CBSE Class 12 Sample Paper 2027 for Biology

FOR CBSE CLASS 12 PREPARATION

CBSE Class 12 Sample
Paper 2027 for Biology
EXAM YEAR TYPE SUBJECT

CBSE Class 12 2027 Sample Paper Biology

Notes · Sample Papers · Previous Year Papers · Mock Tests

m
m .co

m .co s e m
se
BIOLOGY – CODE NO. 044
g l a
a
SAMPLE QUESTION PAPER*
CLASS – XII (2026-27)
Maximum Marks: 70 Time: 3 hours

General Instructions:

(i) All questions are compulsory.
(ii) The question paper has five sections and 33 questions.
m
.co
(iii)Section–A has 16 questions of 1 mark each; Section–B has 5 questions of 2
m
.co
marks each; Section– C has 7 questions of 3 marks each; Section– D has 2
e m
s
case-based questions of 4 marks each; and Section–E has 3 questions of 5
em l a
s
marks each.

l a
(iv) There is no overall choice. Answer all 33 questions. However, internal choices
g ag
a
have been provided in some questions. A student has to attempt only one of the
alternatives in such questions.
(v) Wherever necessary, neat and properly labeled diagrams should be drawn.

Section – A
Q. Nos. 1 to 12 are multiple choice questions. Only one of the choices is correct.
Select and write the correct choice as well as the answer to these questions.

m
c. o
Q. Question Marks
No.
e m
1
las
A researcher observes that in a particular flowering plant, the pistil matures 1

ag
several days before the stamens in all flowers of the plant. What is the most
significant consequence of this timing difference?
A. It guarantees self-pollination
B. It promotes autogamy
C. It ensures cross-pollination
D. It leads to geitonogamy

2 A male patient undergoes a medical procedure where a small section of the 1
m
.co
vas deferens is cut and tied at both ends. Which of the following effects is
m
c. o A. Blockage of sperm transport into the ejaculatory duct and urethra.
the intended and direct result of this procedure?
s e m
s em B. Inhibition of testosterone production by the testes. gla
la a
ag
C. Suppression of the formation of seminal plasma by accessory glands.
D. Prevention of spermatogenesis in the seminiferous tubules.

3 During the early stage of human embryonic development, the blastomeres 1
are arranged into an outer layer and an inner group of cells known as the
Inner Cell Mass (ICM). What is the fundamental significance of the outer
layer, the trophoblast?
A. It is responsible for forming the primary germ layers (ectoderm,
mesoderm, endoderm).
o m m .
c
. Paper Design and Assessment Pattern for Academic Session 2026-27. se
e m
*There is no change in the Question
l a
la s ag
a g For more Question Papers, Sample Papers, Notes & Syllabus visit Page 1 of 12

B. It provides essential nutrients to developing embryo and helps in its
implantation.
C. It secretes colostrum which contains antibodies.
D. It gives rise to all the organs of the future embryo (organogenesis).

4 Select the option that gives the correct description of the process of natural 1
selection with respect to the length of the neck of the giraffe.

A. Stabilising selection as giraffes with longer neck lengths are selected
further.
B. Disruptive selection as giraffes with smaller and longer neck lengths are
selected.
C. Directional selection as giraffes with longer neck lengths are selected.
D. Stabilising selection as giraffes with medium neck lengths are selected.
-------------------
For Visually impaired students
Evolution of antibiotic-resistant bacterial population signifies the information
that
A. Acquired traits are inherited.
B. Nature selects for fitness.
C. Genetic variations are not a prerequisite factor for natural selection.
D. The theory of spontaneous generation of life holds true.

5 The initiation step during the process of transcription in bacteria is shown 1
below. Identify A, B, C and D by selecting the option:

A. A-RNA polymerase, B-Promoter, C-Sigma factor, D-DNA helix
B. A-Promoter, B-Sigma factor, C-RNA polymerase, D-DNA helix
C. A-Promoter, B-RNA polymerase, C-DNA helix, D-Sigma factor
D. A-Promoter, B-RNA polymerase, C-Sigma factor, D-DNA helix

*There is no change in the Question Paper Design and Assessment Pattern for Academic Session 2026-27.

For more Question Papers, Sample Papers, Notes & Syllabus visit Page 2 of 12

m
m .co

m .co s e m
se -------------------
g l a
For Visually impaired students a
The promoter site and the terminator site for transcription are located at:
A. 3′ (downstream) end and 5′ (upstream) end, respectively of the
transcription unit
B. 5′ (upstream) end and 3′ (downstream) end, respectively of the
transcription unit
C. the 5′ (upstream) end
m
.co
D. the 3′ (downstream) end
m
6
.co
Given below is the illustration of the different steps of experiments conducted
m
1
s e m
e
by MacLeod, McCarty and Avery to find the chemical nature of the
s l a
l a
'transforming principle' as DNA. Select the option that incorrectly depicts
g ag
a
the step of the experiment.

m
m .co
s e
g la
a
A B C D
-------------------
For Visually impaired students
In the Griffith experiment, which of the following, when injected into mice, did
not cause pneumonia?
A. Heat-killed S strain only
m
m B. Live R strain only
.co
.co C. Both (A) and (B)
s em
s em D. Live S strain only
g la
g la 7 15
a then he shifted
A scientist was culturing E.coli in a NH Cl medium initially, 1
a
4
14
E.coli to a NH4Cl medium. The DNA was extracted from E.coli after 60
minutes of transfer to 14NH4Cl Medium and performed density gradient
centrifugation to check the isotope distribution in newly replicated DNA.
What will be the densities of DNA molecules formed?
A. 25% hybrid and 75% light
B. 50% hybrid and 50% light
C. 75% hybrid and 25% light

o
D. 85% hybrid and 15% light
m m .
c
. Paper Design and Assessment Pattern for Academic Session 2026-27. se
e m
*There is no change in the Question
l a
la s ag
a g For more Question Papers, Sample Papers, Notes & Syllabus visit Page 3 of 12

8 Study the given pedigree and identify the disease represented 1

A. Myotonic Dystrophy
B. Sickle cell anaemia
C. Haemophilia
D. Colour blindness
-------------------
For Visually impaired students
If a genetic disease is transferred from a phenotypically normal but carrier
female to only some of the male progeny the disease is:
A. Autosomal dominant
B. Autosomal recessive
C. Sex-linked dominant
D. Sex-linked recessive

9 A patient with fever, chest pain, cough and breathing difficulty undergoes a 1
chest X-ray. The film shows patchy opacities and reduced clarity of lung
fields. Which observation best supports pneumonia?
A. Enlarged heart size
B. Inflammation or fluid buildup in the lungs
C. Fractured ribs
D. Air pockets in the lungs

10 A stretch of an euchromatin has 200 nucleosomes, how many base pairs 1
(bp) will be there in the stretch and what would be the length of the typical
euchromatin?
A. 20,000 bp and 13,000x10-9 m
B. 10,000 bp and 10,000x10-9 m
C. 40,000 bp and 13,600x10-9 m
D. 40,000 bp and 13,900x10-9 m

11 A biotechnology company grew Streptomyces in a fermenter to produce an 1
antibiotic. It was observed that Day 7 onwards, the actual yield drops
sharply, even though nutrient level, temperature, and aeration remain

*There is no change in the Question Paper Design and Assessment Pattern for Academic Session 2026-27.

For more Question Papers, Sample Papers, Notes & Syllabus visit Page 4 of 12

m
m .co

m .co s em
unchanged. Also, Microscopy revealed new colonies oflabacteria which were
se ag stopped.
not present in the original culture. So the fermenter was
What measures should be taken to prevent the fall in yield in future
fermentations?
A. Increasing temperature only at the end of fermentation to kill
contaminants.
B. Adding antibiotics to the culture so unwanted microbes cannot grow.
C. Ensuring sterile handling, sterilised equipment, and aseptic transfer
before and during fermentation.
m
m
D. Using a genetically modified strain designed to grow faster than
.co
.co
contaminants.
e m
s em field, which typically thrives in waterlogged conditions and g1las
requireslasoil rich in nutrients like phosphorus, is experiencing a severe a
12 A rice farmer's

ag this year. The crop is also susceptible to root infestation by
drought
pathogens. Which of the following techniques is best to address all these
issues?
A. Adding nitrogen-fixing bacteria to the soil
B. Applying chemical fertilizers
C. Adding spores of Glomus to the soil
D. Flooding the field artificially to mimic normal conditions
m
.co
Question No. 13 to 16 consist of two statements – Assertion (A) and Reason (R). Answer
m
e
these questions selecting the appropriate option given below:
s
la
A. Both A and R are true and R is the correct explanation of A.

ag
B. Both A and R are true but R is not the correct explanation of A.
C. A is true but R is false.
D. A is False but R is true.

13 Assertion (A): Spermatogenesis is an ongoing process throughout the 1
reproductive life of a human male, while oogenesis is a discontinuous process.
Reason (R): Oogenesis begins during the embryonic stage, gets arrested at
prophase-I, resumes after puberty, and is arrested again at metaphase-II.
m
14
c om
Assertion (A): There is no variation in the percentage recombination due to
m.co 1

m . loosely or tightly linked genes.
s e
s e Reason (R): Linked genes result in occurrence of higher proportion of parental
g l a
g la gene combinations.
a
a 15 Assertion (A): The primary goal of sewage treatment is to eliminate all organic 1
matter from the effluent.
Reason (R): High BOD indicates a low level of organic matter in the water,
which can lead to increased oxygen consumption by microorganisms,
potentially harming aquatic life.

16 Assertion (A): Tissue culture is used when traditional breeding technique is 1
o m m .
c
insufficient to keep pace with the demand of crop improvement.

m . Paper Design and Assessment Pattern for Academic Session 2026-27. se
s e
*There is no change in the Question

g l a
g la a
a For more Question Papers, Sample Papers, Notes & Syllabus visit Page 5 of 12

Reason (R): Totipotency is the ability of a single plant cell or explant to
regenerate into a whole plant under sterile conditions in nutrient media.

Section - B

17 Attempt either option A or B. 2
A. Geitonogamy can be compared with cross-pollination as well as self-
pollination. Comment.
OR
B. Mohit wants to produce hybrid seeds in a plant in his field in which male
and female flowers mature at the same time and are close together.
Suggest one strategy to promote only desired cross pollination and justify
your answer.

18 The movement of landmasses over geological time changed the distribution 2
and evolution of animals. Explain this idea using two examples from different
regions of the world.

19 The following is a realistic example dataset and not a real world patient dataset: 2

Sample Tumor size Glucose Oxygen Neighboring
ID (mm3) level level cell’s viability/
mM/litre (mmHg) vitality (%)
1 150 2.0 15 60
2 50 4.5 30 85
3 200 1.3 10 50
4 100 3.0 20 70
5 250 0.9 7 40

A. Interpret the relationship between tumor size and glucose level.
B. Evaluate the data to determine how tumor progression may affect the
viability/vitality of neighboring cells. Provide a brief explanation.

20 2
Attempt either option A or B.
A. The table below shows hypothetical data comparing α-lactalbumin
concentration in three types of milk, including that of Rosie, a transgenic
cow designed to express human milk proteins.
Source of Milk α-lactalbumin Content
approximately (g/L)
Normal cow’s milk 0.1
Rosie cow’s milk 2.4
Human milk 3.5

*There is no change in the Question Paper Design and Assessment Pattern for Academic Session 2026-27.

For more Question Papers, Sample Papers, Notes & Syllabus visit Page 6 of 12

m
m .co

m .co s em
se g laidentical, which milk
a from α-lactalbumin?.
I. Assuming all other nutritional components are
would provide the lowest nutritional contribution
II. If further genetic modification increases α-lactalbumin levels in Rosie to
3.5 g/L, predict one ethical concern that might arise from such a
development.
OR
B. A farmer replaces the GM crop with a conventional variety. Predict any two
challenges she/he may face. Support your answer with two reasons.
m
21 Attempt either option A or B.
m 2
.co
.co
A. The table below is a hypothetical data on Seasonal Temperatures seen
s e m
s em
over two different zones
g l a
g la Temp. Temp. in Temp. Respiration a
a
Region Temp. Primary
in Summer in in Productivity (R)
o 2 2
Spring ( C) Autum Winter (GPP) (g/m / (g/m /year)
o o o
( C) n ( C) ( C) year)

Region X 27 28 27 26 3500 1300

Region Y 12 20 14 4 2000 800

I. Justify which region will have greater species diversity based on the
m
.co
given data?

em
II. Calculate the net primary productivity (NPP) of the region mentioned in
s
la OR
(I) and give its significance?

a g
B. Following is a hypothetical data on Plant Pollinator interaction
Plant Main Pollinator Seed set (%) Seed set (%)
with pollinator without pollinator
P1 H1 (Bee) 80 40
P2 H2 (Butterfly) 75 45
P3 H3 (Moth) 85
o m 35

m I. From the data above, justify which plant shows the. highest c
m .co dependence on its main pollinator?
s em
s e II.
g la above? Define
What kind of ecological interaction is shown in the table

g la it in one sentence. a
a Section - C

22 A couple, A and B, visit a fertility clinic. Examination reveals that female A has 3
a blockage in her fallopian tubes, but her ovaries can produce viable ova. Male
B produces sperm with a very low sperm count, making natural fertilization
unlikely.
Which two different Assisted Reproductive Technologies (ARTs) would a doctor
o m m .
c
. Paper Design and Assessment Pattern for Academic Session 2026-27. se
e m
*There is no change in the Question
l a
la s ag
a g For more Question Papers, Sample Papers, Notes & Syllabus visit Page 7 of 12

most likely recommend for this couple to increase their chances of conceiving?
Justify your selection by briefly stating the principle behind each chosen
technique concerning the couple's specific issues.

23 In the post-fertilization embryo sac shown in figure, structure 'P' results from the 3
fusion of one male gamete with the egg cell, and structure 'Q' results from the
fusion of the other male gamete with the polar nuclei.

A. Identify structure 'P' and structure 'Q' and state their ploidy.
B. Evaluate the following statement: "The division of 'P' always precedes
the division of 'Q'." Justify your evaluation based on the nutritional
requirements for seed development.
C. Which characteristic feature of endosperm helps in its nutritive role?
-------------------
For Visually impaired students
A. Which two products are formed after double fertilization in the embryo
sac of a flowering plant?
B. State the ploidy of these two structures.
C. Which of these two structures develops first during embryonic
development? State its significance.

24 In mice, the traits for running ability and hair colour assort independently. 3
Running (R) is dominant over walking in circles (r).
Black hair (B) is dominant over brown hair (b). A heterozygous running, brown-
haired female mouse was artificially inseminated using sperm from a
heterozygous running, heterozygous black male.
A. Write the genotypes of both parents and draw a Punnett square showing
all possible offspring combinations. (1)
B. Using the Punnett square, state the phenotypic ratio for: Running–Black,
Running–Brown, Walking–Black, Walking–Brown. (1)
C. If 64 offspring were produced, calculate how many would be expected to
show the Running–Black phenotype. (1)

*There is no change in the Question Paper Design and Assessment Pattern for Academic Session 2026-27.

For more Question Papers, Sample Papers, Notes & Syllabus visit Page 8 of 12

m
m .co

m .co s em
se gla in Phenylketonuria
25 How can a single gene defect caused by the mutation result
(PKU)? Explain the molecular mechanism underlyingapleiotropy.
3

26 Drug-use disorders often begin with occasional consumption but may progress 3
into a compulsive state.
Analyse how addiction differs from dependence in both origin and
consequence, and justify why long-term drug intake forces the user to increase
dose over time.

m
m .co
27 Pathogens are often considered harmful, yet they have been adapted as 3

.co m
powerful tools in genetic engineering. Explain how pathogens have been
s e
em a
modified into useful vectors. Describe the role of a similarly modified plant
s l
ag 3
vector and animal vector.

g la Myrmeconema neotropicum lives inside the abdomen of certain
a
28 The nematode
tropical ants (Cephalotes atratus). Inside the ant’s body, the nematode
develops slowly without killing it. Once mature, it changes the color of the ant’s
abdomen to bright red, making it resemble a berry. Birds, mistaking it for a fruit,
eat the ant. The nematode’s eggs survive in the bird’s digestive system and
pass out in droppings, which other ants contact while foraging, starting the
cycle again.

m
.co
A. Why would harming the ant too early be disadvantageous for the
nematode? (1)
e m
s
B. How is natural selection playing a vital role in maintaining this interaction?

g la (1)

Define it in one sentence.
a
C. What kind of ecological interaction is seen between nematode and ant?
(1)

Section - D

29 Madhuri, a 17-year-old girl, has been experiencing irregular periods for the past 4
one year. Sometimes, her cycles are as short as 20 days and sometimes as
long as 45 days. She occasionally has very heavy bleeding that lasts over a
m
.co
week, causing fatigue and weakness. A doctor reviews her menstrual diary and
m
.co em
explains that these changes can be linked to hormonal fluctuations in the

e m las
hypothalamic-pituitary-ovarian (HPO) axis. He shows Madhuri the lack of a

las g
clear ovulation peak and low progesterone levels in her recent cycles.
a causing fatigue.
ag A. Madhuri experiences heavy bleeding lasting over a week
What possible complication could arise from this condition? (1)
B. Examine how the absence of a distinct LH (luteinizing hormone) surge in
the menstrual cycle might explain both the irregularity and heaviness of
Madhuri’s periods. (2)
Attempt either subpart C or D.
C. Madhuri’s cycles vary between 20 and 45 days. What might this

o m
irregularity indicate about her ovarian function? (1)
m .
c
. Paper Design and Assessment Pattern for Academic Session 2026-27. se
e m
*There is no change in the Question
l a
la s ag
a g For more Question Papers, Sample Papers, Notes & Syllabus visit Page 9 of 12

OR
D. If a doctor suspects hypothalamic-pituitary dysfunction in Madhuri, which
hormone secretion pattern would you expect to be disrupted? (1)

30 A tribal farmer is cultivating Brassica oleracea (cabbage) in a forest region rich 4
in pollinators and rare butterflies. Recently, his crops have been heavily
damaged by cabbage looper caterpillars. To manage the pest outbreak, he
applies Nucleopolyhedrovirus (NPV). After a few weeks, the pest population
decreases significantly without affecting other insects or animals in the area.
A. Justify with reasons why the use of Nucleopolyhedrovirus (NPV) was a
suitable choice for controlling cabbage looper caterpillars. (1)
B. Suggest another IPM strategy suitable for controlling caterpillar pests,
and briefly describe its mode of action. (2)
Attempt either subpart C or D.
C. Name the group of pathogens to which Nucleopolyhedrovirus belong. (1)
OR
D. Justify why the use of NPV is considered a biocontrol method. (1)

Section - E

31 Attempt either option A or B. 5
A. A short stretch of DNA strand that codes for a polypeptide is shown below:
3'—TACAAAAAGAAGAAAAAGAAGATT--5'
Due to exposure to harmful UV radiation two different types of errors
occurred during DNA replication affecting their sequences of bases in the
DNA in two different cells.
I. What is the term given to a segment of DNA that codes for a
polypeptide?
II. Which type of mutation could have occurred in each of the following due
to the error during replication?
a) 3'-- TACAAAAAGAAGAAAAAGAAAATT--5'
b) 3'-- TACAAAAAGAAGAAAAAGAGATT--5'
III. If DNA strand (a) codes for Methionine and sequences of
Phenylalanine, mention the sequence of amino acids that will constitute
the polypeptide chain after translation.
How many amino acids will be translated from this strand?
IV. If all the codons of the stretch code for Phenylalanine excluding the
initiator codon which feature does it depict?
OR
B.
I. If GUA is an intron how many amino acids will be translated from the
mature or processed RNA. Pick out the untranslated region from the
following messenger RNA and mention their location and sequence.

*There is no change in the Question Paper Design and Assessment Pattern for Academic Session 2026-27.

For more Question Papers, Sample Papers, Notes & Syllabus visit Page 10 of 12

m
m .co

m .co s em
se What is its significance?
g l a
a
5’ACGUCGAUGACCGUAGCGUUUGUAUCUUUAGUAGUGGUAUUA
GUAGGCUAAAAA3’
II. If AAA is the anticodon of phenylalanine, draw the tRNA adaptor
molecule, Mention the position of amino acid Phenylalanine in the
sequence of polypeptide counting the triplet codons.

32 Attempt either option A or B. 5

m
.co
A. A scientist is screening bacterial transformants engineered with DNA
m
fragments of the β-globin gene. A radioactive DNA probe complementary to
.co
the normal β-globin sequence is used. After autoradiography:
mand C show strong and week radioactive signals respectively. las e m
 PlateseA
l as ag
agthe following:
 Plate B shows no radioactivity.
Answer
I. Why does plate B fail to show radioactivity, while A and C do?
(2)
II. How can this experiment help in distinguishing a normal individual, a
carrier, and a patient of sickle cell anaemia? (2)
III. Name one other commonly used technique (apart from autoradiography)

m
to differentiate recombinants from non-recombinants. (1)
OR
m .co
e
B. A student placed DNA from three different sources: bacteria, plant tissue,
s
la
and fungal cells in a test tube A, B and C respectively. During the process of
g
a
isolating and purifying DNA, the student added cellulase to all test tubes.
I. Predict and explain in which trial(s) DNA isolation would fail, and why?
Also suggest how it could be corrected. (2)
II. After rectifying the mistake made in ‘a’, outline the steps to obtain visible
spooled DNA from the sample. (2)
III. Suggest one application of the spooled DNA in biotechnology. (1)

33 5
m
Attempt either option A or B.

mA. A Green Valley X, home to rare medicinal plants and several migratory bird
.co
m .co species, is facing multiple environmental challenges.
s e m
s e I. A luxury brand of cosmetics with little regulation has been sourcing wild
g l a
la a
medicinal plants from the valley.

ag II. The company has introduced an ornamental grass species from another
country, which has taken over large areas of native grassland.
III. There is also a reported drastic decline in the endemic trees.
IV. Large scale forest fire in a part of the valley.
a) From the above hypothetical case, identify and explain the four major
biodiversity threats. (4)
b) Suggest one in-situ conservation practice that could help protect the
biodiversity of Green Valley X, and justify your choice. (1)
o m m .
c
. Paper Design and Assessment Pattern for Academic Session 2026-27. se
e m
*There is no change in the Question
l a
la s ag
a g For more Question Papers, Sample Papers, Notes & Syllabus visit Page 11 of 12

OR
B. At a composting ground, after a community clean-up drive, large amounts
of vegetable peels, garden leaves, and other organic waste are piled up.
Over the next few weeks, the volume of the waste decreases noticeably.
I. Explain the sequence of processes that could have led to this
transformation, and name the major organisms involved at each step. (4)
II. If a prolonged dry spell occurs during this composting period, explain how
it could affect the rate of the above processes. (1)

**********

*There is no change in the Question Paper Design and Assessment Pattern for Academic Session 2026-27.

For more Question Papers, Sample Papers, Notes & Syllabus visit Page 12 of 12