aglasem.com
Schools Admission Mock Test Playground
ClassChoose class
StateSelect state

CBSE Class 12 Sample Paper 2023 Biotechnology

Download the CBSE Class 12 Sample Paper 2023 Biotechnology PDF for free at AglaSem. Designed as per the latest CBSE Class 12 exam pattern and marking scheme, this sample paper lets you practise likely questions, manage time and self-assess before the exam. More Detail
CBSE Class 12 Sample Paper 2023 Biotechnology - Page 1 of 9

Finished viewing? Save it for later —

Download CBSE Class 12 Sample Paper 2023 Biotechnology (PDF · 9 pages)
Downloaded 12 times

About CBSE Class 12 Sample Paper 2023 Biotechnology

CBSE Class 12 Sample Paper 2023 Biotechnology is available here for free download. Published by CBSE for Class 12, this sample paper can be viewed online or downloaded as a PDF (9 pages). Candidates preparing for Class 12 can use CBSE Class 12 Sample Paper 2023 Biotechnology to understand the exam pattern, the type of questions asked, and the overall difficulty level.

Frequently Asked Questions

How can I download CBSE Class 12 Sample Paper 2023 Biotechnology?

Open this page and click the Download button to save CBSE Class 12 Sample Paper 2023 Biotechnology as a PDF. It is completely free on AglaSem Docs.

Is CBSE Class 12 Sample Paper 2023 Biotechnology free to download?

Yes. CBSE Class 12 Sample Paper 2023 Biotechnology can be viewed online and downloaded as a PDF free of cost on AglaSem Docs.

How many pages does CBSE Class 12 Sample Paper 2023 Biotechnology have?

CBSE Class 12 Sample Paper 2023 Biotechnology contains 9 pages, which you can read online or download together as a single PDF.

Where can I find more Class 12 study material?

You can find more Class 12 question papers, sample papers, syllabus, and answer keys on AglaSem Docs.

CBSE Class 12 Sample Paper 2023 Biotechnology – Text

Read the full text of this sample paper below — useful to quickly search, copy and reference the content online without downloading the PDF.

📄 View text version (9 pages)

Page 1

SAMPLE QUESTION PAPER
BIOTECHNOLOGY (045)
Class XII (2022-23)

Max.Marks:70 Time allowed: 3 hours
General Instructions:
i) All questions are compulsory.
ii) The question paper has five sections. All questions are compulsory.
iii) Section–A contains 12 Multiple choice questions and 4 Assertion-Reasoning based
questions of 1 mark each; Section–B has 5 short answer questions of 2 marks each;
Section –C has 7 short answer questions of 3 marks each; Section-D has two case-
based question of 4 marks; Section-E has three long answer questions of 5 marks
each.
iv) There is no overall choice. However, internal choices have been provided in some
questions. A student has to attempt only one of the alternatives in such questions.

SECTION A
1. 1
Male sterility is widely used in crops such as maize, sunflower for hybrid
production. Male sterile plants are created by introducing a gene encoding-
(a) Barnase protein
(b) TA29
(c) Barstar protein
(d) Coat protein
2. 1
Body builders prefer to drink buffalo milk to build muscle mass. Determine the
reason for this?
(a) Easier to digest
(b) Lower fat content
(c) Higher calcium and phosphorus content
(d) Balanced calorie source

Page 2

3. 1
An industrially important secondary metabolite which is used as a red pigment in
lipstics and dye for silk is obtained from-
(a) Datura stramonium
(b) Lithospermum erythrorhizon
(c) Digitalis lanata
(d) Coptis japonica
4. 1
Proteome of a given cell is dynamic because :
(a) In response to Internal and external changes the biochemical machinery of the
cell could be changed.
(b) In response to Internal and external changes the biochemical machinery of the
cell could not be changed.
(c) No direct relationship exists between Internal and external changes in the
biochemical machinery of the cell.
(d) Indirect relationship exists between Internal and external in changes the
biochemical machinery of the cell.
5. 1
Artificial seeds are produced by-
(a) Encapsulating somatic embryos in calcium alginate beads
(b) Desiccating the somatic embryos with or without coating
(c) Hydrating the somatic embryos
(d) Hydrating the zygotic embryos.
6. 1
Being a researcher, you want to improve the deficiency of certain amino acids in
cereals and legumes. Choose the technique out of the following which will be the
best to achieve your goal:
(a) Plant tissue culture
(b) Adding fertilizers to soil
(c) Protein engineering
(d) Vegetative Propagation
7. 1
Foreign DNA is directly introduced into the recipient cell using a fine micro-syringe
to transform it. The probable advantage this provides could be:
a) No specialised equipment required
b) No damage to cells
c) Low transduction rate
d) Precision of delivery

Page 3

8. 1
A piece of young hypocotyl was cultured in MS medium in a plant tissue culture lab.
This is a type of-
(a) Organ culture
(b) Callus culture
(c) Explant culture
(d) Mass cell culture
9. 1
Molecular Biologists prefer to use artificial vectors with MCS. List a benefit for this
choice.
(a) Flexibility in choice of insert size
(b) Flexibility in choice of vector size
(c) Flexibility in choice of host organism
(d) Flexibility in choice of restriction enzyme
10. 1
Native enzyme Subtilisin is inactivated by bleach, in detergents because of oxidation
of methionine at position 222. Choose a strategy that will help overcome this problem:
(a) Use Pepsin instead of Subtilisin
(b) Eliminate use of bleach
(c) Substitute another amino acid at position 222
(d) Use Amylase instead of Subtilisin
11. 1
Culture based approaches for detecting pathogens, as compared to PCR based assays
are
(a) Faster, safer but less specific
(b) Slower but safer and more specific
(c) Slower, less safe and less specific
(d) Slower, less safe but more specific
12. 1
A 100 Kb DNA fragment has to be cloned in a host cell. Which vector should be used
for this experiment?
a) Plasmid
b) Cosmid
c) BAC
d) Bacteriophage lambda

Page 4

Question No. 13 to 16 consist of two statements – Assertion (A) and Reason (R).
Answer these questions selecting the appropriate option given below:
A. Both Assertion and Reason are true and the reason is the correct explanation of the
assertion
B. Both Assertion and Reason are true but the reason is not the correct explanation of
the assertion
C. Assertion is true but Reason is false
D. Both Assertion and Reason are false
13 1
Assertion-The functional property of whey protein exploited in confectionery is
browning.
Reason-Whey proteins undergo maillard reaction providing colour and aroma to food
items
14 1
Assertion- Foaming is a problem in most microbiological processes.
Reason- It is caused due to the presence of fatty acids and silicones in the culture
medium.
15 Assertion- Whey mixed with herbs and honey is administered to the sick to treat 1
ailments like jaundice and infected skin lesions.

Reason - Whey proteins elevates the levels of glutathione which protects the cells from
harmful oxygen intermediates.
16 1
Assertion-It‟s difficult to count genes even if we know where the genes are in a given
genome
Reason- There is no simple correlation between the intuitive complexity of an
organism and the number of genes in its genome.

SECTION B
17 2
Depict the production and mode of action of tissue plasminogen activator through
diagram or flowchart.
18 2
X is a valuable tool in plant breeding, wherein variation in tissue culture regenerated
plants from somatic cells can be used for the development of crops with novel traits.
Identify „X‟. State any one example where this tool can be used for crop improvement.
OR
Leaf explants of brinjal are showing multiple shoot regeneration in a plant tissue culture
laboratory. Which plant regeneration pathway is depicted here? In this process, what
would happen if either auxins or cytokinins are high in the medium?

Page 5

19 2
Given below is a list of the first 06 residues of the beta helix in myogloblin from
different organisms. Based on this information, which amino acids (a) are most
conserved, and (b) are highly variable.
Position →
1 2 3 4 5 6
Organism↓
Human D I P G H G

Chicken D I A G H G

Alligator K L P E H G

Turtle D L S A H G

Tuna D L T T M G

Carp D F E G T G

20 2
A doctor has to prescribe a protein rich diet to sportsmen to improve their
performance. What are the two parameters that the doctor should consider while
prescribing these protein sources. Explain.
21 2

(a) Identify the technique shown above.
(b) State any three applications of the technique.

Page 6

SECTION C
3
22 (a) Chymotrypsinogen is inactive form of enzyme chymotrypsin. Which molecular
alteration converts it into active form?
(b) The catalytic triad in chymotrypsin leads to a charge relay system. Justify
OR
Haemoglobin protein of a normal individual has to be compared with that of a person
with sickle cell anaemia in a pathology laboratory. Represent the steps of the
technique, which can be used for the same, in the form of a flow chart.
23 3
Given below are few transgenic crops approved by US Food and Drug Administration
along with the improved character. Name the genes A to F introduced for the
improved character.
Crop Gene Improved character

Canola A Hybrid production

Corn B Insect resistance

Cotton C Insect resistance

Papaya D Virus resistance

Potato E Insect and virus control

Soyabean F Weed control

24 3
In animal cell culture, osmolarity of the culture medium has significant role in cell
growth and function. Justify. Which ingredients decides osmolarity of the medium

25 3
You have the gene sequence of a protein which has a proteolytic activity. How will
you establish through tools of bioinformatics that this protein:
(a) Has homologues in other organisms
(b) Belongs to the chymotrypsin family
(c) Has a database that can we used to trace the evolutionary history of this
proteolytic protein
26 3
What are type II restriction endonucleases (RE)? Give an example of a type II RE
that generates flush ends and the sequence recognized by it. Mention two other
enzymes and their utility in cloning experiment.

Page 7

27 3
Bioinformatics databases provide resources for gene level sequences such as RefSeq,
Homologene , Paralogs and UniGene and BLAST . Which of these would you use
as most suitable starting point for :
i) Avoiding redundancy in EST data.
ii) For inferring relations among organisms.
iii) Information retrieved from this resource will be used in designing gene chips.

28 a) Identify the vector shown below :

b) How can we use LEU2 gene as a selectable marker?

SECTION D
29 4
Mass Spectrometry
Mass spectrometry (MS) has emerged as an important tool in biotechnology. It is
extremely useful in obtaining protein structural information such as peptide mass or
amino acid sequences. The molecular ions are generated either by a loss or gain of a
charge (e.g. electron ejection, protonation or deprotonation). After the ions are
formed, they can be separated according to their m/z ratio and finally detected. A
protein with a molecular weight of 10,000 dalton generates five different peaks with
the ions containing 5, 4, 3, 2, and 1 charges, respectively, as shown below.

(a) What happens if there is a loss of charge from a biomolecule?
(b) Mass spectrometry is an analytical tool. Justify the statement.
(c) Calculate the m/z ratio each for protein ions containing 5, 4, 3 and 2 charges.
OR
(c) A protein has a molecular weight of 20,000 daltons and it forms two protein ions
containing 6 and 7 charges, What will be it‟s mass/charge ratio ?

Page 8

4
30 Growth kinetics is an autocatalytic reaction which implies that the rate of growth is
directly proportional to the concentration of cell..
As the cell divides, we shall have

No. of cell division 0 1 2 3 n

No. of cells 1 2 4 8 20

Mathematically N0 N0 x 22 N0 x 22 N0 x 22 N0 x 22

Doubling time which is the time taken by the population to double through one round
of cell division is inversely related to specific growth rate.
(a) In a microbiology laboratory, one bacterial culture is marked “X” with
generation time 20 s and other bacterial culture is marked “Y” with generation
time 30 s. Which bacterial culture will proliferate rapidly?
(b) Using the above table, Calculate the number of divisions the population must have
undergone to increase from 104 to 107 in 24 hours.
(c) Using the above table ,Calculate the generation time (doubling time) of a bacterial
population in which the number of bacteria increases from 108 cells/ml to 1014
cells/ml during four hours of exponential growth.
OR
(c) Explain any two different ways to measure microbial growth.

SECTION E
31 5
Several medically important protein pharmaceuticals have been produced using
animal cell culture and recombinant DNA technology. Represent the animal cell line
used for the production of the following proteins and their therapeutic use in a
tabular form.
(a) Erythropoietin
(b) Factor VIII
(c) Follicle Stimulating Hormone (FSH)
(d) Interleukin 2 (IL 2)
(e) Monoclonal antibodies (mAbs)
OR
(a) Differentiate between-
(i) Defined and Serum-supplemented medium
(ii) Anchorage-dependent and Anchorage-independent cells
(b) Explain how pH is maintained in animal cell cultures. Mention two advantages
of maintaining pH during such cultures.

Page 9

32 5
a) Dr. Sharma discovered first restriction enzyme ever from a bacteria called
Thermus aquaticus, strain DR 15. Name the enzyme.
b) Design two primers (5 nucleotide long each) for the given sequence:
5‟GATTCATTGCGCGCATTACTCGCATT3‟
c) Recognition sites are generally palindromic in nature. Does it point towards the
structure of restriction enzymes being that of a homodimer or heterodimer? Give
reason for your answer.
d) A bacteriophage is known to infect E.coli with pili. How can it be modified to
serve as a suitable vector?
( 1+1+1+2)
OR
a) Schematically explain the formation of recombinant plasmid. (2)
b) Selection is an important step in genetic engineering. You are given ampicillin and
tetracycline antibiotics. Using these antibiotics, which selection technique could
be used to differentiate between recombinant and non-recombinant cells? (3)
5
33 (a) A group of students are trying to isolate recombinant insulin .After processing
the fermentation broth, they observed no yield .What could be the most possible
reason for this?
(b) A recently discovered microbial strain gives us the desired metabolite in
nanomolar concentration. Suggest two ways of improving the production of the
desired metabolite.
(c) Pichia pastoris has many advantages as a eukaryotic expression host. Justify
giving two reasons.
OR
a) A professor told her students to ready a bacterial culture in 12 hours sharp.
Suggest her students two ways to enhance the growth of bacterial cells in the lab
so that they are able to fulfill the requirement.
b) Write any two commercial significance of microbial cell culture.
c) There are many ways of measuring microbial growth. Which technique is
considered the best and why?

Document Details

Board / OrgCBSE
ExamClass 12
TypeSample Paper
Pages9
Updated22 Jul 2026