CBSE Class 12 Sample Paper 2026 for Biology

CBSE BOARD

SAMPLE
PAPER
2026

DOWNLOAD

BIOLOGY – Code No. 044
SAMPLE QUESTION PAPER*
CLASS – XII (2025-26)
Maximum Marks: 70 Time: 3 hours

General Instructions:

(i) All questions are compulsory.
(ii) The question paper has five sections and 33 questions.
(iii)Section–A has 16 questions of 1 mark each; Section–B has 5 questions of 2
marks each; Section– C has 7 questions of 3 marks each; Section– D has 2
case-based questions of 4 marks each; and Section–E has 3 questions of 5
marks each.
(iv) There is no overall choice. Answer all 33 questions. However, internal choices
have been provided in some questions. A student has to attempt only one of the
alternatives in such questions.
(v) Wherever necessary, neat and properly labeled diagrams should be drawn.

Section – A
Q. No. 1 to 12 are multiple choice questions. Only one of the choices is correct.
Select and write the correct choice as well as the answer to these questions.

Q. Question Marks
No

1 The male gametes in plants are formed by: 1
A. Mitotic division of nucleus of vegetative cell
B. Meiotic division of nucleus of vegetative cell
C. Mitotic division of nucleus of generative cell
D. Meiotic division of nucleus of generative cell

2 The primary endosperm nucleus is formed by fusion of which of the 1
following?
A. A male gamete and a female gamete
B. A male gamete and two polar nuclei
C. A female gamete and two synergids
D. Two male gametes and an egg cell

3 During the menstrual cycle of a human female, formation of graafian 1
follicle is stimulated by secretion of which of the following gonadotropin
hormones?
A. Estrogen and progesterone
B. FSH and Estrogen
C. FSH and LH
D. Progesterone and LH

*Please note that the assessment scheme of the Academic Session 2024-25 will continue in the current session i.e.
2025-26.

4 The experimental proof on the thermal stability of genetic material was 1
first provided by experiments of
A. Hershey and Chase
B. Meselson and Stahl
C. Frederick Griffith
D. Jacob an Monod

5 Short stretches of DNA used to identify complementary sequences in a 1
sample are called
A. Probes
B. Markers
C. Primers
D. Minisatellites

6 Select the incorrect statement among the following. 1
A. p2+2pq+q2 = 1. This is binomial expansion of (p+q)2.
B. When frequency measured differs from expected values, the
difference (direction) indicates the extent of evolutionary change.
C. Hardy-Weinberg principle says that phenotype frequencies in a
population are stable and are constant from generation to
generation.
D. The gene pool (total genes and their alleles in a population)
remains constant. This is called genetic equilibrium. Sum total of
all the allelic frequencies is 1.

7 Albinism is known to be due to an autosomal recessive mutation. The first 1
child of a couple with normal skin pigmentation was an albino. What is the
probability that their second child will also be an albino?
A. 100%
B. 25%
C. 50%
D. 75%

8 "In Cricket species, the sound produced by rubbing the wings or legs 1
together play a crucial role in attracting mates, any change in the
morphology of Cricket legs could potentially affect their ability to produce
sound”.
A mutant Cricket had thicker hind legs. What would you expect for this
cricket species?
A. The leg mutation will not lead to speciation if they diversify into
new habitats.
B. The leg mutation will have little effect on other external features,
and therefore have little effect on speciation.
C. The leg mutation will have no effect on behavior, and thus have
little effect on speciation.
D. The leg mutation might lead to reproductive isolation and
speciation due to an effect on the mating call.

*Please note that the assessment scheme of the Academic Session 2024-25 will continue in the current session i.e.
2025-26.

9 Plasmodium is a pathogen that causes malaria. Identify the correct 1
sequence of transmission of the pathogen.
I II III IV
Stage of First site in the host Second site in the Stage of
pathogen as it body where the host body where pathogen as it
is transferred pathogens infect and the pathogen is transferred to
by vector bite proliferates infects and a new vector
manifests clinical
symptoms
A Sporozoites Erythrocyte infection Liver infection Gametocytes
B Gametocytes Erythrocyte infection Liver infection Sporozoites
C Gametocytes Liver infection Erythrocyte Sporozoites
infection
D Sporozoites Liver infection Erythrocyte Gametocytes
infection

10 Which mRNA will be translated to a polypeptide chain containing 8 amino 1
acids?
A. AUGUUAAUAGACGAGUAGCGACGAUGU
B. AUGAGACGGACUGCAUUCCCAACCUGA
C. AUGCCCAACCGUUAUUCAUGCUAG
D. AUGUCGACAGUCUAAAACAGCGGG

11 In order to isolate genetic material of a bacterium, the cell must be treated 1
with
A. Lysozyme, ribonuclease, protease, chilled ethanol
B. Cellulase, ribonuclease, protease, chilled ethanol
C. Chitinase, ribonuclease, chilled ethanol, water
D. Ribonuclease, protease, chilled ethanol, water

12 Integrated Pest Management involves 1
I. Using pesticides/insecticides judiciously
II. Using biocontrol agents
III. Engaging in organic farming
A. Only I
B. Only II
C. Both I and II
D. Only III

Question No. 13 to 16 consist of two statements – Assertion (A) and Reason (R). Answer
these questions selecting the appropriate option given below:
A. Both A and R are true and R is the correct explanation of A.
B. Both A and R are true and R is not the correct explanation of A.
C. A is true but R is false.
D. A is False but R is true.

13 Assertion (A): The ability of the pistil to recognise the pollen is the result 1
of a continuous dialogue between pollen and pistil.
Reason (R): This electrical dialogue allows only compatible pollen to
germinate.

*Please note that the assessment scheme of the Academic Session 2024-25 will continue in the current session i.e.
2025-26.

14 Assertion (A): Some organisms are better adapted to survive in an 1
otherwise hostile environment.
Reason (R): Adaptive ability is inherited and has a genetic basis.

15 Assertion (A): Excess dose of coke or crack produces a sense of 1
euphoria, increased energy and causes hallucinations.
Reason(R): It interferes with the transport of dopamine

16 Assertion (A): Rosie was the first transgenic cow to make more 1
nutritionally balanced milk for consumption by human babies.
Reason (R): The milk of Rosie cow contained human beta- lactalbumin
which made the milk rich in protein.

Section – B

17 Attempt either option A or B. 2
A. During artificial hybridization, it is important to ensure that only
desired pollen grains are used for pollination. How is it ensured?
OR
B. Why is manual transfer of desired pollen grains relatively easy in pea
plants for hybridization, but in wheat, pollen grains are often utilized
from pollen banks for hybridization purposes?

18 How is the rate of initiation of RNA polymerase at a given promoter in a 2
transcriptional unit of prokaryotes regulated?

19 The table below shows a hypothetical blood report of a patient. 2

Test description Observed Unit Reference range
value

Leucocytes

Total leucocyte count 1100 Per Microliter 4400-11000

Neutrophils 31 % 55-70

Lymphocytes 25 % 20-40

Basophils 0.5 % 0.5 - 1

Eosinophils 02 % 1-4

Monocytes 0 % 1-8

A. Looking at the values suggest which defense mechanism/ immunity
is affected and state how this defense mechanism provides immunity.
B. Name the barrier with least count and enumerate its role in providing
immunity.

*Please note that the assessment scheme of the Academic Session 2024-25 will continue in the current session i.e.
2025-26.

20 Attempt either option A or B. 2
A. A cheese maker claims to be a biotechnologist. How will you
support the same?
OR
B. Why does the 'insertional inactivation' method to detect
recombinant DNA is preferred to 'antibiotic resistance' procedure?

21 Attempt either option A or B. 2
A.
(i) Compare the two ecological pyramids of biomass I and II given
below and explain the situations in which this is possible.

Fig. I Fig. II

(ii) Construct an ideal pyramid of energy if 200,000 joules of
sunlight are available.
-------------------
For Visually impaired students:
A.
(i) Compare the upright and inverted ecological pyramids of
biomass and explain the situations in which this is possible.
(ii) Construct an ideal pyramid of energy if 200,000 joules of
sunlight is available.
OR
B. A tropical rainforest in South America is home to more than 40,000
species of plants, 3,000 of fishes, 1,300 of birds, 427 of mammals,
427 of amphibians, 378 of reptiles and 1,25,000 insects, snails and
worms.
From the given data, calculate the total number of known vertebrate
species in the rainforest.
(i) Give a reason to justify the huge difference in the number of
plant and animal species.

*Please note that the assessment scheme of the Academic Session 2024-25 will continue in the current session i.e.
2025-26.

Section - C

22 Suggest a suitable contraceptive device for the following cases with 3
justification.
(i) Mohini does not want to take the risk of conception and sexually
transmitted infections (STIs).
(ii) Lalita has two children and does not want any more children.
(iii) Geeta wants a contraceptive that she can take till she wants to
avoid conception and can resume back to her fertile life without the
intervention of the doctor. Also, it should have a lower failure rate.

23 Given below is a figure showing transport of ovum, fertilisation and 3
passage of growing embryo through fallopian tube in a human female.
Answer the questions that follow:
(i) What will be the ploidy of cells shown in (a) and (c) stage in the figure
given below?
(ii) What will happen if component L as shown in the figure (g) given
below does not attach properly to the endometrium?
(iii) In a pregnant mother (case X), during early pregnancy, the fertilised
egg splits into two embryos at stage C shown in the figure given
below, resulting in the formation of twins. Will the genome of cells
of these two embryos exhibit variation? Justify your answer.

-------------------
For Visually impaired students
Explain the events and journey of an ovum in the fallopian tube of a
mother from fertilisation stage to implantation.

24 In guinea pigs, black coat colour (G) dominates over white (g) and brown 3
eyes (B) dominate over blue (b). The alleles for coat colour and eye colour
are not linked. What will be the probability of the offspring having blue
eyes and a white coat if both parents are heterozygous for eye and coat
colour? Find the probability using a Punnett square

*Please note that the assessment scheme of the Academic Session 2024-25 will continue in the current session i.e.
2025-26.

25 Shown below are certain aquatic vertebrates, where natural selection has 3
favoured them to develop certain characteristics which enable them to live
in water.

A. Name and explain the phenomenon exhibited by the above animals.
B. Which one of the above is the most primitive one? What is its
significance?
-------------------
For Visually impaired students
A. What are the basic conceptual similarities and differences between
Lamarckian and Darwinian theory of evolution?
B. Give an example that supports any one of the above two theories.

26 The Biological Oxygen Demand (BOD) of a primary effluent during 3
sewage treatment is reduced. Enlist the process of how this is achieved.

27 Expand ELISA. On what principle is the ELISA test based? List two ways 3
by which an infection can be detected by this test.

28 The population pyramids of Japan for the years 1950, 2007 and on the 3
basis of the estimated value for 2050 have been shown below to answer
the questions that follow:

A. Comment upon the growth status of the population on the basis of
shape of the age pyramids.

*Please note that the assessment scheme of the Academic Session 2024-25 will continue in the current session i.e.
2025-26.

B. What insights can you gain about their population dynamics?
-------------------
For visually impaired students
The population pyramids of Japan for the years 1950, 2007 and on the
basis of the estimated value for 2050 have broad-based, inverted bell and
urn shape, respectively. Answer the following questions:
A. Comment upon the growth status of the population on the basis of
shape of the age pyramids.
B. What insights can you gain about their population dynamics?

Section – D

29 Given below is a set of information about some fruits and seeds. 4
Fruit Fruit and seed formation
P Nucellar cells surrounding the embryo sac develop
into embryos.
Q Ovary develops into the fruit by the application of
growth hormones.
R Thalamus contributes to fruit formation.
S Ovary matures into a fruit after fertilisation.

On the basis of the information provided above, answer the following
questions with justification for each answer.
A. How many embryo sacs will be present in each ovule of S before
maturation and how many egg(s) will be present in each embryo sac
when the embryo sac is developed from a single megaspore? (1)
B.

(i) Which of these fruits exhibits polyembryony? Will their embryos
exhibit genetic variation? Justify.
(ii) What will be ploidy of the embryonic cells in the above case?
(2)
Attempt either subpart C or D.
C. Which of these fruits can be considered as parthenocarpic? Give a
reason. (1)
OR
D. Which of the fruits P, Q, R or S is a true fruit with seeds? Give
reason. (1)

30 The graph below shows the Antibody concentration in young calves. 4
Study the graph and answer the questions that follow:

*Please note that the assessment scheme of the Academic Session 2024-25 will continue in the current session i.e.
2025-26.

A. What do you think is the difference between passive and active
immunity in this case? (1)
B. What kind of immunity will be observed when a vaccine is
administered to the calf and why? (2)
Attempt either subpart C or D.
C. What kind of trend does passive immunity show and why? (1)
OR
D. Why does active immunity start after 14 days as per the above
graph?
-------------------
For visually impaired students
The antibody concentration in a young calf was studied. It was found that
the antibodies derived from colostrum (passive immunity) decreased from
day 1 to 14, while the antibodies derived from immune cells (active
immunity) increased between day 1 to day 14 and remained steady
thereafter.
A. What do you think is the difference between passive and active
immunity in this case? (1)
B. What kind of immunity will be observed when a vaccine is
administered to the calf and why? (2)
Attempt either subpart C or D.
C. What kind of trend does passive immunity show and why? (1)
OR
D. Why does active immunity start after 14 days as per the above
graph?

Section – E

31 A. Construct a complete transcription unit with promoter and terminator 5
on the basis of the hypothetical template strand given below.

B. How is transcription a more complex process in eukaryotic cells?

*Please note that the assessment scheme of the Academic Session 2024-25 will continue in the current session i.e.
2025-26.

Explain the additional processes that a precursor mRNA has to
undergo in these organisms.
-------------------
For visually impaired students
A. Why are both the strands not copied during transcription?
B. How is transcription a more complex process in eukaryotic cells?
Explain the additional processes that a precursor mRNA has to
undergo in these organisms.
OR
A. Explain the process of aminoacylation of tRNA. Mention its role in
translation.
B. How do ribosomes in the cells act as factories for protein synthesis?
C. Given below is a strand of mRNA undergoing the process of
translation, what will be the sequence of Amino acids that will be
translated? Name the triplet codons that should be added to bring to
the end of translation at X.

-------------------
For visually impaired students
C. Explain the phenomenon that forms the genetic basis to prove that
codon is a triplet and it is read in a contiguous manner.

32 Some plant and animal pathogens serve as one of the tools of 5
recombinant DNA (rDNA) technology.’
A. Name one animal and one plant pathogen and discuss the
pathogenic nature of both. State how they serve as a tool in rDNA
technology.
B. What are the enzymes needed for rDNA technology?
C. A farmer owns a cotton farm land which is getting infested with
coleopteran pests. He is not willing to use the microbes to protect his
farm.
i. Name an alternate method to introduce the gene of interest the
pathogen would have otherwise delivered and discuss how the
alternate method would deliver the gene.
ii. State how this gene would control the pest.

*Please note that the assessment scheme of the Academic Session 2024-25 will continue in the current session i.e.
2025-26.

OR
BamH1 is a restriction enzyme which recognizes the sequence-
5' - GGATCC - 3'. The restriction activity of this enzyme is between G and
G.
A. Construct the palindrome for the above sequence.
B. Draw a labeled diagram to show the formation of recombinant DNA
(rDNA) using BamH1.
C. PBR322 is a plasmid that has a restriction site for this enzyme at the
tetracycline resistant gene. If BamH1 were to be used, how will it
impact the response of the transformant with rDNA to antibiotics-
ampicillin and tetracycline. Justify.

33 Justify the following statements with suitable proof/examples: - 5
A. ‘competition is not limited to closely related species’
B. ‘competition is not always dependent on resources being limiting’
C. ‘competitive exclusion occurs in nature’
D. ‘competing species may evolve mechanisms for co-existence’
E. ‘competition in nature comes from what is called ‘competitive release’’
OR
A. How does a simple food chain exemplify the First Law of
Thermodynamics?
B. The table below shows the number of species in different parts of the
world.
Name of Place Number of Bird species
Columbia 1400
India 1200
Northern South America 1300
New York 105
Denmark 504

Identify the common factor in regions with a higher number of bird species
and suggest at least two reasons for this greater diversity.

**********

*Please note that the assessment scheme of the Academic Session 2024-25 will continue in the current session i.e.
2025-26.

जीव ववज्ञान – कोड न. 044
प्रविदर्श प्रश्न पत्र*
कक्षा XII (2025-26)

अविकिम अंक: 70 समय: 3 घंटे

सामान्य कनदे श:
(i) सभी प्रश्न अकनवायत हैं ।
(ii) प्रश्न - पत्र में पााँ च खण्ड और 33 प्रश्न हैं ।
(iii) खांड - क में 16 प्रश्न हैं , कजनमें से प्रत्येक 1 अांक का है ; खांड - ख में 5 प्रश्न हैं , कजनमें से प्रत्येक प्रश्न 2
अांक का है ; खांड - ग में 7 प्रश्न हैं , कजनमें से प्रत्येक प्रश्न 3 अांक का है ; खांड - घ में 2 केस -आधाररर् प्रश्न
हैं , कजनमें से प्रत्येक प्रश्न 4 अांक का है ; और खांड - ड में 3 प्रश्न हैं , कजनमें से प्रत्येक प्रश्न 5 अांक का है ।
(iv) कोई समग्र कवकल्प नहीां है , सभी 33 प्रश्नोां के उत्तर दें । हालााँ कक, कुछ प्रश्नोां में आां र्ररक कवकल्प कदए
गए हैं । ऐसे प्रश्नोां में छात्र को केवल एक कवकल्प का प्रयास करना होगा।
(v) जहााँ भी आवश्यक हो, साफ-सुर्रे और उकचर् रूप से नामाां ककर् ककए गए कचत्र बनाए जाने चाकहए।

खंड – क
प्रश्न संख्या 1 से 12 िक बहुववकल्पीय प्रश्न हैं। इनमें से केवल एक ही ववकल्प सही है। सही ववकल्प का
चयन करें िथा इन प्रश्नों के उत्तर भी वलखें।

1. पौधोां में नर युग्मक बनर्े हैं :
क. वनस्पकर् कोकशका के नाकभक का समसूत्री कवभाजन द्वारा
ख. वनस्पकर् कोकशका के केंद्रक का अधतसूत्री कवभाजन द्वारा 1
ग. जनन कोकशका के नाकभक का समसूत्री कवभाजन द्वारा
घ. जनन कोकशका के केन्द्रक का अधतसूत्री कवभाजन द्वारा

2. प्रार्कमक भ्रूिपोष केंद्रक कनम्नकलखखर् में से ककसके सां लयन से बनर्ा है ?

क. एक नर युग्मक और एक मादा युग्मक
ख. एक नर युग्मक और दो ध्रुवीय केन्द्रक 1
ग. एक मादा युग्मक और दो अपभ्रष्टीय सहाय कोकशका
घ. दो नर युग्मक और एक अांड कोकशका

3. मानव मादा के माकसक धमत चक्र के दौरान, ग्राक़ियन पुटक कनमात ि कनम्नकलखखर् में से ककस
गोनैडोटर ोकपन हामोन के स्राव द्वारा उत्तेकजर् होर्ा है ?

क. एस्ट्र ोजन और प्रोजेस्ट्ेरोन 1
ख. एफएसएच और एस्ट्र ोजन
ग. एफएसएच और एलएच
घ. प्रोजेस्ट्ेरोन और एलएच

*कृपया ध्यान दें कक शैक्षकिक सत्र 2024-25 की मू ल्ाांकन योजना वर्तमान सत्र अर्ातर् 2025-26 में भी जारी रहे गी।

4. आनुवांकशक पदार्त की र्ापीय खथर्रर्ा पर प्रायोकगक प्रमाि पहली बार कनम्न में से ककसके प्रयोगोां
द्वारा प्रदान ककया गया र्ा?
क. हषे और चेस
ख. मेसेलसन और स्ट्ाहल 1
ग. फ्रेडररक कग्रकफर्
घ. जैकब और मोनोड

5. एक नमूने में पूरक अनुक्रमोां की पहचान करने के कलए उपयोग ककए जाने वाले डीएनए के छोटे
खांडोां को क्या कहा जार्ा है ?
क. प्रोब्स
ख. माकतसत 1
ग. उपक्रामक
घ. लघु अनुषांगी

6. कनम्नकलखखर् में से गलर् कर्न का चयन करें
क. p² + 2pq + q² = 1 यह (p + q)2 का कद्वपद कवस्तार है ।
ख. जब मापी गई आवृकत्त अपेकक्षर् मानोां से कभन्न होर्ी है , र्ो अांर्र (कदशा) कवकासवादी की
सीमा को इां कगर् करर्ा है ।
1
ग. हाडी-वेनबगत कसद्ाां र् कहर्ा है कक जनसांख्या में फेनोटाइप आवृकत्तयााँ खथर्र होर्ी हैं और
पीढी दर पीढी खथर्र रहर्ी हैं ।
घ. जीन पूल (एक आबादी में कुल जीन और उनके एलील) खथर्र रहर्ा है । इसे आनुवांकशक
सांर्ुलन कहा जार्ा है । सभी एलीकलक आवृकत्तयोां का योग 1 होर्ा है ।

7. ऐखिकनज़म को अकलांग क्रोमोसोम कवकार के कारि माना जार्ा है । सामान्य त्वचा रां जकर्ा वाले
एक जोडे का पहला बच्चा एखिनो र्ा। क्या सांभावना है कक उनका दू सरा बच्चा भी एखिनो होगा?
क. 100%
1
ख. 25%
ग. 50%
घ. 75%

8. "कक्रकेट प्रजाकर् में, पांखोां या पैरोां को आपस में रगडने से उत्पन्न ध्वकन सार्ी को आककषतर् करने में
महत्वपूित भूकमका कनभार्ी है । कक्रकेट के पैरोां की आकृकर् में कोई भी पररवर्तन सांभाकवर् रूप से
ध्वकन उत्पन्न करने की उनकी क्षमर्ा को प्रभाकवर् कर सकर्ा है ।"
एक उत्पररवर्तर् कक्रकेट के कपछले पैर मोटे र्े। इस कक्रकेट प्रजाकर् से आप क्या उम्मीद करें गे?
क. पैर का उत्पररवर्तन नव प्रजाकर् का कनमात ि नहीां करे गा यकद वे नए आवासोां पर जार्े हैं
ख. पैर के उत्पररवर्तन का अन्य बाह्य कवशेषर्ाओां पर बहुर् कम प्रभाव पडे गा, और इसकलए 1
नव प्रजाकर्-कनमात ि पर भी इसका बहुर् कम प्रभाव पडे गा।
ग. पैर के उत्पररवर्तन का व्यवहार पर कोई प्रभाव नहीां पडे गा, और इस प्रकार नव प्रजाकर्-
कनमात ि पर भी इसका कम ही प्रभाव पडे गा।
घ. पैर के उत्पररवर्तन से प्रजनन अलगाव और प्रजनन की प्रकक्रया प्रभाकवर् हो सकर्ी है , जो
प्रजनन की पुकार पर प्रभाव डालर्ी है ।

*कृपया ध्यान दें कक शैक्षकिक सत्र 2024-25 की मू ल्ाांकन योजना वर्तमान सत्र अर्ातर् 2025-26 में भी जारी रहे गी।

9. प्लास्मोकडयम एक रोगजनक है जो मलेररया का कारि बनर्ा है । रोगजनक के सांचरि के सही
क्रम की पहचान करें ।

I II III IV
रोगज़नक़ का चरि मे जबान शरीर में मे जबान शरीर में दू सरा रोगज़नक़ का
जब यह वेक्टर के पहला थर्ान जहाां थर्ान जहाां रोगािु चरि जब इसे
काटने से रोगािु सांक्रकमर् होर्े सांक्रकमर् होर्ा है और नए वाहक में
थर्ानाां र्ररर् होर्ा है हैं और बढर्े हैं नै दाकनक लक्षि प्रकट थर्ानाां र्ररर्
करर्ा है ककया जार्ा है

क. जीवािुज लाल रक्त कोकशका यकृर् में सांक्रमि युग्मकजनक 1
सांक्रमि

ख. युग्मकजनक लाल रक्त कोकशका यकृर् में सांक्रमि जीवािुज
सांक्रमि

ग. युग्मकजनक यकृर् में सांक्रमि लाल रक्त कोकशका जीवािुज
सांक्रमि

घ. जीवािुज यकृर् में सांक्रमि लाल रक्त कोकशका युग्मकजनक
सांक्रमि

10. कौन सा mRNAअमीनो एकसड युक्त 8 पॉलीपेप्टाइड श्ृांखला में अनुवाकदर् ककया जाएगा?
क. AUGUUAAUAGACGAGUAGCGACGAUGU
ख. AUGAGACGGACUGCAUUCCCAACCUGA 1
ग. AUGCCCAACCGUUAUUCAUGCUAG
घ. AUGUCGACAGUCUAAAACAGCGGG

11. जीवािु के आनुवांकशक पदार्त को अलग करने के कलए, कोकशका को उपचाररर् ककया जाना
चाकहए
क. लाइसोजाइम, राइबोन्यूखिऐस, प्रोटीएज, ठां डा इर्ेनॉल
ख. सेल्ुलेस, राइबोन्यूखिऐस, प्रोटीएज़, ठां डा इर्ेनॉल 1
ग. कचकटनेज़, राइबोन्यूखिऐस, ठां डा इर्ेनॉल, पानी
घ. राइबोन्यूखिऐस, प्रोटीएज़, ठां डा इर्ेनॉल, पानी

12. समाककलर् कीट प्रबांधन में शाकमल है
I. कीटनाशकोां का कववेकपूित उपयोग करना
II. जैव कनयांत्रि एजेंटोां का उपयोग करना
III. जैकवक खेर्ी में सांलग्न होना
1
क. केवल I
ख. केवल II
ग. I और II दोनोां
घ. केवल III

*कृपया ध्यान दें कक शैक्षकिक सत्र 2024-25 की मू ल्ाांकन योजना वर्तमान सत्र अर्ातर् 2025-26 में भी जारी रहे गी।

प्रश्न सांख्या 13 से 16 में दो कर्न हैं - अवभकथन (A) और कारण (R) नीचे कदए गए उपयुक्त कवकल्प का चयन
करके इन प्रश्नोां के उत्तर दीकजए।
1. (A) अकभकर्न और (R) कारि दोनोां सत्य हैं और (R), (A) का सही स्पष्टीकरि है ।
2. (A) अकभकर्नऔर (R) कारिदोनोां सत्य हैं और (R), (A) का सही स्पष्टीकरि नहीां है ।
3. (A) अकभकर्नसत्य है लेककन (R) कारिअसत्य है ।
4. (A) अकभकर्नअसत्य है लेककन (R) कारिसत्य है ।

13. अवभकथन (A): स्त्रीकेसर की पराग को पहचानने की क्षमर्ा पराग और स्त्रीकेसर के बीच कनरां र्र
सांवाद का पररिाम है । 1
कारण (R): यह कवद् युर्ीय सांवाद केवल सुयोग्य पराग को अांकुररर् होने की अनुमकर् दे र्ा है ।

14. अवभकथन (A): कुछ जीव प्रकर्कूल वार्ावरि में जीकवर् रहने के कलए बेहर्र रूप से अनुकूकलर्
होर्े हैं । 1
कारण (R): अनुकूली क्षमर्ा कवरासर् में कमलर्ी है और इसका आनुवांकशक आधार होर्ा है ।
15. अवभकथन (A): कोक या क्रैक की अकधक खुराक से सुखाभास की भावना, ऊजात में वृखद् और
मकर्भ्रम की खथर्कर् उत्पन्न होर्ी है । 1
कारण (R): यह डोपामाइन के पररवहन में बाधा डालर्ा है ।
16. अवभकथन (A): रोज़ी पहली पारजीवी गाय र्ी कजसने मानव कशशुओां के उपभोग के कलए अकधक
पोषियुक्त सांर्ुकलर् दू ध बनाया।
1
कारण (R): रोज़ी गाय के दू ध में मानव बीटा-लैक्टलब्यूकमन होर्ा है जो दू ध को प्रोटीन से समृद्
बनार्ा है ।

खण्ड - ख
2
17. कवकल्प क या ख में से एक कवकल्प करें ।
क. कृकत्रम सांकरि के दौरान यह सुकनकिर् करना महत्वपूित है कक परागि के कलए केवल वाां कछर्
पराग किोां का ही उपयोग ककया गया है । यह कैसे सुकनकिर् ककया जार्ा है ?
अथवा
ख. मटर के पौधोां में सांकरि के कलए वाां कछर् पराग किोां का हस्ट्चकलर् थर्ानाां र्रि अपेक्षाकृर्
आसान क्योां है , लेककन गेहां में, सां करि प्रयोजनोां के कलए पराग किोां का उपयोग अक्सर
पराग बैंकोां से ककया जार्ा है ?
2
18. प्रोकैररयोट् स की एक टर ाां खिप्शनल इकाई में ककसी कदए गए उन्नायक पर आरएनए पॉलीमरे ज़ की
आरां भ दर को कैसे कनयांकत्रर् ककया जार्ा है ?
2
19. नीचे दी गई र्ाकलका एक मरीज की काल्पकनक रक्त ररपोटत दशात र्ी है ।

वववरण परीक्षण दे खा गया मू ल्य इकाई संदभश सीमा

ल्ूकोसाइट

कुल ल्ूकोसाइट कगनर्ी 1100 प्रकर् माइक्रोलीटर 4400-11000

*कृपया ध्यान दें कक शैक्षकिक सत्र 2024-25 की मू ल्ाांकन योजना वर्तमान सत्र अर्ातर् 2025-26 में भी जारी रहे गी।

न्यूटरोकफल 31 % 55-70

कलम्फोसाइटोां 25 % 20-40

बसोकफल 0.5 % 05-1

इयोस्नोकफल्स 02 % 1-4

मोनोसाइट् स 0 % 1-8

क. मानोां को दे खर्े हुए सुझाव दें कौन सा रक्षा र्ां त्र / प्रकर्रक्षा प्रभाकवर् है और बर्ाएां कक यह
रक्षा र्ांत्र ककस प्रकार प्रकर्रक्षा प्रदान करर्ा है ?
ख. न्यूनर्म गिना वाले रोध का नाम बर्ाइए र्र्ा प्रकर्रक्षा प्रदान करने में इसकी भूकमका
बर्ाइए।
2
20. कवकल्प क या ख में से एक कवकल्प करें ।
क. एक पनीर कनमात र्ा जैवप्रौद्योकगककवद् होने का दावा करर्ा है । आप उसका समर्तन कैसे
करें गे?
अथवा
ख. पुनः सांयोजक डीएनए का पर्ा लगाने के कलए ‘कनवे शी कनखियि कवकध' को 'प्रकर्जैकवक
प्रकर्रोध' प्रकक्रया की र्ुलना में क्योां पसांद ककया जार्ा है ?
2
21. कवकल्प क या ख में से एक कवकल्प करें ।
क.
(i) नीचे कदए गए बायोमास I और II के दो पाररखथर्कर्क कपराकमडोां की र्ुलना करें और उन
खथर्कर्योां की व्याख्या करें कजनमें यह सांभव है ।

पौकष्टकर्ा सांबांधी सत्र सुखा वजन

वचत्र - I

वचत्र - II

*कृपया ध्यान दें कक शैक्षकिक सत्र 2024-25 की मू ल्ाांकन योजना वर्तमान सत्र अर्ातर् 2025-26 में भी जारी रहे गी।

(ii) यकद 200,000 जूल सूयत का प्रकाश उपलब्ध हो र्ो ऊजात का एक आदशत कपराकमड
बनाइए।
-------------------
दृकष्टबाकधर् कवद्याकर्तयोां के कलए:
क.
(i) बायोमास के सीधे और उल्टे पाररखथर्कर्क कपराकमड की र्ुलना करें और उन खथर्कर्योां की
व्याख्या करें कजनमें यह सांभव है ?
(ii) यकद 200,000 जूल सूयत का प्रकाश उपलब्ध हो र्ो ऊजात का एक आदशत कपराकमड बनाएां ।

अथवा
ख. दकक्षि अमेररका में उष्णककटबांधीय वषात वन 40,000 से अकधक पौधोां की प्रजाकर्योां, 3,000
मछकलयोां, 1,300 पकक्षयोां, 427 स्तनधाररयोां, 427 उभयचरोां, 378 सरीसृपोां और 1,25,000
कीटोां, घोांघोां और कृकमयोां का घर है ।
(i) कदए गए आाँ कडोां से वषात वन में ज्ञार् कशेरुकी प्रजाकर्योां की कुल सां ख्या की गिना
करें ।
(ii) पौधोां और जानवरोां की प्रजाकर्योां की सांख्या में भारी अां र्र को उकचर् ठहराने के कलए
एक कारि बर्ाइए।

खंड - ग
3
22. कनम्नकलखखर् मामलोां के कलए उनके औकचत्यसकहर् एक उपयुक्त गभतकनरोधक उपकरि का सुझाव
दें ।
(i) मोकहनी गभतधारि और यौन सांचाररर् सांक्रमि (एसटीआई) का जोखखम नहीां लेना चाहर्ी
है ।
(ii) लकलर्ा के दो बच्चे हैं और वह और बच्चा नहीां चाहर्ी है ।
(iii) गीर्ा एक ऐसा गभतकनरोधक चाहर्ी है कजसे वह जब र्क चाहे ले सके व गभतधारि से
बचें और डॉक्टर के हस्तक्षेप के कबना अपने जननक्षम जीवन को कफर से शुरू कर
सकें। इसकी कवफलर्ा दर कम होनी चाकहए।
3
23. नीचे एक मानव मकहला में कडां ब का पररवहन, कनषेचन और फैलोकपयन ट्यूब के माध्यम से बढर्े
भ्रूि के मागत को दशात ने वाला कचत्र कदया गया है । कनम्नकलखखर् प्रश्नोां के उत्तर दीकजए:
(i) नीचे दी गई आकृकर् में (a) और (c) अवथर्ा में दशात ई गई कोकशकाओां की प्लोइडी क्या
होगी?
(ii) यकद नीचे कदए गए कचत्र (g) में कदखाए अनुसार घटक L एां डोमेकटर यम से ठीक से नहीां जुडर्ा
है र्ो क्या होगा?
(iii) एक गभतवर्ी मााँ (केस X) में, प्रारां कभक गभात वथर्ा के दौरान, कनषेकचर् अांडा नीचे कदए गए
कचत्र में कदखाए गए चरि C पर दो भ्रूिोां में कवभाकजर् हो जार्ा है , कजसके पररिामस्वरूप
जुडवााँ बच्चे बनर्े हैं । क्या इन दोनोां भ्रूिोां की कोकशकाओां के जीनोम में कभन्नर्ा कदखाई
दे गी? अपने उत्तर का औकचत्य बर्ाइए।

*कृपया ध्यान दें कक शैक्षकिक सत्र 2024-25 की मू ल्ाांकन योजना वर्तमान सत्र अर्ातर् 2025-26 में भी जारी रहे गी।

दृकष्टबाकधर् कवद्याकर्तयोां के कलए
एक मार्ा की फैलोकपयन ट्यूब में कनषेचन चरि से लेकर आरोपि र्क कडां ब की घटनाओां और
यात्रा की व्याख्या करें ।
3
24. कगनी कपग में, काले कोट का रां ग (G) स़िेद (g) पर प्रभावी होर्ा है और भूरी आाँ खें (B) नीले (b)
पर प्रभावी हैं । कोट के रां ग और आाँ खोां के रां ग के कलए एलील आपस में जुडे नहीां हैं । यकद दोनोां
मार्ा-कपर्ा आाँ खोां और कोट के रां ग के कलए कवषमयुग्मी हैं , र्ो सांर्ान की नीली आाँ खें और स़िेद
कोट होने की सांभावना क्या होगी? पुनेट वगत का उपयोग करके सांभावना ज्ञार् करें ?
3
25. नीचे कुछ जलीय कशेरुकी कदखाए गए हैं , जहाां प्राकृकर्क चयन ने उन्हें कुछ कवशेषर्ाओां को
कवककसर् करने में मदद की है जो उन्हें पानी में रहने में सक्षम बनार्ी हैं ।

क. उपरोक्त जानवरोां द्वारा प्रदकशत र् घटना का नाम बर्ाएां और उसकी व्याख्या करें |
ख. उपरोक्त में से कौन सा सबसे प्राचीन है ? इसका महत्व क्या है ?

दृकष्टबाकधर् कवद्याकर्तयोां के कलए
क. लैमाककतयन और डाकवतकनयन कवकास कसद्ाां र् के बीच बुकनयादी वैचाररक समानर्ाएां और
अांर्र क्या हैं ?
ख. उपरोक्त दो कसद्ाां र्ोां में से ककसी एक का समर्तन करने वाला एक उदाहरि दीकजए।

*कृपया ध्यान दें कक शैक्षकिक सत्र 2024-25 की मू ल्ाांकन योजना वर्तमान सत्र अर्ातर् 2025-26 में भी जारी रहे गी।

3
26. सीवेज उपचार के दौरान प्रार्कमक अपकशष्ट जल की जैकवक ऑक्सीजन माां ग (BOD) कम हो
जार्ी है । इस प्रकक्रया को सूचीबद् करें ।
3
27. ELISA (एकलसा) का कवस्तार करें । एकलसा परीक्षि ककस कसद्ाां र् पर आधाररर् है ? इस परीक्षि
द्वारा सांक्रमि का पर्ा लगाने के दो र्रीके बर्ाइए ।
3
28. वषत 1950, 2007 और 2050 के अनुमाकनर् मूल् के आधार पर जापान की अनुमाकनर् जनसांख्या
कपराकमड नीचे कदए गए प्रश्नोां के उत्तर दे ने के कलए दशात ए गए हैं :

क. आयु कपराकमड के आकार के आधार पर जनसांख्या की वृखद् खथर्कर् पर कटप्पिी करें
ख. उनकी जनसांख्या गकर्शीलर्ा के बारे में आप क्या जानकारी प्राप्त कर सकर्े हैं ?
-------------------
दृकष्टबाकधर् छात्रोां के कलए
वषत 1950, 1950, 2007 और 2050 के अनुमाकनर् मान के आधार पर जापान के अनुमाकनर्
जनसांख्या कपराकमड क्रमशः चौडे आधार वाले, उल्टे घांटी और कलश के आकार के हैं । कनम्नकलखखर्
प्रश्नोां के उत्तर दीकजए,
क. आयु कपराकमड के आकार के आधार पर जनसांख्या की वृखद् खथर्कर् पर कटप्पिी करें
ख. उनकी जनसांख्या गकर्शीलर्ा के बारे में आप क्या जानकारी प्राप्त कर सकर्े हैं ?

खण्ड- घ

29. नीचे कुछ फलोां और बीजोां के बारे में जानकारी दी गई है 4

फल फल एवं बीज वनमाशण

P भ्रूिकोष के चारोां ओर खथर्र् बीजाण्डकोकशकाएां भ्रूि में कवककसर् होर्ी हैं ।

Q अांडाशय फल में कवककसर् होर्ा है वृखद् हॉमोन के प्रयोग द्वारा ।

R र्ैलेमस फल कनमात ि में योगदान दे र्ा है ।

S कनषेचन के बाद अांडाशय पररपक्व होकर फल बन जार्ा है ।

*कृपया ध्यान दें कक शैक्षकिक सत्र 2024-25 की मू ल्ाांकन योजना वर्तमान सत्र अर्ातर् 2025-26 में भी जारी रहे गी।

ऊपर दी गई जानकारी के आधार पर, प्रत्येक उत्तर के औकचत्य के सार् कनम्नकलखखर् प्रश्नोां के उत्तर
दीकजए
क. पररपक्वर्ा से पहले S के प्रत्येक बीजाां ड में ककर्ने भ्रूि र्ैली मौजूद होांगे और जब भ्रूि र्ैली
एक एकल मेगास्पोर से कवककसर् होगी र्ो प्रत्येक भ्रूि र्ैली में ककर्ने अांडे मौजूद होांगे? (1)
ख.
(i) इनमें से कौन सा फल बहुभ्रूिर्ा प्रदकशतर् करर्ा है ? क्या इनके भ्रूिोां में आनुवाां कशक
कभन्नर्ा होगी? औकचत्य समझाइये ।
(ii) उपयुतक्त मामले में भ्रूि कोकशकाओां की प्लोइडी क्या होगी? (2)

उपभाग ग या घ में से एक कवकल्प करें ।
ग. इनमें से कौन सा फल अकनषेक फलन माना जा सकर्ा है ? एक कारि दीकजए।
अथवा
घ. P, Q, R या S में से कौन सा फल बीज वाला वास्तकवक फल है ? कारि बर्ाइए।
4
30. नीचे कदया गया ग्राफ युवा बछडोां में एां टीबॉडी साां द्रर्ा को दशात र्ा है । ग्राफ का अध्ययन करें और
नीचे कदए गए प्रश्नोां के उत्तर दें :

क. आपके अनुसार कदए गए मामले में कनखिय और सकक्रय प्रकर्रक्षा में क्या अांर्र है ?
ख. कदन प्रकर्कदन समय बीर्र्े पर कनखिय प्रकर्रक्षा क्या होर्ी है और क्योां?
उपभाग ग या घ में से एक कवकल्प करें ।
ग. कनखिय प्रकर्रक्षा ककस प्रकार की प्रवृकत्त दशात र्ी है और क्योां?
अथवा
घ. जब बछडे को टीका लगाया जाएगा र्ो ककस प्रकार की प्रकर्रक्षा दे खी जाएगी और क्योां?
दृकष्टबाकधर् कवद्याकर्तयोां के कलए
एक युवा बछडे में एां टीबॉडी साां द्रर्ा का अध्ययन ककया गया। यह पाया गया कक कोलोस्ट्र म
(कनखियप्रकर्रक्षा) से प्राप्त एां टीबॉडी 1 से 14 कदन के बीच कम हो गई, जबकक प्रकर्रक्षा

*कृपया ध्यान दें कक शैक्षकिक सत्र 2024-25 की मू ल्ाांकन योजना वर्तमान सत्र अर्ातर् 2025-26 में भी जारी रहे गी।

कोकशकाओां (सकक्रयप्रकर्रक्षा) से प्राप्त एां टीबॉडी 1 से 14 कदन के बीच बढ गई और उसके बाद
खथर्र रही।
क. आपके अनुसार इस मामले में कनखिय और सकक्रय प्रकर्रक्षा में क्या अांर्र है ?
ख. जैसे-जैसे कदन बीर्र्े हैं कनखिय प्रकर्रक्षा में क्या होर्ा है और क्योां?
उपभाग ग या घ में से एक कवकल्प करें ।
ग. सकक्रय प्रकर्रक्षा ककस प्रकार की प्रवृकत्त दशात र्ी है और क्योां?
अथवा
घ. जब बछडे को टीका लगाया जाएगा र्ो ककस प्रकार की प्रकर्रक्षा दे खी जाएगी और क्योां?

खण्ड - ड
5
31. क. नीचे कदए गए काल्पकनक टे म्पलेट स्ट्र ैं ड के आधार पर उन्नायक और समापक के सार् एक
पूित टर ाां सकक्रप्शन यूकनट का कनमात ि करें ।

ख. यूकेररयोकटक कोकशकाओां में प्रकर्लेखन एक अकधक जकटल प्रकक्रया कैसे है ? इन जीवोां में
पूवतवर्ी mRNA को कजन अकर्ररक्त प्रकक्रयाओां से गुजरना पडर्ा है , उन्हें समझाइए।
दृकष्टबाकधर् कवद्याकर्तयोां के कलए
क. प्रकर्लेखन के दौरान दोनोां रज्जुकोां की प्रकर्कलकप क्योां नहीां बनाई जार्ी?
ख. यूकेररयोकटक कोकशकाओां में प्रकर्लेखन एक अकधक जकटल प्रकक्रया कैसे है ? इन जीवोां में
पूवतवर्ी mRNA को कजन अकर्ररक्त प्रकक्रयाओां से गुजरना पडर्ा है , उन्हें समझाइए।
अथवा
क. tRNA के अमीनोएसाइलेशन की प्रकक्रया को समझाइए। रूपाां र्रि में इसकी भूकमका का
उल्लेख कीकजए।
ख. कोकशकाओां में राइबोसोम प्रोटीन सांश्लेषि के कलए कारखानोां के रूप में कैसे कायत करर्े हैं ?
ग. नीचे mRNA का एक स्ट्र ैं ड कदया गया है जो रूपाां र्रि की प्रकक्रया से गुजर रहा है , अनुवाद
ककए जाने वाले अमीनो एकसड का अनुक्रम क्या होगा? X पर अनुवाद के अांर् र्क लाने के
कलए जोडे जाने वाले कटर पलेट प्रकूट का नाम बर्ाइए।

*कृपया ध्यान दें कक शैक्षकिक सत्र 2024-25 की मू ल्ाांकन योजना वर्तमान सत्र अर्ातर् 2025-26 में भी जारी रहे गी।

दृकष्टबाकधर् कवद्याकर्तयोां के कलए
ग. उस पररघटना की व्याख्या करें जो यह साकबर् करने के कलए आनुवांकशक आधार बनार्ी है
कक प्रकूट एक कत्रक है और इसे सकन्नकहर् र्रीके से पढा जार्ा है ।
5
32. कुछ पौधे और पशु रोगािु पुनः सांयोजक डीएनए (आरडीएनए) प्रौद्योकगकी के उपकरिोां में से
एक उपकरि के रूप में काम करर्े हैं ।

क. एक जन्तु और एक पादप रोगज़नक़ का नाम बर्ाइए और दोनोां की रोगजनक प्रकृकर् पर
चचात कीकजए। बर्ाइए कक वे rDNA र्कनीक में एक उपकरि के रूप में कैसे काम करर्े
हैं ?

ख. आरडीएनए र्कनीक के कलए आवश्यक एां जाइम कौन से हैं ?

ग. एक ककसान के पास कपास की खेर्ी की ज़मीन है जो कोकलयोप्टेरान कीटोां से ग्रकसर् हो रही
है । वह अपने खेर् की सुरक्षा के कलए सूक्ष्मजीवोां का उपयोग करने को र्ैयार नहीां है ।

(i) रुकचकर जीन को प्रस्तुर् करने के कलए एक वैकखल्पक कवकध का नाम बर्ाइए कजसे
रोगजनक अन्यर्ा पररकचर् कर सकर्ा र्ा और चचात करे की वैकखल्पक कवकध ककस
प्रकार जीन को पररकचर् करे गा?
(ii) बर्ाइए कक यह जीन ककस प्रकार कीट को कनयांकत्रर् करे गा?
अथवा
BamH1 एक प्रकर्बांधन एां जाइम है जो अनुक्रम को पहचानर्ा है -
5'-GGATCC - 3'. इस एां जाइम की प्रकर्बांधन गकर्कवकध G और G के बीच है :
क. उपरोक्त अनुक्रम के कलए पैकलांडरोम का कनमात ि करें ।
ख. BamH1 का उपयोग करके पुनः सांयोजक डीएनए (rDNA) के कनमात ि को दशात ने के कलए
एक नामाां ककर् आरे ख बनाएां ।
ग. पीबीआर322 एक प्लाखस्मड है कजसमें टे टरासाइखिन प्रकर्रोधी जीन पर इस एां जाइम के कलए
प्रकर्बांध थर्ल है । यकद BamH1 का उपयोग ककया जार्ा है , र्ो यह एां टीबायोकटक दवाओां-
एम्पीकसलीन और टे टरासाइखिन के कलए आरडीएनए के टर ाां सफॉमेंट की प्रकर्कक्रया को कैसे
प्रभाकवर् करे गा। औकचत्य कसद् करें ।
5
33. उपयुक्त प्रमाि/उदाहरि सकहर् कनम्नकलखखर् कर्नोां की पुकष्ट कीकजए। -
क. 'प्रकर्स्पधात कनकट से सांबांकधर् प्रजाकर्योां र्क सीकमर् नहीां है '
ख. 'प्रकर्स्पधात हमेशा सांसाधनोां की सीकमर्र्ा पर कनभतर नहीां होर्ी'
ग. 'प्रकर्स्पधी बकहष्कार प्रकृकर् में घकटर् होर्ा है '
घ. 'प्रकर्स्पधी प्रजाकर्यााँ सह-अखस्तत्व के कलए र्ांत्र कवककसर् कर सकर्ी हैं '
ङ. 'प्रकृकर् में प्रकर्स्पधात उस चीज़ से आर्ी है कजसे 'प्रकर्स्पधी ररलीज़' कहा जार्ा है '
अथवा
क. एक सरल खाद्य श्ृांखला ऊष्मागकर्की के प्रर्म कनयम का उदाहरि कैसे प्रस्तु र् करर्ी है ?
ख. नीचे दी गई र्ाकलका दु कनया के कवकभन्न भागोां में प्रजाकर्योां की सांख्या दशात र्ी है

*कृपया ध्यान दें कक शैक्षकिक सत्र 2024-25 की मू ल्ाांकन योजना वर्तमान सत्र अर्ातर् 2025-26 में भी जारी रहे गी।

स्थान का नाम पक्षी प्रजावियों की संख्या

कोलांकबया 1400

भारर् 1200

उत्तरी दकक्षि अमेररका 1300

न्यूयॉकत 105

डे नमाकत 504

पक्षी प्रजाकर्योां की अकधक सांख्या वाले क्षेत्रोां में सामान्य कारक की पहचान करें र्र्ा इस अकधक
कवकवधर्ा के कलए कम से कम दो कारि सुझाएाँ ।

**********

*कृपया ध्यान दें कक शैक्षकिक सत्र 2024-25 की मू ल्ाांकन योजना वर्तमान सत्र अर्ातर् 2025-26 में भी जारी रहे गी।

Study Materials
Notes

Model Papers Class 6 Notes

Sample Papers Class 7 Notes
Half Yearly Sample Papers Class 8 Notes

Class 9 Notes
Important Resources
Class 10 Notes
Periodic Table
Class 11 Notes
Writing Skills / Formats

Maps of India / World Class 12 Notes

Books and Solutions

NCERT Books
NCERT Book Solutions
HC Verma Chapter Wise Solutions
RD Sharma Solutions
CGBSE Solutions