JAC Class 12 Model Question Paper 2025 Biology

2025

MODEL
PAPERS
JAC BOARD JHARKHAND
EXAM ACADEMIC
COUNCIL MODEL
PREPARATION QUESTION
PAPER 2025

JHARKHAND ACADEMIC COUNCIL

झारखण्ड शैक्षिक अनुसंधान एवं प्रशिक्षण परिषद, राँची
वार्षि क इं टरमीडिएट परीक्षा (2024- 2025)
प्रतिदर्श प्रश्न पत्र /Model Question Paper

कक्षा- 12 विषय- जीव विज्ञान समय- 3 घंटा पूर्णांक- 70

Instructions / निर्देश:
1. All questions are compulsory. Candidates must answer questions in their own
words wherever possible. / सभी प्रश्न अनिवार्य हैं। परीक्षार्थी यथासंभव अपने शब्दों में उत्तर दें।
2. The question paper is divided into four sections: Group-A, Group-B, Group-C, and
Group-D. / प्रश्न पत्र चार समूहों में विभाजित है: समूह-अ, समूह- ब, समूह- स, और समूह- द।
3. The total number of questions is 48. / कुल प्रश्नों की संख्या 48 है।
4. Marking Scheme / अंक योजना:
I. Group-A: 25 objective questions, each carrying 1 mark. No negative marking
for wrong answers. / समूह-अ: 25 वस्तुनिष्ठ प्रश्न, प्रत्येक 1 अंक के हैं। गलत उत्तर के लिए
कोई नकारात्मक अंकन नहीं होगा।
II. Group-B: 9 questions, each carrying 1 mark. Answer any 7 questions. / समूह- ब:
9 प्रश्न, प्रत्येक 1 अंक का है। 7 प्रश्नों के उत्तर देने हैं।
III. Group-C: 8 questions, each carrying 3 marks. Answer any 6 questions. / समूह-
स: 8 प्रश्न, प्रत्येक 3 अंक के हैं। 6 प्रश्नों के उत्तर देने हैं।
IV. Group-D: 6 questions, each carrying 5 marks. Answer any 4 questions. / समूह-
द: 6 प्रश्न, प्रत्येक 5 अंक के हैं। 4 प्रश्नों के उत्तर देने हैं।
5. If there is any discrepancy in the Hindi translation of the questions, the English
version will prevail. / यदि प्रश्नों के हिं दी अनुवाद में कोई विसंगति हो तो अंग्रेजी संस्करण मान्य होगा।

GROUP - A ( समूह-अ)
Objective Type Question ( वस्तुनिष्ठ प्रश्न)

1. In angiosperms, male gametes are formed by the division of / आवृतबीज पौधों में नर
युग्मक का निर्माण किसके विभाजन से होता है?
(a) Microspore mother cell / माइक्रोस्पोर मदर सेल
(b) Microspore / माइक्रोस्पोर
(c) Generative cell / जनरेटिव सेल
(d) Vegetative cell / वेजिटे टिव सेल

2. Seminal plasma, the fluid part of semen, is contributed by / वीर्य का तरल भाग,
सेमिनल प्लाज्मा, का योगदान किससे होता है?
(i) Seminal vesicle / सेमिनल वेसिकल
(ii) Prostate gland / प्रोस्टे ट ग्रंथि

(iii) Urethra / मूत्रमार्ग
(iv) Bulbourethral gland / बल्बोयूरथ्र े ल ग्रंथि

(a) (i) and (ii) / (i) और (ii)
(b) (i), (ii) and (iv) / (i), (ii) और (iv)

(c) (ii), (iii) and (iv) / (ii), (iii) और (iv)
d) (i) and (iv) / (i) और (iv)

3. In Mendel’s experiments with garden pea, round seed shape (RR) was dominant
over wrinkled seeds (rr), yellow cotyledon (YY) was dominant over green
cotyledon (yy). What are the expected phenotypes in the F2 generation of the
cross RRYY × rryy? / मेंडल के मटर के पौधे पर किए गए प्रयोगों में गोल बीज का आकार (RR)
सिकुड़े हुए बीज (rr) पर प्रभावी था, और पीले बीजपत्र (YY) हरे बीजपत्र (yy) पर प्रभावी थे। क्रॉस
RRYY × rryy की F2 पीढ़ी में अपेक्षित गुणसूत्र प्रकार क्या होंगे?
(a) Round seeds with yellow cotyledons, and wrinkled seeds with yellow
cotyledons. / गोल बीज पीले बीजपत्र के साथ और सिकुड़े हुए बीज पीले बीजपत्र के साथ।
(b) Only round seeds with green cotyledons. / केवल गोल बीज हरे बीजपत्र के साथ।
(c) Only wrinkled seeds with yellow cotyledons. / केवल सिकुड़े हुए बीज पीले बीजपत्र
के साथ।
(d) Only wrinkled seeds with green cotyledons. / केवल सिकुड़े हुए बीज हरे बीजपत्र
के साथ।

4. Emergency contraceptives are effective if used within / आपातकालीन गर्भनिरोधक
प्रभावी होते हैं यदि इनका उपयोग किस अवधि के भीतर किया जाए?
(a) 72 hrs of coitus / सहवास के 72 घंटे के भीतर
(b) 72 hrs of ovulation / डिं बोत्सर्जन के 72 घंटे के भीतर
(c) 72 hrs of menstruation / मासिक धर्म के 72 घंटे के भीतर
(d) 72 hrs of implantation / आरोपण के 72 घंटे के भीतर

5. Choose the correct statement regarding the ZIFT procedure. / ZIFT प्रक्रिया के बारे में
सही कथन चुनें।
(a) Ova collected from a female donor are transferred to the fallopian tube to
facilitate zygote formation. / महिला दाता से संग्रहित डिं ब को फेलोपियन ट्यूब में
स्थानांतरित किया जाता है ताकि युग्मज का निर्माण हो सके।
(b) Zygote is collected from a female donor and transferred to the fallopian
tube / युग्मज को महिला दाता से संग्रहित कर फेलोपियन ट्यूब में स्थानांतरित किया जाता
है।
(c) Zygote is collected from a female donor and transferred to the uterus /
युग्मज को महिला दाता से संग्रहित कर गर्भाशय में स्थानांतरित किया जाता है।
(d) Ova collected from a female donor and transferred to the uterus / महिला
दाता से संग्रहित डिं ब को गर्भाशय में स्थानांतरित किया जाता है।

6. Conditions of a karyotype 2n + 1, 2n – 1 and 2n + 2, 2n – 2 are called / कैरियोटाइप की
स्थितियां 2n + 1, 2n – 1 और 2n + 2, 2n – 2 को क्या कहते हैं?
(a) Aneuploidy / ऐन्यूप्लॉइडी
(b) Polyploidy / पॉलिप्लॉइडी

(c) Allopolyploidy / एलोपॉलीप्लॉइडी
(d) Monosomy / मोनोसोमी

7. In a dihybrid cross, if you get 9:3:3:1 ratio it denotes that / द्विलक्षणी संकरण में, यदि
9:3:3:1 अनुपात प्राप्त होता है तो यह दर्शाता है कि:

(a) The alleles of two genes are interacting with each other / दो जीन के एलील
एक दूसरे के साथ परस्पर क्रिया कर रहे हैं।
(b) It is a multigenic inheritance / यह बहुजीनिक वंशानुक्रम है।
(c) It is a case of multiple allelism / यह एकाधिक एलीलिज़्म का मामला है।
(d) The alleles of two genes are segregating independently / दो जीन के एलील
स्वतंत्र रूप से विभाजित हो रहे हैं।

8. In the F2 generation of a Mendelian dihybrid cross, the number of phenotypes and
genotypes are / मेंडलीय द्विलक्षणी संकरण की F2 पीढ़ी में, फीनोटाइप और जीनोटाइप की संख्या
क्या है?
(a) Phenotypes - 4; Genotypes - 16 / फीनोटाइप - 4; जीनोटाइप - 16
(b) Phenotypes - 9; Genotypes - 4 / फीनोटाइप - 9; जीनोटाइप - 4
(c) Phenotypes - 4; Genotypes - 8 / फीनोटाइप - 4; जीनोटाइप - 8
(d) Phenotypes - 4; Genotypes - 9 / फीनोटाइप - 4; जीनोटाइप - 9

9. DNA is a polymer of nucleotides which are linked to each other by 3′→ 5′
phosphodiester bond. To prevent polymerisation of nucleotides, which of the
following modifications would you choose? / डीएनए न्यूक्लियोटाइड्स का एक बहुलक है
जो एक दूसरे से 3′→ 5′ फॉस्फोडायस्टर बंध द्वारा जुड़े होते हैं। न्यूक्लियोटाइड्स के बहुलकीकरण को
रोकने के लिए आप निम्नलिखित में से कौन सा संशोधन चुनेंगे?
(a) Replace purine with pyrimidines / प्यूरिन को पिरिमिडिन से बदलें ।
(b) Remove/replace 3' OH group in deoxyribose / डिऑक्सीराइबोज में 3' OH समूह
को हटाएं /बदलें ।
(c) Remove/replace 2' OH group with some other group in deoxyribose /
डिऑक्सीराइबोज में 2' OH समूह को किसी अन्य समूह से बदलें ।
(d) Both ‘b’ and ‘c’ / 'b' और 'c' दोनों।

10. While analysing the DNA of an organism, a total number of 5386 nucleotides were
found, out of which the proportion of different bases was: Adenine = 29%, Guanine
= 17%, Cytosine = 32%, Thymine = 17%. Considering the Chargaff’s rule, it can be
concluded that / एक जीव के डीएनए का विश्ले षण करते समय कुल 5386 न्यूक्लियोटाइड पाए
गए, जिनमें से विभिन्न आधारों का अनुपात था: एडेनिन = 29%, गुआनिन = 17%, साइटोसिन = 32%,
थाइमिन = 17%। चार्गफ के नियम को ध्यान में रखते हुए, यह निष्कर्ष निकाला जा सकता है कि:
(a) It is a double-stranded circular DNA / यह डबल-स्ट्रैं डेड गोलाकार डीएनए है।
(b) It is single-stranded DNA / यह एकल-स्ट्रैं डेड डीएनए है।
(c) It is a double-stranded linear DNA / यह डबल-स्ट्रैं डेड रैखिक डीएनए है।
(d) No conclusion can be drawn / कोई निष्कर्ष नहीं निकाला जा सकता।

11. If Meselson and Stahl's experiment is continued for four generations in bacteria,
the ratio of N15/N15: N15/N14: N14/N14 containing DNA in the fourth generation
would be / यदि मेसेलसन और स्टाल का प्रयोग बैक्टीरिया में चार पीढ़ियों तक जारी रखा जाता है,
तो N15/N15: N15/N14: N14/N14 डीएनए का अनुपात चौथी पीढ़ी में क्या होगा?

(a) 1:2:1 / 1:2:1
(b) 1:3:1 / 1:3:1
(c) 1:1:2 / 1:1:2
(d) 1:1:3 / 1:1:3

12. The most important feature in a plasmid to be used as a vector is / प्लाज्मिड में सबसे
महत्वपूर्ण विशेषता, जिसे एक वेक्टर के रूप में उपयोग किया जाता है, है:
(a) origin of replication (ori) / उत्पत्ति का प्रतिकृति (ori)
(b) presence of a selectable marker / चयन करने योग्य चिह्न की उपस्थिति
(c) presence of sites for restriction endonuclease / प्रतिबंध एं डोन्यूक्लीएज के स्थलों
की उपस्थिति
(d) its size / इसका आकार

13. C-peptide of human insulin is / मानव इं सुलिन का C-पेप्टाइड है:
(a) a part of mature insulin molecule / परिपक्व इं सुलिन अणु का एक हिस्सा
(b) responsible for formation of disulphide bridges / डिसल्फाइड ब्रिज के निर्माण के
लिए जिम्मेदार
(c) removed during maturation of proinsulin to insulin / प्रोइं सुलिन से इं सुलिन में
परिपक्वता के दौरान हटाया जाता है
(d) responsible for its biological activity / इसके जैविक कार्य के लिए जिम्मेदार

14. According to Allen’s Rule, the mammals from colder climates have / एले न के नियम
के अनुसार, ठं डे जलवायु के स्तनधारियों में होते हैं:
(a) shorter ears and longer limbs / छोटे कान और लं बे अंग
(b) longer ears and shorter limbs / लं बे कान और छोटे अंग
(c) longer ears and longer limbs / लं बे कान और लं बे अंग
(d) shorter ears and shorter limbs / छोटे कान और छोटे अंग

15. Pyramid of numbers is / संख्या का पिरामिड है:
(a) always upright / हमेशा सीधा
(b) always inverted / हमेशा उल्टा
(c) either upright or inverted / या तो सीधा या उल्टा
(d) neither upright nor inverted / न तो सीधा और न ही उल्टा

16. HIV that causes AIDS, first starts destroying / एड्स का कारण बनने वाला एचआईवी सबसे
पहले नष्ट करता है:
(a) helper T-lymphocytes / सहायक टी-लिंफोसाइट्स
(b) B-lymphocytes / बी-लिंफोसाइट्स
(c) leucocytes / ल्यूकोसाइट्स

17. Which of the following is an example of hormone-releasing IUDs? / निम्नलिखित में से
कौन हार्मोन-उत्सर्जक आईयूडी का उदाहरण है?
(a) CuT and Multilobed 375 / कॉपर-टी और मल्टीलोब्ड 375
(b) LNG-20 and Progestasert / एलएनजी-20 और प्रोजेस्टासर्ट
(c) Lippes loop / लिप्स लू प
(d) Both (b) and / (b) और (c) दोनों

18.
Match the following list of bioactive substances and their roles / जैव सक्रिय पदार्थों
और उनकी भूमिकाओ ं की निम्नलिखित सूची का मिलान करें:

Bioactive Substance / Role / भूमिका
जैव सक्रिय पदार्थ

A. Statin / स्टे टिन (i) Removal of oil stains / तेल के धब्बों को हटाना

B. Cyclosporin A / (ii) Removal of clots from blood vessels / रक्त वाहिकाओ ं
साइक्लोस्पोरिन A से थक्कों को हटाना

C. Streptokinase / (iii) Lowering of blood cholesterol / रक्त कोले स्ट्रॉल को
स्ट्रे प्टोकिनेज़ कम करना

D. Lipase / लाइपेज़ (iv) Immuno-suppressive agent / प्रतिरक्षा-दमनकारी
एजेंट

Choose the correct match. / सही मिलान चुनें:
(a) A-(ii), B-(iii), C-(i), D-(iv)
(b) A-(iv), B-(ii), C-(i), D-(iii)
(c) A-(iv), B-(i), C-(ii), D-(iii)
(d) A-(iii), B-(iv), C-(ii), D-(i)

19. In a certain taxon of insects, some have 17 chromosomes and the others have 18
chromosomes. The 17 and 18 chromosome-bearing organisms are / कीड़ों के एक
निश्चित वर्ग में, कुछ में 17 गुणसूत्र होते हैं और अन्य में 18 गुणसूत्र होते हैं। 17 और 18 गुणसूत्रों वाले जीव
हैं:
(a) males and females, respectively / क्रमशः नर और मादा
(b) females and males, respectively / क्रमशः मादा और नर
(c) all males / सभी नर
(d) all females / सभी मादा

20 Which of the following steps are catalysed by Taq DNA polymerase in a PCR
. reaction? / निम्नलिखित में से कौन से चरण Taq DNA पॉलिमरेज़ द्वारा PCR अभिक्रिया में
उत्प्रेरित किए जाते हैं?
(a) Denaturation of template DNA / टे म्पले ट डीएनए का डीनैचुरश
े न
(b) Annealing of primers to template DNA / टे म्पले ट डीएनए पर प्राइमर्स का एनीलिंग
(c) Extension of primer end on the template DNA / टे म्पले ट डीएनए पर प्राइमर छोर
का विस्तार
(d) All of the above / उपरोक्त सभी

21. Which one of the following is not a major characteristic feature of biodiversity hot

spots? / निम्नलिखित में से कौन जैव विविधता हॉट स्पॉट की प्रमुख विशेषताओ ं में से नहीं है?
(a) Large number of species / प्रजातियों की बड़ी संख्या
(b) Abundance of endemic species / स्थानिक प्रजातियों की प्रचुरता
(c) Mostly located in the tropics / मुख्य रूप से उष्णकटिबंधीय में स्थित
(d) Mostly located in the polar regions / मुख्य रूप से ध्रुवीय क्षेत्रों में स्थित

22. Match the scientists listed under column ‘I’ with ideas listed in column ‘II’ / स्तंभ 'I' में
सूचीबद्ध वैज्ञानिकों को स्तंभ 'II' में दिए गए विचारों से मिलाएं ।

Column I / स्तंभ I Column II / स्तंभ II

A. Darwin (i) Abiogenesis / अबायोजेनेसिस

B. Oparin (ii) Use and disuse of organs / अंगों का उपयोग और त्याग

C. Lamarck (iii) Continental drift theory / महाद्वीपीय विस्थापन सिद्धांत

D. Wagner (iv) Evolution by natural selection / प्राकृतिक चयन द्वारा
विकास

Options / विकल्प:
(a) A-(i); B-(iv); C-(ii); D-(iii)
(b) A-(iv); B-(i); C-(ii); D-(iii)
(c) A-(ii); B-(iv); C-(iii); D-(i)
(d) A-(iv); B-(iii); C-(ii); D-(i)

23. Viviparity is considered to be more evolved because / जीवजनन को अधिक विकसित
माना जाता है क्योंकि:
(a) The young ones are left on their own / युवा को अपने हाल पर छोड़ दिया जाता है।
(b) The young ones are protected by a thick shell / युवा को एक मोटे खोल द्वारा
संरक्षित किया जाता है।
(c) The young ones are protected inside the mother’s body and are looked
after after they are born, leading to more chances of survival / युवा को माँ के
शरीर के अंदर संरक्षित किया जाता है और उनके जन्म के बाद उनकी देखभाल की जाती है,
जिससे उनके जीवित रहने की संभावना बढ़ जाती है।
(d) The embryo takes a long time to develop / भ्रूण को विकसित होने में अधिक समय
लगता है।

24 In malignant tumors, the cells proliferate, grow rapidly, and move to other parts of
. the body to form new tumors. This stage of disease is called / घातक ट्यूमर में,
कोशिकाएं तेजी से बढ़ती हैं और शरीर के अन्य भागों में जाकर नए ट्यूमर बनाती हैं। इस बीमारी की
अवस्था को कहा जाता है:
(a) Metagenesis / मेटाजेनेसिस
(b) Metastasis / मेटास्टे सिस
(c) Teratogenesis / टे राटोजेनेसिस
(d) Mitosis / माइटोसिस

25. Match the following list of bacteria and their commercially important products /
बैक्टीरिया और उनके व्यावसायिक रूप से महत्वपूर्ण उत्पादों की सूची का मिलान करें:

Bacterium / बैक्टीरिया Product / उत्पाद

A. Aspergillus niger (i) Lactic acid / लै क्टिक अम्ल

B. Acetobacter aceti (ii) Butyric acid / ब्युटिरिक अम्ल

C. Clostridium butylicum (iii) Acetic acid / एसिटिक अम्ल

D. Lactobacillus (iv) Citric acid / साइट्रिक अम्ल

Choose the correct match / सही मिलान चुनें:
(a) A-(ii), B-(iii), C-(iv), D-(i)
(b) A-(ii), B-(iv), C-(iii), D-(i)
(c) A-(iv), B-(iii), C-(ii), D-(i)
(d) A-(iv), B-(i), C-(iii), D-(ii)

GROUP -B ( समुह- ब)
अति लघु उत्तरीय प्रश्न (VERY SHORT ANSWER TYPE QUESTION)

26. Draw a diagram of a matured microspore of an angiosperm. Label its cellular
components only. / एं जियोस्पर्म के परिपक्व सूक्ष्मबीजाणु का एक चित्र बनाएं । केवल इसके
कोशिकीय घटकों को ले बल करें।

27. Given below are the stages in human reproduction. Write them in correct
sequential order. / मानव प्रजनन के चरण नीचे दिए गए हैं। इन्हें सही अनुक्रम में लिखें।
Insemination, Gametogenesis, Fertilisation, Parturition, Gestation,
Implantation / अंतःस्रवण, युग्मकजनन, निषेचन, प्रसव, गर्भकाल, आरोपण।

28. State a difference between a gene and an allele. / जीन और एलील में एक अंतर बताएं ।

29. When and why do some animals go into hibernation? / कुछ जानवर कब और क्यों
शीतनिद्रा में चले जाते हैं?

30 How does haemozoin affect the human body when released in blood during
. malarial infection? / मले रिया संक्रमण के दौरान रक्त में हीमोजोइन रिलीज होने पर यह मानव
शरीर को कैसे प्रभावित करता है?

31. BOD of waste water is estimated by measuring the amount of / अपशिष्ट जल का
बीओडी मापने के लिए किस मात्रा का अनुमान लगाया जाता है?

32. What is the difference between endemic and exotic species? / स्थानिक और विदेशी
प्रजातियों में क्या अंतर है?

33. Name the type of biodiversity represented by the following: / निम्नलिखित द्वारा दर्शाई
गई जैव विविधता के प्रकार का नाम बताएं :
(i) 1000 varieties of mangoes in India. / भारत में आम की 1000 किस्में।
(ii) Variations in potency and concentration of reserpine in Rauwolfia
vomitoria growing in different regions of the Himalayas. / हिमालय के विभिन्न
क्षेत्रों में उगने वाले राउवोल्फिया वॉमिटोरिया में रेसरपीन की क्षमता और एकाग्रता में

भिन्नताएं ।

34
. What are biodiversity hot spots? / जैव विविधता हॉटस्पॉट क्या हैं?

Group C (समुह- स)
लघु उत्तरीय प्रश्न (Short Answer Type Question)

35 Differentiate between geitonogamy and xenogamy in plants. Which one between
. the two will lead to inbreeding depression and why? / पौधों में गाइटनोगैमी और ज़ेनोगैमी
में अंतर करें। इन दोनों में से कौन सा इनब्रिडिं ग डिप्रेशन का कारण बनेगा और क्यों?

36 (i) Draw a sectional view of the seminiferous tubule of a human. Label the
. following cells in the seminiferous tubule: / मानव के वृषण नलिका का खंडीय दृश्य बनाएं ।
वृषण नलिका में निम्नलिखित कोशिकाओ ं को ले बल करें:
(a) Cells that divide by mitosis to increase their number. / कोशिकाएं जो अपनी
संख्या बढ़ाने के लिए मिटोसिस द्वारा विभाजित होती हैं।
(b) Cells that undergo Meiosis I. / कोशिकाएं जो मीओसिस I से गुजरती हैं।
(c) Cells that undergo Meiosis II. / कोशिकाएं जो मीओसिस II से गुजरती हैं।
(d) Cells that help in the process of spermiogenesis. / कोशिकाएं जो
स्पर्मि ओजेनेसिस की प्रक्रिया में सहायता करती हैं।
(ii) Mention the role of Leydig cells. / ले यडिग कोशिकाओ ं की भूमिका का उल्ले ख करें।

37. A cross was carried out between two pea plants showing the contrasting traits of
the height of the plant. The result of the cross showed 50% of parental characters.
/ दो मटर के पौधों के बीच एक क्रॉस किया गया, जिसमें पौधे की ऊँचाई के विपरीत लक्षण प्रदर्शि त हो
रहे थे। क्रॉस के परिणाम में 50% पैतृक लक्षण दिखे।

(i) Work out the cross with the help of a Punnett square. / पुनेट स्क्वायर की सहायता से
क्रॉस का निर्धारण करें।
(ii) Name the type of the cross carried out. / किए गए क्रॉस के प्रकार का नाम बताएं ।

38 Define: / परिभाषित करें:
. (a) Metastasis / मेटास्टे सिस
(b) Vaccination / टीकाकरण

39 If the sequence of one strand of DNA is written as follows: / यदि डीएनए के एक स्ट्रैं ड का
. अनुक्रम निम्नलिखित रूप में लिखा गया है:
5′—ATGCATGCATGCATGCATGCATGCATGC—3′
Write down the sequence of complementary strand in 5′→3′ direction. / पूरक स्ट्रैं ड
का अनुक्रम 5′→3′ दिशा में लिखें।

40 Draw a schematic representation of dinucleotide. Label the following: /
. डायन्यूक्लियोटाइड का योजनात्मक चित्रण बनाएं । निम्नलिखित को ले बल करें:
(i) The components of a nucleotide / न्यूक्लियोटाइड के घटक
(ii) 5′ end / 5′ सिरा
(iii) N-glycosidic linkage / N-ग्लाइकोसिडिक बंध
(iv) Phosphodiester linkage / फॉस्फोडाइएस्टर बंध

41. Define algal bloom. How does it affect an ecosystem? / शैवाल प्रस्फुटन को परिभाषित
करें। यह एक पारितंत्र को कैसे प्रभावित करता है?

42 What is DNA fingerprinting? Mention its application. / डीएनए फिंगरप्रिं टिंग क्या है? इसके
. अनुप्रयोगों का उल्ले ख करें।

Group - D (समूह- द)
दीर्घ उत्तरीय प्रश्न (Long Answer Type Question)

43 (a) What is the trophic level of an ecosystem? What is ‘standing crop’ with
. reference to it? / किसी पारिस्थितिकी तंत्र में पोषण स्तर (ट्रॉफिक ले वल) क्या होता है? इसके
संदर्भ में 'स्थायी फसल' (स्टैं डिंग क्रॉप) क्या है?
(b) Explain the role of the ‘first trophic level’ in an ecosystem. / किसी पारिस्थितिकी
तंत्र में 'पहले पोषण स्तर' (फर्स्ट ट्रॉफिक ले वल) की भूमिका को समझाइए।
(c) How is the detritus food chain connected with the grazing food chain in a
natural ecosystem? / प्राकृतिक पारिस्थितिकी तंत्र में मलबा खाद्य श्रृंखला (डिट्रिटस फूड चेन)
चराई खाद्य श्रृंखला (ग्रेजिंग फूड चेन) से कैसे जुड़ी होती है?

44 (a) Name the specific type of gene that is incorporated in a cotton plant to protect
. the plant against cotton bollworm infestation. / उस विशिष्ट जीन का नाम बताएं जिसे
कपास के पौधे में कपास की बॉल वर्म संक्रमण से बचाने के लिए डाला जाता है।
(b)State a method of cellular defense which works in all eukaryotic organisms. /
एक कोशिकीय सुरक्षा विधि बताएं जो सभी यूकैरियोटिक जीवों में कार्य करती है।
(c)What is the significance of the process of RNA interference (RNAi) in eukaryotic
organisms? / यूकैरियोटिक जीवों में RNA हस्तक्षेप (RNAi) की प्रक्रिया का महत्व क्या है?
(d)Mention the chemical change that proinsulin undergoes to be able to act as
mature insulin. / उस रासायनिक परिवर्तन का उल्ले ख करें जो प्रोसुलिन में होता है ताकि वह
परिपक्व इं सुलिन के रूप में कार्य कर सके।
(e)State the role of transposons in silencing of mRNA in eukaryotic cells. /
यूकैरियोटिक कोशिकाओ ं में mRNA की शांति में ट्रांसपोसॉन्स की भूमिका बताएं ।

45 (a)Which main technique and instrument is used to isolate DNA from any plant
. cell? / किसी भी पौधे की कोशिका से DNA अलग करने के लिए कौन-सी मुख्य तकनीक और
उपकरण का उपयोग किया जाता है?
(b)What is the cell that receives a recombinant gene called? / उस कोशिका को क्या
कहा जाता है जो पुनः संयोजित जीन प्राप्त करती है?
(c)Why is a thermostable DNA polymerase needed in amplification (genetic
engineering)? / प्रवर्धन (आनुवंशिक इं जीनियरिं ग) में थर्मोस्टे बल DNA पोलीमरेज़ की
आवश्यकता क्यों होती है?
(d)Identify the reason for the selection of DNA polymerase from Thermus
aquaticus for Polymerase Chain Reaction. / पोलीमरेज़ चेन रिएक्शन के लिए Thermus
aquaticus से DNA पोलीमरेज़ के चयन का कारण बताएं ।
(e)How is repetitive/satellite DNA separated from bulk genomic DNA for various
genetic experiments? / विभिन्न आनुवंशिक प्रयोगों के लिए रिपिटिटिव/सैटेलाइट DNA को
थोक जीनोमिक DNA से कैसे अलग किया जाता है?

46 (a) Draw a diagram of an enlarged view of T.S. of one microsporangium of an
. angiosperm and label the following parts: / एक सपुष्पक के एक माइक्रोस्पोरेंगियम के
टी.एस. का विस्तृत दृश्य का आरेख बनाएं और निम्नलिखित भागों को चिह्नित करें:
(i) Tapetum / टे पेटम

(ii) Middle layer / मध्य परत
(iii) Endothecium / एन्डोथीसियम
(iv) Microspore mother cells / माइक्रोस्पोर जनक कोशिकाएं
(b) Mention the characteristic features and function of tapetum. / टे पेटम की
विशेषताओ ं और कार्य का उल्ले ख करें।
(c) Explain the following giving reasons: / निम्नलिखित को कारण सहित समझाइए:
(i) Pollen grains are well preserved as fossils. / पराग कण जीवाश्म के रूप में अच्छी
तरह संरक्षित रहते हैं।
(ii) Pollen tablets are in use by people these days. / इन दिनों लोग पराग टै बले ट
का उपयोग कर रहे हैं।

47. (a) Draw a schematic representation of the structure of a transcription unit and
show the following in it: / एक ट्रांसक्रिप्शन यूनिट की संरचना का आरेख बनाएं और इसमें
निम्नलिखित दिखाएं :
(i) ट्रांसक्रिप्शन की दिशा
(ii) शामिल दो स्ट्रैं ड की ध्रुवता
(iii) टे म्पले ट स्ट्रैं ड
(iv) टर्मि नेटर जीन
(b) Mention the function of promoter gene in transcription. / ट्रांसक्रिप्शन में प्रॉमोटर
जीन का कार्य बताएं ।

48
.

Study the population growth curves in the graph given below and answer the
questions that follow: / नीचे दिए गए ग्राफ में जनसंख्या वृद्धि वक्रों का अध्ययन करें और नीचे
पूछे गए प्रश्नों का उत्तर दें:

(i) पहचानें कि वक्र 'a' और 'b' कौन से हैं।
(ii) इनमें से कौन सा अधिक यथार्थवादी माना जाता है और क्यों?
(iii) यदि dt/dN = rN(K - N)/K है तो लॉजिस्टिक वृद्धि वक्र में K का क्या अर्थ है?
(iv) N द्वारा क्या प्रतीकित किया जाता है?
(v)What will happen to an ecosystem if / यदि किसी पारिस्थितिकी तंत्र को क्या होगा
यदि:
(a) सभी उत्पादक हटा दिए जाएं ।
(b) सभी घास-खरतनाशक स्तर के जीवों को हटा दिया जाए।
(c) सभी शीर्ष शिकारी जनसंख्या हटा दी जाए।

Answer
1. In angiosperms, male gametes are formed by the division of: Answer: (c)
Generative cell / जनरेटिव सेल
2. Seminal plasma, the fluid part of semen, is contributed by: Answer: (b) (i), (ii)
and (iv) / (i), (ii) और (iv)
3. In Mendel’s experiments with the garden pea, what are the expected
phenotypes in the F2 generation of the cross RRYY × rryy?
Answer: (a) Round seeds with yellow cotyledons, and wrinkled seeds with yellow
cotyledons / गोल बीज पीले बीजपत्र के साथ और सिकुड़े हुए बीज पीले बीजपत्र के साथ।
4. Emergency contraceptives are effective if used within: Answer: (a) 72 hrs of
coitus / सहवास के 72 घंटे के भीतर
5. Choose the correct statement regarding the ZIFT procedure: Answer: (b)
Zygote is collected from a female donor and transferred to the fallopian tube /
युग्मज को महिला दाता से संग्रहित कर फेलोपियन ट्यूब में स्थानांतरित किया जाता है।
6. Conditions of a karyotype 2n + 1, 2n – 1 and 2n + 2, 2n – 2 are called: Answer: (a)
Aneuploidy / ऐन्यूप्लॉइडी
7. In a dihybrid cross, if you get 9:3:3:1 ratio it denotes that: Answer: (d) The
alleles of two genes are segregating independently / दो जीन के एलील स्वतंत्र रूप से
विभाजित हो रहे हैं।
8. In the F2 generation of a Mendelian dihybrid cross, the number of phenotypes
and genotypes are: Answer: (a) Phenotypes - 4; Genotypes - 16 / फीनोटाइप - 4;
जीनोटाइप - 16
9. To prevent polymerisation of nucleotides in DNA, which of the following
modifications would you choose? Answer: (d) Both ‘b’ and ‘c’ / 'b' और 'c' दोनों।
10. Considering the Chargaff’s rule, it can be concluded that: Answer: (b) It is
single-stranded DNA / यह एकल-स्ट्रैं डेड डीएनए है।
11. If Meselson and Stahl's experiment is continued for four generations in
bacteria, the ratio of N15/N15: N15/N14: N14/N14 containing DNA in the fourth
generation would be
Answer: (d) 1:1:3
12. The most important feature in a plasmid to be used as a vector is
Answer: (a) origin of replication (ori)
13. C-peptide of human insulin is
Answer: (c) removed during maturation of proinsulin to insulin
14. According to Allen’s Rule, the mammals from colder climates have
Answer: (d) shorter ears and shorter limbs
15. Pyramid of numbers is
Answer: (c) either upright or inverted

16. HIV that causes AIDS, first starts destroying
Answer: (a) helper T-lymphocytes
17. Which of the following is an example of hormone-releasing IUDs?
Answer: (b) LNG-20 and Progestasert
18. Match the following list of bioactive substances and their roles

Answer: (d) A-(iii), B-(iv), C-(ii), D-(i)
19. In a certain taxon of insects, some have 17 chromosomes and the others have
18 chromosomes. The 17 and 18 chromosome-bearing organisms are
Answer: (a) males and females, respectively
20. Which of the following steps are catalysed by Taq DNA polymerase in a PCR
reaction?
Answer: (c) Extension of primer end on the template DNA
21. Which one of the following is not a major characteristic feature of biodiversity
hot spots?
Answer: (d) Mostly located in the polar regions / मुख्य रूप से ध्रुवीय क्षेत्रों में स्थित
22. Match the scientists listed under column ‘I’ with ideas listed in column ‘II’:
Answer: (b) A-(iv); B-(i); C-(ii); D-(iii)
23. Viviparity is considered to be more evolved because:
Answer: (c) The young ones are protected inside the mother’s body and are
looked after after they are born, leading to more chances of survival / युवा को माँ
के शरीर के अंदर संरक्षित किया जाता है और उनके जन्म के बाद उनकी देखभाल की जाती है,
जिससे उनके जीवित रहने की संभावना बढ़ जाती है।
24. In malignant tumors, the cells proliferate, grow rapidly, and move to other
parts of the body to form new tumors. This stage of disease is called:
Answer: (b) Metastasis / मेटास्टे सिस
25. Match the following list of bacteria and their commercially important products:
Answer: (c) A-(iv), B-(iii), C-(ii), D-(i)

AglaSem Earn while Learn Program. Send your papers and get paid.
Contact: support@

Sample Papers

CBSE Sample Papers
ICSE / ISC Board Sample Papers
AP Board Sample Papers
Assam Board Sample Papers
Bihar Board Sample Papers
Chhattisgarh Board Sample Papers
Goa Board Sample Papers
Gujarat Board Sample Papers
Haryana Board Sample Papers
HP Board Sample Papers
J&K State Board Sample Papers
Jharkhand Board Sample Papers
Karnataka Board Sample Papers
Kerala Board Sample Papers

Sample Papers

MP Board Sample Papers
Maharashtra Board Sample Papers
Manipur Board Sample Papers
Mizoram Board Sample Papers
Orissa Board Sample Papers
Punjab Board Sample Papers
Rajasthan Board Sample Papers
Tamil Nadu Board Sample Papers
Telangana State Board Sample Papers
Tripura Board Sample Papers
UP Board Sample Papers
Uttarakhand Board Sample Papers
West Bengal Board Sample Papers