Gß÷hõì÷£õº E¸ÁõUP®
The mode of sexual reproduction in bacteria is by :
(a) Conjugation (b) Formation of gametes
(c) Zoospore formation (d) Endospore formation

11. ÷u]¯ E°›¯¨ £ÀÁøPzußø© Bøn¯zvß uø»ø©¯P® G[S
Aø©¢xÒÍx ?
(A) öhÀ¼ (B) •®ø£ (C) öPõÀPzuõ (D) ö\ßøÚ
The headquarters of the National Biodiversity Authority is situated in __________.
(a) Delhi (b) Mumbai (c) Kolkata (d) Chennai

12. öuõhº¦øh¯ ÷Áø»PøÍa ö\´QÓ ©µ£q TmhzvØS __________ GßÖ ö£¯º.
(A) öµUPõßPÒ (B) ª³mhõßPÒ
(C) K£µõßPÒ (D) ]ìmµõßPÒ
The clusters of gene with related functions are called as _________.
(a) Recons (b) Mutons
(c) Operons (d) Cistrons

13. RÌUPshÁØÖÒ G¢u ~sq°›, öuõÈØ\õø»PÎÀ ]m›U Aª» EØ£zvUS
£¯ß£kQÓx ?
(A) B죺âÀ»ì ø|Ạ(B) »õU÷hõ÷£]À»ì £ÀPõ›ì
(C) øµ÷\õ£ì ø|U›Pßì (D) ö£Û]¼¯® ]ØÔÚ®
Which of the following micro-organisms is used for production of citric acid in Industries ?
(a) Aspergillus niger (b) Lactobacillus bulgaris
(c) Rhizopus nigricans (d) Penicillium citrinum

14. ìm÷µm÷hõ줯›ß K÷\õß AkUQß ui©øÚ AÍÂh £¯ß£kÁx __________.
(A) ö©À\ß A»S (B) ëÁºmì A»S (SU)
(C) ¥L÷£õºm AÍÄ÷PõÀ (D) hõ¨\ß A»S (DU)
The ‘thickness’ of Stratospheric Ozone layer is measured in :
(a) Melson units (b) Sieverts units
(c) Beaufort scale (d) Dobson units

A

7 8337

15. ï÷©õ÷\õ°ß Gߣx :
(A) ¤Íõì÷©õi¯® CÚzv¼¸¢x öÁÎ÷¯Ö® |a_
(B) ï÷©õS÷Íõ¤Ûß •ß÷Úõi
(C) ï÷©õLø£»ì CÚzv¼¸¢x öÁÎ÷¯Ö® |a_
(D) ìmöµ¨÷hõPõUP꼸¢x öÁÎ÷¯Ö® |a_
Haemozoin is :
(a) A toxin from Plasmodium species
(b) A precursor of haemoglobin
(c) A toxin from Haemophilus species
(d) A toxin from Streptococcus

£Sv & II / PART - II
SÔ¨¦ : GøÁ÷¯Ý® BÖ ÂÚõUPÐUS Âøh¯ÎUPÄ®. ÂÚõ Gs 24 &US
Pmhõ¯©õP Âøh¯ÎUPÄ®. 6x2=12
Note : Answer any six questions. Question No. 24 is Compulsory.

16. Ch® ©õÔ¯ Pº¨£® GßÓõÀ GßÚ ?
What is ectopic pregnancy ?

17. •vº¢u ¢uqÂß £h® Áøµ¢x £õP[PøÍU SÔUPÄ®.
Draw and mention the parts of a spermatozoan.

18. i.Gß.H ÷µøP Aa]h¼ß £¯ß£õkPÎÀ H÷uÝ® CµsiøÚz u¸P.
Give any two applications of DNA finger printing.

19. öuõßø©¯õÚ §ª°À Põn¨£mh Áõ²UPøͨ £mi¯¼kP.
List out the major gases seems to be found in the primitive earth.

20. ©Ûu CÚzvß £›nõ©z ÷uõØÓzvß {ø»PøÍ RÌ÷|õUS Á›ø\°À
Á›ø\¨£kzxP.
Bìmµ÷»õ¤zvPì → ÷íõ÷©õ GµUhì → ÷íõ÷©õ ÷\¨¤¯ßì →
µõ©õ ¤zvPì → ÷íõ÷©õ íõ¤¼ì
Rearrange the descent in human evolution.
Australopithecus → Homo erectus → Homo sapiens → Ramapithecus → Homo habilis

A [ v¸¨¦P / Turn over

8337 8

21. ©Ûu Eh®¤ß £õxPõ¨¤À EªÌ}º GÆÁõÖ ö\¯À£kQÓx ?
How does Saliva act in body defence ?

22. ~sq°›PÍõÀ EØ£zv ö\´¯¨£k® E°›¯ ö\¯À vÓÝÒÍ ‰»UTÖPÒ
CµsiøÚ²®, AÁØÔß £¯ßPøͲ® TÖP.
Give any two bioactive molecules produced by microbes and state their uses.

23. ¦v¯ `ǾUS Cn[PÀ GßÓõÀ GßÚ ?
What is Acclimatisation ?

24. ¤Ó¨¦ Ãu® ©ØÖ® CÓ¨¦ Ãu® GßÓõÀ GßÚ ?
Differentiate Natality and Mortality.
£Sv & III / PART - III
SÔ¨¦ : GøÁ÷¯Ý® BÖ ÂÚõUPÐUS Âøh¯ÎUPÄ®. ÂÚõ Gs 33 &US
Pmhõ¯©õP Âøh¯ÎUPÄ®. 6x3=18
Note : Answer any six questions. Question No. 33 is Compulsory.

25. ¤ÍÄÖuÀ ©ØÖ® xshõuÀ BQ¯ÁØøÓz uS¢u GkzxUPõmkhß
÷ÁÖ£kzxP.
Differentiate Fission and Fragmentation with suitable examples.

26. RÌUPshÁØÔØPõÚ Â›ÁõUP® u¸P.
(1) ZIFT
(2) I C S I
(3) I U T
Give the expansion for the following.
(1) Z I F T
(2) I C S I
(3) I U T

27. SÖUS ©ÖUS ©µ¦UPhzuÀ GßÓõÀ GßÚ ? GkzxUPõmk u¸P.
What is criss-cross inheritance ? Give example.

28. RÌUPõq® £iö¯kzuÀ A»QØPõÚ SÔ±mk Á›ø\°ß£i, E¸ÁõUP¨£k®
yx Bº Gß H &ÂÀ EÒÍ {³UÎ÷¯õøhk Á›ø\°øÚ GÊxP.
5' TGCATGCATGCATGCATGCATGCATGC 3'
If the coding sequence in a transcription unit is written as follows :
5' TGCATGCATGCATGCATGCATGCATGC 3'
Write down the nucleotide sequence of mRNA.

A

9 8337

29. RÌUPõq® AmhÁønø¯ {øÓÄ ö\´.
÷|õ´PÒ ÷|õ´UPõµo ÷|õ´zöuõØÖ® Ch®
¦mhõÍ®ø©
]ßÚ®ø©
öh[S Põ´a\À
Complete the following table.

Diseases Causative agent Site of infections
Mumps
Chicken pox
Dengue fever

30. E°›¯z wºÄ GßÓõÀ GßÚ ? Auß ÁøPPøÍU TÖP.
What is bioremediation ? Mention their types.

31. J¸ E°›°À ©µ£q ]Qaø\ •øÓ ‰»® C¯À£õÚ ©µ£qUPøÍ ÁÇ[Q
©µ¤¯À SøÓ£õkPøÍ \›ö\´¯ ÂøÇQßÓÚº. CuÚõÀ E°›°ß ö\¯À£õkPÒ
«Í¨ö£Ó¨£kQßÓÚ.
CuØS ©õØÓõP ©µ£qÂß EØ£zv ö£õ¸ÍõÚ ö|õv ©õØÖ ]Qaø\ •øÓ
‰»•® E°›°ß ö\¯À£õkPÒ «Í¨ö£Ó¨£kQßÓÚ.
÷©ØSÔ¨¤mh Cµsk •øÓPÎÀ ]Ó¢ux Gx GÚ }º P¸xQßÕº ? u[PÒ
P¸zxUPÐUPõÚ Põµn[PøÍU SÔ¨¤hÄ®.
Gene Therapy is an attempt to correct a Genetic defect by providing a normal gene into the
individual. By this the function can be restored.
An alternate method could be to provide gene product known as enzyme replacement therapy,
which would also restore the function.
Which in your opinion is a better option ?
Give reasons for your answer.

32. C¢v¯õ¾ÒÍ ªøP EÒѺ E°›Ú¨ £SvPÒ GzuøÚ ? AÁØøÓ ö£¯›kP.
How many HOTSPOTS are there in INDIA ? Name them.

33. ÷ÁÍõs ÷Áv¨ö£õ¸mPÒ GßÓõÀ GßÚ ? AÁØøÓ AvP©õP¨
£¯ß£kzxÁuõÀ HØ£k® ÂøÍÄPÒ H÷uÝ® CµsiøÚU SÔ¨¤kP.
What is meant by agrochemicals ? Mention any 2 (Two) effects of over usage of agrochemicals.

A [ v¸¨¦P / Turn over

8337 10

£Sv & IV / PART - IV
SÔ¨¦ : AøÚzx ÂÚõUPÐUS® Âøh¯ÎUPÄ®. 5x5=25
Note : Answer all the questions.

34. (A) ©Ûu AshPzvß Aø©¨ø£ ÂÍUSP.
AÀ»x
(B) ©µ¦ Ai¨£øh°À ©ÛuÛß ABO Cµzu ÁøPø¯ ÂÁ›UPÄ®.
(a) Explain the structure of the Human ovary.
OR
(b) Explain the genetic basis of ABO Blood grouping in man.

35. (A) Rh & Põµo°ß CnUPªßø© £ØÔ GÊxP. AÁØøÓ GÆÁõÖ ukUP»õ® ?
AÀ»x
(B) ]ØÔÚ[PÒ ©µ£ØÖ¨ ÷£õÁuõÀ HØ£k® ‰ßÖ uõUP {ø»PøÍ ÂÁ›UPÄ®.
(a) Write about incompatibility of Rh factor and how it can be prevented ?
OR
(b) Explain the three level of impact of extinction of species.

36. (A) ©Ûu ©µ£q vmhzvß ]Ó¨¤¯À¦PÒ H÷uÝ® I¢vøÚU SÔ¨¤kP.
AÀ»x
(B) ÷£õøu ©ØÖ® ©xøÁ Áøµ¯øÓ°ßÔ £¯ß£kzxÁøuz ukUP ]»
ÁÈPøͨ £›¢xøµ ö\´P.
(a) Mention any five salient features of Human Genome Project.
OR
(b) Suggest some ways to prevent drug and alcohol abuse.

37. (A) C®²÷ÚõS÷Íõ¦¼ß Aø©¨ø£ uS¢u £hzxhß ÂÍUSP.
AÀ»x
(B) {»ÁõÌ E°›Ú[PÎÀ Põn¨£k® uPÁø©¨¦PøÍ ÂÍUSP.
(a) Explain the structure of immunoglobulin with suitable diagram.
OR
(b) List the adaptations seen in terrestrial animals.

A

11 8337

38. (A) r &÷uºÄ ö\´u ©ØÖ® k &÷uºÄ ö\´u ]ØÔÚ[PÐUQøh÷¯ EÒÍ
÷ÁÖ£õkPøÍU TÖP.
AÀ»x
(B) ]Ö SÔ¨¦ ÁøµP :
(i) £õxPõUP¨£mh £SvPÒ
(ii) ÁÚ»[S ¦P¼h[PÒ
(iii) WWF

(a) Differentiate between r-selected and k-selected species.
OR
(b) Write short notes on :
(i) Protected areas
(ii) Wild life sanctuaries
(iii) WWF

-oOo-

A [ v¸¨¦P / Turn over