Page 1
Correct answers are ticked in green.
CHM-X
GS-2015 (Chemistry)
TATA INSTITUTE OF FUNDAMENTAL RESEARCH
Written Test in CHEMISTRY ‐ December 14, 2014
Duration : Three hours (3 hours)
Name : _______________________________________________ Ref. Code : ____________
Please read all instructions carefully before you attempt the questions.
1. Please fill‐in details about name, reference code etc. on the answer sheet. The Answer
Sheet is machine‐readable. Use only Blue/Black ball point pen to fill‐in the answer
sheet.
2. Indicate your ANSWER ON THE ANSWER SHEET by blackening the appropriate circle for
each question. Do not mark more than one circle for any question : this will be treated
as a wrong answer.
3. This is a multiple choice question paper with one section having a total of 40 questions.
Each correct answer will get you 3 marks. Every wrong answer will get you ‐1 mark.
Marks are not awarded or deducted when a question is not attempted. It is better not
to answer a question if you are not sure.
4. We advise you to first mark the correct answers on the QUESTION PAPER and then to
TRANSFER these to the ANSWER SHEET only when you are sure of your choice.
5. Rough work may be done on blank pages of the question paper. If needed, you may ask
for extra rough sheets from an Invigilator.
6. Use of calculators is permitted. Calculator which plots graphs is NOT allowed.
Multiple‐use devices such as cell phones, smart phones etc., CANNOT be used for this
purpose.
7. Do NOT ask for clarifications from the invigilators regarding the questions. They have
been instructed not to respond to any such inquiries from candidates. In case a
correction/clarification is deemed necessary, the invigilator(s) will announce it publicly.
Page 1 of 16
Page 2
SOME USEFUL DATA
Avogadro number = 6.02×1023 mol−1 e = 1.6×10−19 C
RT/F = 0.0257 V at 25°C h = 6.626×10−34 J s
Faraday constant = 96500 C/mol c = 3×108 m s−1
Boltzmann constant k = 1.38×10−23 J K−1 R = 8.314 J K−1 mol−1
Z2
En = − a.u. for hydrogen like atom
2n 2
Mass of an electron = 9.109×10−31 kg
8kT
Average velocity =
π m
For H3PO4, pK1 = 2.16, pK2 = 7.21, pK3 = 12.32
1. Predict the product for the following sugar functionalization reaction:
2. Which of the following cannot act as a chelating agent?
A) HC(CH2CH2NH2)3
B) CH3NHCH2CH2CH3
C) N(CH2CH2NH2)3
D) H2NCH2CH2CH2NH2
Page 2 of 16
Page 3
3. In the following setup, two chambers 1 and 2 are enclosed by a thermally insulated
material. Chamber 1 contains an ideal gas at 100 atm. Chambers 2 is completely
1 2
Seal
evacuated. The two chambers are separated by a breakable seal. Before the seal is
broken, the temperature of the chamber 1 is T1, initial. Then the seal is broken, and the
gas is allowed to rush to chamber 2. The volume of chamber 2 is 100 times the volume
of chamber 1. When the pressure in the two chambers becomes equal, their respective
temperature is T1, final and T2, final. Which of the following statements is true?
A) T1, final = T2, final = T1, initial
B) T2, final = T1, final < T1, initial
C) T2, final < T1, initial , T1, final = T1, initial
D) Only a very small drop in temperature is expected. So T1, final, T2, final will be
approximately equal to T1, initial
cos A − sin A + 1
4. Consider the trigonometric function . It can be simplified as
cos A + sin A − 1
1 + sec A − tan A
A)
1 − sec A + tan A
B) cosec A + cot A
C) 1 /(cosec A − cot A)
D) All of the above
5. The combustion of ethane (C2H6) is represented by the following reaction:
2 C2H6(g) + 7 O2(g) 4 CO2(g) + 6 H2O(l)
Which of the following is TRUE for the above reaction?
A) The rate of consumption of ethane is seven times faster than the rate of
consumption of oxygen
B) Water is formed at a rate equal to two-thirds the rate of formation of CO2
C) The rate of consumption of oxygen equals the rate of formation of water
D) CO2 is formed twice as fast as ethane is consumed
Page 3 of 16
Page 4
6. Consider the following reaction:
Au + O2 + 3F2 → [O2]+ + [AuF6]–
Which statement is correct about the redox changes in this reaction?
A) Au is oxidized; O is oxidized; F is reduced
B) Au is reduced; O is oxidized; F is reduced
C) Au is oxidized; O does not undergo a redox change; F is reduced
D) Au is reduced; O is oxidized; F does not undergo a redox change
7. Formation of Z from X is theoretically expected to obey the following kinetic scheme.
k1 k2
X Y Z
k−1 k−2
An experimentalist wants to verify the above scheme, but can observe and measure the
concentration of only X or Z. Is it possible that under certain conditions, the
measurements of [X] or [Z] as function of time would lead the experimenter to conclude
that the kinetic scheme is as given below, and that the species Y is absent?
kobs
X Z
k−obs
A) No, that is not possible
B) Yes, if k−1 >> k1 and k−2 >> k2
k1 k
C) Yes, if = 2
k −1 k −2
D) Yes, if [Y] attains a steady-state concentration during the experiment
8. NaCl, KCl, NaBr and KBr crystallize in FCC lattices. Their anion and cation touch along the
edge of the unit cell. The dimensions of their unit cells are 562.8 pm, 627.7 pm, 596.2
pm, and 658.6 pm, respectively. From these data, what can you say about the size of the
ionic radii (within an error of about 5%)?
A) Ionic radii of the cations depend on the nature of the anions
B) Ionic radii of the anions depend on the nature of the cations
C) Both (A) and (B)
D) Ionic radii are independent of the counter ions
Page 4 of 16
Page 5
9. Indicate which of the following is/are “acceptable” wave function(s) in quantum
mechanics in the range -∞ < x < +∞
i) ψ = x ii) ψ = x2 iii) ψ = sin x iv) ψ = exp(-x) v) ψ = exp(-x2)
A) iii and v
B) iv only
C) iv and v
D) i and iii
10. For a harmonic oscillator in its ground state i.e. v = 0 state, the energy is given by
E= ½hν, where ν is the vibrational frequency. This is due to its
A) Kinetic energy
B) Potential energy
C) Sum of kinetic and potential energy
D) Heat of formation
11. The state of a certain amount of a gas, not necessarily ideal, is changed from A to B in
various hypothetical paths, as shown below. The total amount of the gas remains
constant. Which of the following paths are physically realizable?
A A A
(i) (ii) (iii)
P P B P
B B
V V V
A
(iv) A
(v)
P P
B B
V V
A) All of them
B) Only (i), (ii) and (iii)
C) Only (iii) and (v)
D) Only (i) and (iii)
Page 5 of 16
Page 6
12. Thiols are important molecular species present in cells and can mediate cell signaling
processes. A procedure for detecting thiols has been recently reported based on the
following reaction. Predict the structures of reaction products.
O N
O pH 7.6
O S O +
SH
O
13. If the peak in the mass spectrum of C2F6 at mass number 138 is 100 units tall, what will
be the heights of the peaks at mass numbers 139 and 140.
(Isotopic abundances: 12C, 98.89%; 13C, 1.11%; 19F, 100%)
A) 2.24 and 0.0126
B) 1.12 and 0.0126
C) 50 and 25
D) 2.24 and 0.025
14. According to the Nernst equation, the potential of an electrode changes by 59.2 mV
whenever the ratio of the oxidized and the reduced species changes by a factor of 10
at 25 °C. What would be the corresponding change in the electrode potential if the
experiment is carried out at 30 °C?
A) 59.2 mV
B) 71.0 mV
C) 60.2 mV
D) None of the above
Page 6 of 16
Page 7
15. Degenerate C-C coupling reactions are very important for synthesizing supramolecular
organic structures. Name the reagents X, Y and Z that would be necessary to make the
C3 symmetric product?
A)
B)
C)
D)
16. What is the point group of Fe2(CO)9 ?
A) C3h
B) D3h
C) C3v
D) D3d
Page 7 of 16
Page 8
17. Which of the following is the curve x = y2.
A) i B) ii C) iii D) iv
18. For a particle undergoing quantum tunneling through a barrier, which of the following is
NOT true:
A) The amplitude of particle wave function after passing the barrier decreases with
an increase in tunneling distance
B) The probability of finding the particle after passing the barrier decreases with
increase in tunneling barrier height
C) The energy of the particle after crossing the barrier decreases with increase in
tunneling distance
D) The change in the phase of the particle wave function upon transmission is
proportional to the tunneling distance
Page 8 of 16
Page 9
19. A magnetic resonance spectrum, recorded using a radiation of frequency 100 MHz, is
shown below. What can you say about the nature of this spectrum?
Signal
Magnetic field
A) It is a continuous-wave NMR spectrum
B) It is a Fourier transform NMR spectrum
C) It is an ESR spectrum
D) None of the above
20. An electron can transfer from state D to state A with a rate kDA. The intrinsic (in the
absence of any charge transfer between states D and A) lifetimes of charge transfer
states D and A are τD and τA, respectively. Assuming that initially the electron is in
state D, under what conditions would kDA be completely determined in terms of the
overall rate at which the electron leaves the combined D+A system.
A) kDA >> 1/τD and kDA >> 1/τA
B) kDA >> 1/τD and kDA << 1/τA
C) kDA << 1/τD and kDA >> 1/τA
D) kDA << 1/τD and kDA << 1/τA
21. A common characteristic of conducting polymers, such as polypyrrole and
polythiophene, which make them conduct electricity is
A) The presence of stereogenic centers of the same configuration
B) A monodisperse distribution in molecular weight
C) Conjugation throughout the polymer chain
D) A very low glass transition temperature
Page 9 of 16
Page 10
22. Which of the following plots represent(s) the Arrhenius rate equation, k = Ae-Ea/RT with A
= 3x107 s-1 and Ea = 3x104 J/mol.
A) i
B) ii
C) iii
D) i and ii
23. Which of the following monomers do you expect to find in a RNA molecule?
A) i B) ii C) iii D) iv
24. How many normal modes does the CO2 molecule have? What if the C and the O atoms
were constrained to move in one dimension?
A) 4 normal modes for free CO2 and 4 for constrained CO2
B) 3 normal modes for free CO2 and 2 for constrained CO2
C) 3 normal modes for free CO2 and 3 for constrained CO2
D) 4 normal modes for free CO2 and 2 for constrained CO2
Page 10 of 16
Page 11
25. Two containers X and Y have equal fixed number of particles. Container X is maintained
at constant temperature while container Y is maintained at constant temperature and
pressure. What statistical ensemble will you use to best describe the properties of
particles in the two containers?
A) Canonical ensemble for both X and Y
B) Microcanonical ensemble for X and canonical for Y
C) Canonical ensemble for X and grand canonical ensemble for Y
D) Microcanonical ensemble for both X and Y
26. An aqueous solution contains 0.300 mole L−1 of KH2PO4 and 0.0150 mole L−1 of K2HPO4.
Which of the following statement(s) is/are true about this solution?
A) It can act as a buffer solution around pH ≈ 7.0
B) It can act as a buffer solution around pH = 12
C) Its pH will approximately equal to 6.9
D) Both A and C
27. A catalyst:
A) Participates in the reaction
B) Does not affect a reaction energy path
C) Always decreases the rate for a reaction
D) Always increases the activation energy for a reaction
28. What would be the likely ratio of products X and Y for the following reaction on
2-methyl-cyclohexanone if we consider that torsional effects play a significant role in
the reaction outcome?
A) X:Y = 80:20
B) X:Y = 50:50
C) X:Y = 20:80
D) X:Y = 1: 99
Page 11 of 16
Page 12
29. A pure substance can exist in several different phases A, B, C, …. Its partial phase
diagram is shown below.
δ
E F
P D
C γ
A β B
α
T
Which of the following statements is correct about the above diagram?
A) The diagram is correct in all respects
B) The diagram is wrong as it has more than one triple point
C) A phase diagram cannot have an island, such as D
D) The point γ cannot be present in any phase diagram
30. Free water pKa is 15.7 at 25oC. Based on the free water pKa benchmark, arrange the
acidity of the “bound” water molecules in increasing order within the following metal-
aqua complexes: [Mn(H2O)6]2+, [Cu(H2O)5]2+, [Ca(H2O)8]2+, [Sr(H2O)8]2+
A) Ca2+ < Mn2+ < Cu2+ < Sr2+
B) Mn2+ < Cu2+ < Sr2+ < Ca2+
C) Sr2+ < Ca2+ < Mn2+ < Cu2+
D) All have same acidities
31. The number of peptide bonds in a protein consisting of a linear chain of 128 amino acids
is
A) 127
B) 128
C) 129
D) None of the above
Page 12 of 16
Page 13
32. Which of the following statement(s) is/are true?
i) The state function Ψ(x,t) is always equal to a function of time multiplied by a
function of the coordinates
ii) If f1 and f2 are eigenfunctions of an operator B, then c1f1 + c2f2 must always be an
eigenfunction of B, where c1 and c2 are constants
iii) The operator L2 commutes with Lx+Ly
A) i and ii
B) i and iii
C) ii and iii
D) Only iii
33. The restriction enzyme Alu1 recognizes four DNA base pairs and cuts right in the middle
as shown below:
5’ AGCT 3’
3’ TCGA 5’
What fragments of DNA do you expect to recover from the reaction mixture if the
following DNA sequence
5’ CGACTAGCTACTGAGCTAAA 3’
3’ GCTGATCGATGACTCGATTT 5’
is partially digested with Alu1. Partially digested means that the reaction is not
allowed to proceed to completion, say only to 50%.
i) 5’ CGACTAG 3’ and 5’ CTACTGAGCTAAA 3’
3’ GCTGATC 5’ 3’ GATGACTCGATTT 5’
ii) 5’ CGACTAGCTACTGAG 3’ and 5’ CTAAA 3’
3’ GCTGATCGATGACTC 5’ 3’ GATTT 5’
iii) 5’ CGACTAG 3’ and 5’ CTACTGAG 3’ and 5’ CTAAA 3’
3’ GCTGATC 5’ 3’ GATGACTC 5’ 3’ GATTT 5’
iv) 5’ CGACTAGCTACTGAGCTAAA 3’
3’ GCTGATCGATGACTCGATTT 5’
A) Only i and ii
B) Only I and iii
C) Only iii and iv
D) i, ii, iii and iv
Page 13 of 16
Page 14
34. Which of the following statements are true?
i) For a harmonic oscillator potential, the spacing between between adjacent energy
levels remain constant with increasing the quantum number
ii) For a Morse oscillator potential, the spacing between adjacent energy levels
increases with increasing the vibrational quantum number.
iii) Harmonic oscillators are be used to explain the bond dissociation
iv) Morse oscillators can be used to explain the vibration of molecules
A) i, ii and iii only
B) i and iv only
C) i, ii and iv only
D) i, ii, iii and iv
35. Molecular knots have been observed in DNA and proteins. Although synthetically
challenging, a few purely organic molecular knots have also been reported in the
literature. One such elusive knot is the trefoil knot. An organic trefoil knot was
prepared by reacting two structurally distinct components X and Y. The reaction
mixture contained four products as shown in the figure below:
Which spectra will afford distinguishable spectral features for (1) C and D? and (2) E and F?
A) Circular Dichroism Spectra for C and D; 1H-NMR for E and F
B) 1H-NMR and 13C-NMR Spectra for C and D; Circular Dichroism for E and F
C) Absorbance and Emission spectra for C and D; Circular Dichroism for E and F
D) Infra-Red Spectra for C and D; Circular Dichroism for E and F
36. The molar absorption coefficient of sea water in the visible region is 6.2 x 10-5 M-1cm-1.
What will be depth from the sea surface at which the intensity of light becomes one-
tenth of that at the surface?
A) 2.9 m
B) 0.9 m
C) 1.1 m
D) 8.0 m
Page 14 of 16
Page 15
37. The electronic absorption spectra of two species A and B are shown below.
absorptivity
Molar
B
A
νA νB
Frequency Frequency
In a solution, these two species are dissolved, and they are moving freely. Using a
tunable laser, when the solutuion is excited at νA, a single fluorescence band is seen
around frequency F1. When the laser frequency is changed to νB, two fluorescence
bands are seen around frequencies F1 and F2. Which of the following figures can
qualitatively describe the correct relative positions of the frequencies νA, νB, F1 and F2?
The continuous line shows absorption and the dashed line shows fluorescence emission
spectra.
or emission
Absorption
intensity
A) B
A
νA F1 νB F2
Frequency
or emission
Absorption
intensity
B) A B
F1 νA F2 νB
Frequency
or emission
Absorption
intensity
or emission
Absorption
intensity
C) B
A D) B A
F1 ν A F2 ν B νA
F2 ν B F1
Frequency Frequency
Page 15 of 16
Page 16
38. For Co in oxidation state II, predict the overall charges of the coordination complexes
shown in the reactions below:
A) z = +2; x = -2; y = +2
B) z = 0; x = +2; y = -2
C) z = 0; x = +2; y = +2
D) z = -2; x = +2; y = -2
39. If Ψ(x,t) can be expressed as a product of two functions f(t)g(x), where f(t) has the form
exp[-(iEt/ħ)] then it can be shown that the probability of finding the particle between x
and (x + dx)
A) Equal to 1
B) Is independent of time
C) Can be obtained by solving Time Dependent Schrodinger Equation
D) Can be obtained by solving Time Independent Schrodinger Equation
40. Which of the following statements is TRUE regarding the electrical conductivity of HCl in
aqueous solution, HCl as a gas and HCl in benzene?
A) All three conduct electricity because HCl is a strong acid
B) HCl in aqueous solution only conducts electricity because it is ionized but not HCl
gas and HCl in benzene
C) HCl in benzene is not conducting because benzene is a non-polar solvent and but
HCl gas and HCl in aqueous solution conduct electricity
D) HCl in aqueous solution and HCl in benzene are conducting because they are
solutions but not HCl gas
The following question does NOT carry any marks and is given to collect
information only:
41. How much time did you take to complete this chemistry exam?
A) Less than 1 hour
B) Between 1 to 2 hours
C) Between 2 to 3 hours
D) Insufficient time was given
Page 16 of 16