How can I download PU CET PG 2022 Question Paper?

Open this page and click the Download button to save PU CET PG 2022 Question Paper as a PDF. It is completely free on AglaSem Docs.

Is PU CET PG 2022 Question Paper free to download?

Yes. PU CET PG 2022 Question Paper can be viewed online and downloaded as a PDF free of cost on AglaSem Docs.

How many pages does PU CET PG 2022 Question Paper have?

PU CET PG 2022 Question Paper contains 156 pages, which you can read online or download together as a single PDF.

Where can I find more PU CET PG study material?

You can find more PU CET PG question papers, sample papers, syllabus, and answer keys on AglaSem Docs.

PU CET PG 2022 Question Paper

Download the PU CET PG 2022 Question Paper PDF for free at AglaSem. Solving this previous year question paper helps you understand the real PU CET PG exam pattern, question types, difficulty level and marking scheme, and reveals important repeated topics — practise it to build speed, accuracy and exam confidence. More Detail

Question Paper Punjab University PU CET PG 2022

PU CET PG 2022 Question Paper – Text

Read the full text of this question paper below — useful to quickly search, copy and reference the content online without downloading the PDF.

📄 View text version (361 pages)

Page 15

(B.P.Ed.)
1. Occipital is the bone of
(A) Thigh (B) Skull
(C) Chest (D) Foot

2. How many sports were in the Tokyo 2020 Olympics?
(A) 32 (B) 33
(C) 35 (D) 43

3. In which year India did not compete in the Paralympics?
(A) 1992 (B) 1988
(C) 1976 (D) 1984

4. If GAMES could be as SEMAG, what is the code number for SPORTS?
(A) STORPS (B) STROPS
(C) STORSS (D) STTOPS

5. Where was the first World Cup Football held?
(A) Uruguay (B) Spain
(C) France (D) Brazil

6. India played hockey for the first time in Olympic Games in:
(A) 1924, Paris (France) (B) 1932, Los Angles (USA)
(C) 1928, Amsterdam (D) 1938, Berlin (Germany)

7. Which of the following are involved in injuries called “sprains”?
(A) tendons (B) ligaments
(C) blood vessels (D) muscles

8. 6th South Asian Games (SAF) were held at
(A) Dhaka (B) Chennai
(C) Colombo (D) Kathmandu

9. Improper Coagulation of blood is the deficiency of
(A) Vitamin D (B) Vitamin K
(C) Vitamin A (D) Vitamin E

10. Olympic Flag was hoisted first time in the year:
(A) 1990 (B) 1920
(C) 1928 (D) 1912

11. Neck joint is an example of
(A) Pivot joint (B) Saddle joint
(C) Hinge joint (D) Condyloid joint

Page 16

12. “ Sound mind in sound body” was propounded by
(A) Plato (B) Aristotle
(C) John Dewey (D) Pavlov

13. In a code, the word CRICKET is written as ETKEMGV. How will you write GOLF
in the given code?
(A) IQMH (B) IRNH
(C) IQNH (D) IRMH

14. Complete the series 1, 6, 12, 19, 27, ?
(A) 35 (B) 36
(C) 38 (D) 54
15. Lordosis is the deformity of
(A) Lumber (B) Shoulder
(C) Neck (D) Knee
16. ‘Narang Cup’ is related with
(A) Hockey (B) Lawn Tennis
(C) Badminton (D) Football

17. In which of the following organ carbohydrate is stored as glycogen
(A) Intestine (B) Stomach
(C) Pancreas (D) Liver
18. Who is called the Father of the Olympiad?
(A) Jacques Rogge (B) Pierre de Coubertin
(C) Michael James (D) Stephanie Rice
19. Osteology is the study of
(A) Muscles (B) Bones
(C) Joints (D) Nerves
20. Wills Trophy’ is associated with the game of
(A) Hockey (B) Football
(C) Volleyball (D) Cricket
21. Olympics were longest as per their duration in days?
(A) 1906 (B) 1908
(C) 1912 (D) 1916
22. Who wrote the book ‘Goal’?
(A) David Beckham (B) Tiger Woods
(C) Kapil Dev (D) Major Dhyanchand
23. Who said of the following persons said: “Play the game in the spirit of the game?
(A) Rabindranath Tagore (B) Mahatma Gandhi
(C) Subhas Chandra Bose (D) Jawaharlal Nehru

24. The term ‘Tee’ is associated with which of the following sports?
(A) Chess (B) Golf
(C) Table Tennis (D) Water Polo
(2)

Page 17

25. Anisha is fifteenth from both ends of a row of girls. How many girls are there in the
row?
(A) 15 (B) 30
(C) 16 (D) 29

26. John Dewey propounded the philosophy of
(A) Naturalism (B) Existentialism
(C) Realism (D) Pragmatism

27. How many athletes competed in the first Modern Olympic Games in 1896?
(A) 196 (B) 295
(C) 280 (D) 554

28. What is the normal life span of RBC’s
(A) 30 days (B) 90 days
(C) 60 days (D) 120 days

29. Newton’s second law of motion is also known as
(A) Law of inertia (B) Law of momentum
(C) Law of action reaction (D) Law of gravitation

30. Varun runs 8km to the South, turns left and runs 5 km. Again, he turns left and runs
8km. How far is he from his starting point?
(A) 3km (B) 5km
(C) 8km (D) 13km

31. Which is the national sport of Bangladesh?
(A) Kabaddi (B) Cricket
(C) Hockey (D) Football
32. ‘Holker Trophy’ is associated with
(A) Golf (B) Rugby
(C) Cricket (D) Bridge
33. If RESULT is coded as 798206, LET will be coded as:
(A) 680 (B) 096
(C) 092 (D) 086
34. ‘Shivanthi Gold Cup’ is associated with the game of:
(A) Hockey (B) Table Tennis
(C) Volleyball (D) Football
35. In the marathon race, athletes have to run:
(A) 25 miles 325 yards (B) 26 miles 385 yards
(C) 26 miles 285yards (D) 26 miles 386yards

36. ‘Bob Beamon’ is related to:
(A) High Jump (B) Long Jump
(C) Pole Vault (D) Shot Put
(3)

Page 18

37. ‘Ryder Cup’ is associated with
(A) Field Hockey (Men) (B) Golf (Men)
(C) Golf (Women) (D) Badminton (Men)

38. How many Bronze Medals India won at the Tokyo 2020 Olympics?
(A) 2 medals (B) 3 medals
(C) 4 medals (D) 5 medals

39. What is the stick used in Snooker called:
(A) Heave (B) A Cue
(C) Paddle (D) Tago

40. Ashok Pandit is known for outstanding performance in __________
(A) Swimming (B) Shooting
(C) Kabaddi (D) Wrestling

41. The United Nations Organization has its Headquarters at
(A) Washington DC (B) Bali
(C) New York, USA (D) Haque

42. What is the percentage of water in the muscle tissues
(A) 65% (B) 75%
(C) 85% (D) 60%

43. “Walker Cup” is associated with the game of:
(A) Badminton (B) Fencing
(C) Golf (D) Cricket

44. Sourav Chaudhary is related to which sports?
(A) Archery (B) Chess
(C) Shooting (D) Badminton

45. Bijapur is known for its_________.
(A) Gol Gumbaz (B) Heavy rainfall
(C) Statue of Gomateshwar (D) Severe drought condition
46. The first electric train of India ‘Deccan Queen’ was run between
(A) Howrah and Delhi (B) Bombay and Surat
(C) Kalyan and Pune (D) New Delhi and Madras
47. ‘Rectus Femoris’ muscle is located in:
(A) Lower back (B) Calf
(C) Lower leg (D) Thigh
48. World AIDS day is observed ever year on:
(A) February,1 (B) October,1
(C) May,1 (D) December, 1

(4)

Page 19

49. Complete the series 9,11,15,23, ?
(A) 43 (B) 39
(C) 31 (D) 27

50. Fosbury Flop technique is used in
(A) High Jump (B) Triple Jump
(C) Pole Vault (D) Long Jump

51. What is the number of chromosomes in a human cell?
(A) 28 (B) 36
(C) 48 (D) 56

52. Neck Joint is an example of
(A) Hinge Joint (B) Pivot Joint
(C) Saddle Joint (D) Condyloid Joint

53. India won its first Olympic Hockey gold in?
(A) 1928 (B) 1932
(C) 1936 (D) 1948

54. The Military Word Games are held once in:
(A) 2years (B) 3years
(C) 4years (D) 5years

55. Kwashiorkor is the deficiency of:
(A) Vitamin (B) Protein
(C) Mineral (D) Carbohydrate

56. The First World Congress of Sport Psychology was held in Rome in
(A) 1960 (B) 1963
(C) 1965 (D) 1967
57. Who was the first Indian to go space?
(A) Kalpana Chawla (B) Satish Dhawan
(C) Rakesh Sharma (D) Ravi Malhotra
58. The permanent Headquarter of the IOC is located in:
(A) Atlanta (USA) (B) Beijing (China)
(C) Lausanne (Switzerland) (D) Stockholm (Sweden)
59. Which city hosted first National Games?
(A) New Delhi (B) Karnataka
(C) Cennai (D) Trivandrum
60. Who was known as Iron Man of India?
(A) Govind Ballabh Pant (B) Jawaharlal Nehru
(C) Subhash Chandra Bose (D) Sardar Vallbhbhai Patel

(5)

Page 20

61. Who is the author of the book ‘Naked Triangle’?
(A) Khushwant Singh (B) R.K. Narayan
(C) Balwant Gargi (D) Amrita Pritam

62. Vitamin B2 is also known as
(A) Roboflavin (B) Niacin
(C) Calcium (D) Thiamine

63. The first Indian to swim across English channel was
(A) Arati Saha (B) Mihir Sen
(C) V. Marchant (D) P.K. Banerji

64. Which part of the cell is called its power house?
(A) Nucleus (B) Plastics
(C) Mitochondria (D) Centrosome

65. National Institute of Nutrition is located in which of the following place?
(A) Hyderabad (B) Kerla
(C) Gandhinagar (D) Bangalore
66. ‘Apsara is the name of India’s First
(A) Ground Battle Tank (B) Helicopter
(C) Railway Locomotive (D) Nuclear Reactor
67. Thomas Cup is associated with:
(A) Badminton (men) (B) Table Tennis (men)
(C) Badminton (women) (D) Table Tennis (women)
68. Identify the bone injury:
(A) Sprain (B) Green Stick
(C) Strain (D) Laceration
69. Meta-carpal bones are found in the
(A) Knee (B) Palm
(C) Shoulder (D) Elbow

70. The longest bone in human body is:
(A) Humerus (B) Tibia
(C) Femur (D) Ulna
71. The word “Effleurage” is related with:
(A) Weight Training (B) Sprint Training
(C) Massage (D) Endurance Training

72. Knee joint is a:
(A) Hinge Joint (B) Ball and Socket Joint
(C) Sliding Joint (D) Pivot Joint

(6)

Page 21

73. To which of the following chambers of the heart, is the aorta connected?
(A) Left auricle (B) Right auricle
(C) Right ventricle (D) Left ventricle

74. Which organ of the human body stores glycogen?
(A) Stomach (B) Liver
(C) Kidneys (D) Spleen

75. Who coined the Olympic Motto ‘Citius, Altius, Fortius’?
(A) Rousseau (B) Aristotle
(C) Henri Didon (D) Plato

x-x-x

(7)

Page 22

MSc(HS)(Biochemistry) (BIO-CHM)
1. Which of the following statements concerning the peptide shown below is correct?
Val-Cys-Glu-Ser-Asp-Arg-Cys
(A) The peptide contain asparagine
(B) The peptide contains side chain that can be phosphorylated
(C) The peptide contains side chain with secondary amino group
(D) The peptide cannot form an internal disulphide bond

2. A particular point mutation results in disruption of the a-helical structure in a segment
of the mutant protein. The most likely change in the primary structure of the mutant
protein is:
(A) Glutamate to aspartate (B) Lysine to arginine
(C) Methionine to proline (D) Valine to alanine

3. A 30-year-old woman of Northern European ancestry presents with progressive
dyspnea (shortness of breath). She denies the use of cigarettes. Family history reveals
that her sister also has problems with her lungs. Which of the following etiologist most
likely explain the patients’ symptoms?
(A) Deficiency in dietary Vitamin C (B) Deficiency of prolyl hydroxylase
(C) Increased collagenase activity (D) Deficiency of α1-antitrypsin
4. Alcohol dehydrogenase (ADH) requires oxidized nicotinamide adenine dinucleotide
(NAD+) for catalytic activity. In the reaction catalyzed by ADH, an alcohol is oxidized
to an aldehyde as NAD+ is reduced to NADH and dissociates from the enzyme. The
NAD+ is functioning as a:
(A) Apoenzyme (B) Coenzyme-cosubstrate
(C) Coenzyme-prosthetic group (D) Cofactor
5. Which of the following has the strongest tendency to gain electrons?
(A) Coenzyme Q (B) Cytochrome c (C) FAD (D) Oxygen

6. Which of the following statements is true for anabolic pathways only?
(A) They are synthetic and require energy
(B) Their irreversible reactions are regulated
(C) They are called cycles if they regenerate an intermediate
(D) They typically require oxidized coenzymes

7. Compared with resting state, vigorously contracting skeletal muscle show:
(A) Decreased AMP/ATP ratio
(B) Increased oxygen availability
(C) Decreased NADH/NAD+ ratio
(D) Increased reduction of pyruvate to lactate

Page 23

8. Epinephrine and glucagon have which of the following effects on hepatic glycogen
metabolism?
(A) Both glycogen phosphorylase and glycogen synthase are activated by
phosphorylation but at significantly different rates
(B) Glycogen phosphorylase is inactivated by the resulting rise in calcium, whereas
glycogen synthase is activated
(C) Glycogen phosphorylase is phosphorylated and active, whereas glycogen synthase
is phosphorylated and inactive
(D) The net synthesis of glycogen is increased

9. A nursing female with classic galactosemia is on a galactose-free diet. She is able to
produce lactose in breast milk because:
(A) Galactose can be produced from fructose by isomerisation
(B) Galactose can be produced from a glucose metabolite by epimerization
(C) Hexokinase can efficiently phosphorylate galactose to galactose-1-phosphate
(D) The enzyme affected in galactosemia is activated by a hormone produced in the
mammary gland
10. Anomers of D-fructose differ in configuration.
(A) C1 (B) C2 (C) C3 (D) C5

11. An essential fatty acid is:
(A) Oleic acid (B) B. Stearic acid
(C) Linoleic acid (D) Palmitic acid
12. Which one of the following statements about the absorption of lipids from the intestine
is correct?
(A) Dietary triacylglycerol must be completely hydrolyzed to free fatty acids and
glycerol before absorption
(B) The triacylglycerol carried by chylomicrons is degraded by lipoprotein lipase to
fatty acids that are taken up by muscle and adipose tissues and glycerol that is taken
up by the liver
(C) Fatty acids that contain fewer than 12 carbon atoms are absorbed and enter the
circulation primarily via the lymphatic system
(D) Deficiency in the ability to absorb fat result in excessive amounts of chylomicrons
in the blood
13. The Lipid not present in biomembranes is:
(A) TGs (B) Lecithin (C) Cholesterol (D) Sphingomyelin

14. The following is true about cholesterol:
(A) 27 carbons, 1 double bond (B) 27 carbons, 2 double bond
(C) 27 carbons, no double bond (D) 30 carbons, 1 double bond
15. The ratio of ATP yield from glucose oxidation under aerobic to anaerobic conditions
is:
(A) 1 (B) 5 (C) 10 (D) 19

Page 24

16. The enzyme in glycolysis which catalyses reversible step is
(A) Hexokinase
(B) Glyceraldehyde-3-phosphate dehydrogenase
(C) Phosphofructokinase
(D) Pyruvate kinase

17. Complete oxidation of Palmitic acid yields:
(A) 129 ATP (B) 131 ATP (C) 121 ATP (D) 111 ATP

18. The two carbon donor in fatty acid biosynthesis is:
(A) Acetyl coA (B) Malonyl coA (C) Succinyl coA (D) HMG-coA

19. Toamplify 1µg DNA to 1g by PCR the thermocycles needed are:
(A) 10 cycle (B) 20 cycle (C) 30 cycle (D) 40 cycle

20. The polymerase used in PCR is taken from hot spring bacteria because it is:
(A) Cheap (B) Abundant (C) Thermostable (D) More efficient

21. Which of the following statements about the free energy change (ΔG) in a biochemical
reaction correct?
(A) If ΔG is negative, the reaction proceeds spontaneously with a loss of free energy
(B) In a exergonic reaction, ΔG is positive
(C) In the endergonic reaction, ΔG is negative
(D) If the ΔG is zero, the reaction is essentially irreversible

22. The flow of electrons through the respiratory chain and the production of ATP are
normally tightly coupled. The processes are uncoupled by:
(A) Cyanide (B) Carbon monoxide
(C) Oligomycin (D) Thermogenin

23. A student takes some tablets she is offered at a disco, and without asking what they are
he swallows them. At a short time later he starts to hyperventilate, and becomes very
hot. What is the most likely action of the tablets?
(A) An inhibitor of mitochondrial electron transport chain
(B) An inhibitor of transport of ADP into mitochondria to be phosphorylated
(C) An inhibitor of transport of ATP out of mitochondria to cytosol
(D) An uncoupler of mitochondrial electron transport and oxidative phosphorylation

24. Which of the plasma lipoproteins is best described as follows: synthesized in the
intestinal mucosa, containing a high concentration of triacylglycerol and responsible
for transport of dietary lipids in the circulation?
(A) Chylomicrons (B) HDL (C) LDL (D) VLDL

Page 25

25. Identify the metabolite that does NOT serve as a precursor of a dietary essential amino
acid.
(A) α-ketoglutarate (B) Glutamate (C) Aspartate (D) Histamine
26. Select the correct answer:
The first reaction in the degradation of most of the protein amino acids involves the
participation of

(A) NAD+ (B) Thiamine pyrophosphate
(C) Pyridoxal phosphate (D) FAD

27. Which of the following is not a haemoprotein.
(A) Myoglobin (B) Cytochrome c (C) Catalase (D) Albumin

28. A 1-week old infant, who was born at home in a rural area, has undetected classic
phenylketonuria. Which statement about this baby and/or her treatment is correct?
(A) A diet devoid of phenylalanine should be initiated immediately
(B) Dietary treatment will be recommended to be discontinued in adulthood
(C) Supplementation with vitamin B6 is required
(D) Tyrosine is an essential amino acid

29. Which of the following statements concerning amino acids is correct?
(A) Alanine is ketogenic
(B) Amino acids that are catabolised to acetyl coenzyme A are glucogenic
(C) Branched chain amino acids are catabolised primarily in liver
(D) Cysteine is essential for individuals consuming a diet severely limited in methionine

30. δ-Aminolaevulinic acid synthase activity:
(A) Biosynthesis is decreased by iron in erythrocytes
(B) Catalyzes the committed step in porphyrin
(C) Is decreased in liver in individuals treated with certain drugs such as the barbiturate
phenobarbital
(D) Requires biotin as a coenzyme

31. In which of the following tissues glucose transport into the cell is insulin dependent?
(A) Adipose (B) Brain (C) Liver (D) RBCs

32. Which of the following is called memory test for diabetes?
(A) Hyperglycemia (B) Ketone estimation
(C) Glucose tolerance test (D) HbA1c test

33. While studying the structure of a small gene that was sequenced during the human
genome project, an investigator notices that one strand of DNA molecule contains 20
As, 25Gs, 30Cs and 22Ts. How many of each base is found in complete double stranded
molecule?
(A) A=40, G=50, C=60, T=44 (B) A=44, G=60, C=50, T=40
(C) A=45, G=45, C=52, T=52 (D) A=42, G=55, C=55, T=42

Page 26

34. The protein factor that identifies the promoter of protein-coding genes in eukaryotes is:
(A) Rho (B) Sigma (C) TFIID (D) U1
35. An inhibitor of transcription is:
(A) Puromycin (B) Rifamycin (C) Cholera toxin (D) Streptomycin

36. The enzyme which does NOT participate in ammonia assimilation is:
(A) Carbamoyl-phosphate synthetase (B) Glutamine synthetase
(C) Glutamate decarboxylase (D) Glutamine oxoglutarate transaminase

37. The Shine-Dalgarno sequence is:
(A) Purine rich segment in mRNA (B) Pyrimidine rich segment in mRNA
(C) Purine rich segment in rRNA (D) Pyrimidine rich segment in rRNA

38. The cells involved in adaptive immunity are:
(A) Macrophages (B) Neutrophils (C) Dendrites (D) Lymphocytes

39. A pentameric immunoglobin is:
(A) IgA (B) IgE (C) IGE (D) IgM

40. The only amino acid with one codon is:
(A) Tryptophan (B) Leucine (C) Lysine (D) Isoleucine

41. Competitive inhibitors:
(A) Increase Km (B) Decrease Km (C) Increase Vmax(D) Decrease Vmax
42. Azide inhibits:
(A) Complex I (B) Complex II (C) Complex III (D) Complex IV

43. Non-cyclic photophosphorylation produces:
(A) NADH (B) NADPH (C) NADH (D) FADH2

44. The metal present in chlorophyll is:
(A) Fe (B) Mg (C) Co (D) Zn

45. Assuming semi-conservative replication, starting with 15N-DNA shifted to 14N-
medium, the ratio of 15N-14N : 14N-14N DNA after 3cycles of replication will be:
(A) 1:2 (B) 1:4 (C) 1:3 (D) 1:1

46. The most abundant species of RNA is:
(A) rRNA (B) tRNA (C) mRNA (D) snRNA

47. The restriction enzyme most useful in recombinant DNA technology is:
(A) Type I (B) Type II (C) Type III (D) Type IV

48. An antibiotic resembling aminoacyl-tRNA is:
(A) Puromycin (B) Streptomycin (C) Rifamycin (D) Chloramphenicol

Page 27

49. The only dehydrogenase of TCA cycle which transfers electrons to FAD is:
(A) Isocitrate dehydrogenase (B) Succinate dehydrogenase
(C) Malate dehydrogenase (D) α-ketoglutarate dehydrogenase

50. The subcellular site of breakdown of long chain fatty acids to acetyl coA via b-oxidation
is:
(A) Mitochondrial intermembrane space (B) Cytosol
(C) Mitochondria (D) Endoplasmic reticulum

51. Secretion of Insulin results in:
(A) Increase of blood glucose
(B) Increases in expression of glucose transporter in adipose tissue
(C) Phosphorylation of glycogen synthase
(D) Phosphorylation of glycogen phosphorylase

52. Name the enzyme of TCA cycle which is not inhibited by NADH.
(A) Citrate synthase (B) Isocitrate dehydrogenase
(C) Pyruvate dehydrogenase (D) Succinate dehydrogenase

53. Which one of the following enzyme is inhibited by the nonsteroidal anti-inflammatory drug
(NSAID) aspirin?
(A) Lipoxygenase (B) Prostacyclin synthase
(C) Cyclooxygenase (D) Thromboxane synthase

54. The mononuclear phagocyte system does not include:
(A) Monocytes
(B) Kupffer cells
(C) Lymph node medullary macrophages
(D) Endothelial cells

55. A polymorphonuclear neutrophil (PMN):
(A) Is a bone marrow stem cell (B) Is closely similar to a mast cell
(C) Contains microbicidal cytoplasmic granules (D) Is not a professional phagocytic cell

56. Several of the complement components are:
(A) Glycolipids (B) Cytokines (C) Enzymes (D) Hormones

57. Clonal selection occurs when antigen is encountered by:
(A) Neutrophils (B) Mast (C) T-cells (D) Basophils

58. Which of the following are the antigen presentation cells:
(A) B cells (B) T cells (C) Plasma cells (D) Dendritic cells

59. Pattern recognition receptors (PRR) include:
(A) LPS (B) PAMPs
(C) Lectin like molecules (D) Unmethylated CpG sequences.

(6)

Page 28

60. Which of the following is not produced following activation of the NADPH oxidase
microbicidal pathway
(A) O2 – (B) H2O2 (C) NO (D) OH

61. The membrane attack complex consists of:
(A) Colicins (B) C5b,6,7,8,9 (C) C3b3b,Bb (D) Properdin

62. In order for T cells to respond to the antigen for which they are specific, they need to
recognize which of the following?
(A) B cells
(B) The antigenic epitope displayed by MHC molecules
(C) Immunoglobulin
(D) Cytokines

63. The most rapid effects of exposure to an allergen may be due to which of the following?
(A) Leukotrienes (B) Granulocytic infiltration
(C) Metabolites of arachidonic acid (D) Histamine

64. Which one of following statements about glycogen metabolism is correct?
(A) Glycogen synthase activity is increased by glucagon.
(B) Glycogen phosphorylase is an enzyme that can be activated by phosphorylation of its
own serine residues.
(C) Glycogen phosphorylase cannot be activated by calcium ions.
(D) cAMP activates glycogen synthesis.

65. Which is the active form of vitamin D
(A) Cholecalciferol (B) 25-OH cholecalciferol
(C) 1,25-dihydroxychoecalciferol (D) Calciferol

66. Which of the amino acids are exclusively ketogenic-
(A) Lysine (B) Tyrosine (C) Isoleucine (D) Alanine

67. Beri-Beri is caused by the deficiency of-
(A) Niacin (B) Pantothenic acid (C) Vitamin A (D) Thiamine

68. If the genetic code consisted of four bases per codon rather than three, the maximum
number
of unique amino acids that could be encoded would be
(A) 16 (B) 64 (C) 128 (D) 256
69. The difference between the molecular weight of sucrose and that of the sum of the
molecular
weights of its components (glucose and fructose) is
(A) 0 (B) 1 (C) 180 (D) 18
70. Structurally urea consist of two NH2 groups. The original contributory source of these two
amine groups are
(A) Glutamate and ornithine (B) Arginine and pyruvate
(C) Ammonia and aspartate (D) Ornithine and glutamate

(7)

Page 29

71. Which of the following amino acid is not required for glutathione synthesis?
(A) Serine (B) Cysteine (C) Glycine (D) Glutamic acid

72. An example of a transamination process is:
(A) glutamate = hexanoic acid + NH3
(B) aspartate + hexanoic acid = glutamate + oxaloacetate
(C) aspartate + α ketoglutarate = glutamate + oxaloacetate
(D) glutamate = α-ketoglutarate + NH3

73. A 42 year old male patient undergoing radiation therapy for prostate cancer develops
severe pain in the metatarsal phalangeal joint of his right big toe. Monosodium urate
crystals are detected by polarized light microscopy in fluid obtained from this joint. The
patient’s pain is directly caused by the overproduction of the end product of which of the
following metabolic pathways?
(A) Pyrimidine degradation (B) De novo purine synthesis
(C) Purine salvage (D) Purine degradation

74. Which of the following is an example of epimers?
(A) Mannose & Glucose (B) Glucose & Ribose
(C) Galactose & Mannose (D) Glucose & Galactose

75. The amino acid sequences of thousands of different proteins from many species have
been determined using principles first developed by?
(A) Watson and Crick (B) Edman (C) Sanger (D) Mendel

x-x-x

Page 30

MSc(HS)(Biophysics) (BIOPHY)
1. High energy donors involved in glycosylation are:
(A) UDP-Mannose and Galactose
(B) UDP-Mannose and GDP-N acetylglucosamine
(C) GDP-Mannose and UDP-N-acetylglucosamine
(D) UDP-Mannose and GDP-Mannose

2. The chaperone involved in protein folding:
(A) Calnexin (B) Calcitonin (C) Cadherin (D) Cdc 25 phosphatase

3. The core of the nuclear pore complex is lined with which amino acids?
(A) Glycine- Glutamic acid (B) Phenylalanine- Glycine
(C) Tryptophan- Glycine (D) Alanine- Valine

4. The electron carrier in the electron transport chain is:
(A) Ubiquitin (B) UGGT
(C) Unconventional myosin (D) Ubiquinone

5. Given below are few statements with reference to blood clot formation which results
from triggered chain of reactions:
a) Conversion of fibrinogen to fibrin
b) Activation of factor XIII, which stabilizes fibrin meshwork
c) Activation of factor XII, which promotes plasmin activation
d) Enhancement of platelet aggregation.
Which one of the following statements is correct with reference to roles of thrombin in
hemostasis?
(A) b, c and d (B) a, b and d (C) a, c and d (D) a, b and c

6. Peroxisomes are organelles involved in:
(A) Oxidation of very long chain fatty acids, synthesis of plasmalogens
(B) Oxidation of short chain fatty acids, synthesis of pigments
(C) Oxidation of very long chain fatty acids, synthesis of pigments
(D) Oxidation of short chain fatty acids, synthesis of plasmalogens

7. The sequence of sugars to dolicol phosphate during N-Linked glycosylation is:
(A) N-acetylglucosamine phosphate, N-acetylglucosamine, 9 mannose, 3 glucose
(B) N-acetylglucosamine, N-acetylglucosamine phosphate, 9 mannose, 3 glucose
(C) N-acetylglucosamine phosphate, N-acetylglucosamine, 9 glucose, 3 mannose
(D) N-acetylglucosamine, N-acetylglucosamine phosphate, 3 mannose, 9 glucose

8. Innate immunity can be defined as:
(A) The immunity resulting from vaccination
(B) The resistance to infectious diseases acquired via subclinical infections
(C) The naturally occurring defense mechanisms that provide protection from
infectious agents
(D) The protection acquired due to placental passage of maternal antibodies
9. Properties of haptens include:

Page 31

(A) Immunogenicity and reactivity
(B) Immunogenicity but no reactivity
(C) Reactivity but no immunogenicity
(D) Neither immunogenicity nor reactivity

10. A graft exchanged between a brother and sister is termed:
(A) Xenograft (B) Isograft (C) Autograft (D) Allograft

11. Components of a Fab fragment include
(A) An entire light chain, the VH and CH1 domains of the heavy chain and the Fd
fragment
(B) The VH and CH1 domains of the light chain
(C) The Fd fragment and the carboxy terminal portion of the heavy chain
(D) The carboxy terminal portion of the heavy chain

12. BCG vaccine is sometimes used for:
(A) Passive immunization for tuberculosis
(B) Non specific potentiation of the immune response
(C) Inducing antipilli antibody production
(D) Inducing production of neutralizing antibodies
13. How are restriction enzymes and ligases used in biotechnology?
(A) Restriction enzymes cut DNA at specific locations, producing ends that can be ligated
back together with ligase
(B) Only restriction enzymes that produce blunt ends after cutting DNA can be ligated
with ligase
(C) Only restriction enzymes that produce sticky ends on the DNA can be ligated with
ligase
(D) Restriction enzymes randomly cut DNA, and the cut fragments can be ligated back
together with ligase
14. Which of the following enzymes is used for the degradation of RNA strand while
performing the synthesis of cDNA?
(A) Mung Bean Nuclease (B) DNase I
(C) EcoRI (D) Ribonuclease H
15. Which of the following occurs when a knockout mouse is produced?
(A) A mutant gene is replaced by a functional allele
(B) A functional gene is replaced by a mutant allele
(C) A functional gene is inserted in addition to the mutant allele
(D) A mutant gene is inserted in addition to the functional allele

16. Which of the following enzymes in bacteria are responsible for restricting the growth
of viruses?
(A) Restriction endonucleases (B) Topoisomerases
(C) Gyrase (D) Protease

17. Which of the following statements is true about two-dimensional electrophoresis?
(A) Separates proteins of identical molecular weights, same pI but different charge
(B) Separates proteins of different molecular weights and different pI
(C) Separates proteins of identical molecular weight that differ in pI
(D) Isoelectric focusing is also termed as two-dimensional electrophoresis.

Page 32

18. In cell extracts with high protein content, before phenol treatment:
(A) Chloroform is used to break polypeptides to small fragments.
(B) SDS is used to break polypeptides to small fragments.
(C) Proteases are used to break polypeptides to small fragments.
(D) Acrylamide is used to break polypeptides to small fragments.

19. Protein separation techniques are often based on the following properties except:
(A) Solubility of the protein (B) Viscosity of the protein
(C) Charge of the protein (D) Specific binding affinity of the protein

20. If a reaction is at equilibrium, the free energy ΔG change is
(A) 1 (B) 0 (C) 10 (D) 0.1

21. The correct equation for the reduction of NADP + is
(A) NADP++2H+ →NADPH++H+ (B) NADP++H++ e-→NADPH
+ + -
(C) NADP +H +2e → NADPH (D) NADP++ 2H++2 e-→ NADPH2

22. An example of competitive inhibition of an enzyme is the inhibition of
(A) Succinic dehydrogenase
(B) Cytochrome oxidase by cyanide
(C) Hexokinase by glucose-6-phosphate
(D) Carbonic anhydrase by carbon dioxide
23. Which of the following is the important reactive group of glutathione in its role as an
antioxidant?
(A) Serine (B) Sulfhydryl (C) Tyrosine (D) Acetyl-co A

24. Aspirin, used as a common analgesic, antipyretic, and anti-inflammatory agent inhibits
the synthesis of which of the following?
(A) Arachidonic acid (B) Prostaglandins
(C) Glucocorticoids (D) Histamine

25. Which of the following is not a dietary antioxidant?
(A) Vitamin C (B) Vitamin K (C) Beta –carotene (D) Vitamin E

26. Lysosomal protein targeting takes place through
(A) COP-coated vesicles (B) Clathrin coated vesicles
(C) Liposome (D) Receptor mediated endocytosis
27. Which of the following modifications leads to protein degradation?
(A) Methylation (B) Acetylation (C) Phosphorylation (D) Ubiquitination
28. SNARE proteins are found in the membranes of all of the following compartments
except
(A) Mitochondria (B) Golgi complex
(C) Early endosome (D) Endoplasmic reticulum
29. Human diseases caused by mutations in mitochondrial genomes
(A) Are inherited from both parents
(B) Are inherited from the father
(C) Are inherited from the mother
(D) Do not exist because the mutation is always complemented by the normal gene copy
in the nucleus

Page 33

30. Phenylketonuria (PKU) is inherited disease that is characterized by
(A) Elimination of gentisic acid in urine
(B) Increased occurrence of phenylalanine in blood and tissues
(C) Elimination of sugar in urine
(D) Decrease in phenylalanine in blood and tissues

31. Apoptosis or programmed cell death, occurs in all of the following cases except
(A) In virus-infected cells
(B) In cells damaged by injury
(C) In cells with potentially cancer-causing mutations
(D) During the elimination of tissue between the digits in the formation of human
fingers

32. At which of the following sites is the partial pressure of carbon dioxide highest?
(A) Exhaled air (B) Alveolar air
(C) Systemic arterial blood (D) Systemic venous blood

33. Cerebellum of brain is concerned with?
(A) Static balance
(B) Initiation of muscular contraction
(C) Regulation of body posture and equilibrium
(D) Coordination of muscular movements

34. The system that controls smooth muscle, cardiac muscle and gland activity is the
(A) Somatic nervous system (B) Autonomic nervous system
(C) Skeletal division (D) Sensory nervous system

35. In an electrocardiogram, the QRS complex represents the
(A) Depolarisation of the atria (B) Repolarisation of the atria
(C) Depolarisation of the ventricles (D) Repolarisation of ventricles

36. High doses of antibiotics can destroy the bacterial flora of the large intestine. This can
result in impaired:
(A) Absorption of proteins (B) Blood coagulation
(C) Bone resorption (D) Respiratory control

37. Cutting the posterior root of the spinal nerve would
(A) Impair motor control of skeletal muscle
(B) Interfere with the flow of sensory impulses
(C) Interfere with the ability of brain to transmit impulses
(D) Interfere with the circulation of CSF

38. Consider the following statements
Sympathetic nervous system is characterized by
P. Acetylcholine as neurosecretion
Q. Fight and flight activity
R. longer preganglionic fibres
S. Non medullated postganglionic fibres
T. Arising from thoracic lumbar portion
(A) P, Q and R (B) Q, S and T (C) Q and S (D) P, R and T

Page 34

39. Which of the following is not a function of the liver
(A) Production of bile (B) Detoxification of drugs
(C) Storage of glucose (D) Storage of vitamin

40. The functions of the ileum is to:
(A) Absorb nutrients (B) Absorb vitamin B12 and bile salts
(C) To introduce bile and pancreatic juice (D) Absorb alcohol and aspirin

41. Which of the following group of enzymes is involved in the digestion of protein?
(A) Pepsin, amylopsin and trypsin (B) Amylopsin, trypsin and chymotrypsin
(C) Trypsin, chymotrypsin and steapsin (D) Pepsin, trypsin and chymotrypsin

42. Hormones
(A) Are chemical regulators that are conveyed from one organ to another via the blood
stream
(B) May be secreted by endocrine cells
(C) May be secreted by nerves
(D) A, B and C

43. Correct sequence of hormone secretion in menstruation is:
(A) FSH, progesterone, estrogen (B) Estrogen, FSH, progesterone
(C) FSH, estrogen, progesterone (D) Estrogen, progesterone, FSH

44. Pernicious anemia is due to:
(A) Blockage of vit B12 absorption (B) Blockage of vit A absorption
(C) Deficiency of vit C (D) Deficiency of vit B

45. Release of which of the following peptide leads to an increase in the secretion of
pancreatic enzymes into the small intestine?
(A) Cholecystokinin (B) Motilin (C) Gastrin (D) Secretin

46. In human eyes, light exposure to the retinal photoreceptors:
(A) Ncause its depolarization
(B) Causes its hyperpolarization
(C) Open Na+ channels of the photoreceptors
(D) Opens K+ channels of the photoreceptors

47. Which of the primary factor regulating normal coronary blood flow:
(A) Aortic diastolic pressure (B) Coronary perfusion pressure
(C) Systolic wall tension (D) Myocardial oxygen consumption

48. The tertiary structure of protein is detected by
(A) X-ray diffraction/crystallography (B) Spectrophotometry
(C) Electrophoresis (D) Chromatography

49. Lysosomal proteins are targeted for secretion by phosphorylation of:
(A) Mannose at the 6th position (B) Glucose at the 3rd position
rd
(C) Mannose at the 3 position (D) Glucose at the 6th position

(5)

Page 35

50. The residual biological damage that remains following radiation exposure is called:
(A) Direct effect (B) Indirect effect (C) Cumulative effect (D) Tolerance

51. A type of proteolytic enzyme found in infants’ gastric juices which helps in the
digestion of milk proteins is?
(A) Peptide (B) Rennin (C) Amylases (D) Oxidase

52. When an individual consumes a large amount of protein, what will he or she will
excrete?
(A) More urea and uric acid (B) More glucose
(C) Salt (D) Water

53. The life span of red blood cells is?
(A) 100 days (B) 110 days (C) 120 days (D) 130 days

54. Which body muscle can resist fatigue?
(A) Voluntary (B) Striped (C) Cardiac (D) Involuntary

55. All Thyroid hormones are derived from one large protein called:
(A) Thyroxine (B) Thyroglobulin (C) Thyrotropin(D) Triiodothyronine

56. Smooth endoplasmic reticulum is involved in:
(A) Synthesis of proteins (B) Synthesis of steroid hormones
(C) Synthesis of liver enzymes (D) Synthesis of proteoglycans

57. Which of the following permits the rapid diffusion of water soluble molecules between
cytoplasms of adjacent cells:
(A) Gap junctions (B) Tight junctions
(C) Anchoring junctions (D) Adherens junctions

58. Cretinism is another name for:
(A) Congenital hypothyroidism (B) Congenital hyperthyroidism
(C) Addison’s disease (D) Cushing ‘s syndrome

59. I131 is a
(A) β- emitter (B) α- emitter (C) β and γ emitter (D) α and γ emitter

60. Half-life of Technetium-99m is:
(A) 12 hours (B) 6 hours (C) 3 hours (D) 4 hours

61. The parent nuclide for Technetium-99m is:
(A) Molybdenum99 (B) Strontium90 (C) Technetium99 (D) Cobalt60

62. The first amino acid to be discovered was:
(A) Glycine (B) Asparagine (C) Glutamic acid (D) Arginine

63. Which of the following is an aromatic amino acid:
(A) Tryptophan (B) Glycine (C) Valine (D) Arginine

Page 36

64. A polar molecule
(A) Is slightly negative at one end and slightly positive at the other end
(B) Has an extra electron, giving it a negative charge
(C) Has an extra neutron, making it weigh more
(D) Has covalent bonds

65. In scurvy, defective collagen is due to insufficient vitamin C, which:
(A) Is ordinarily incorporated into crosslinks between tropocollagen molecules
(B) Is usually involved in the hydroxylation of proline residues
(C) Inhibits the oxidative degradation of collagen
(D) Is required for the conversion of lysyl residues into aldehydes

66. Which of the following is the major force of attraction that stabilizes the three
dimensional structure of globular proteins?
(A) Peptide bond (B) Van der waals interaction
(C) Hydrogen bond (D) Hydrophobic interaction

67. Non-coding regions of DNA are called:
(A) Exons (B) Introns
(C) Palindromic sequence (D) Introns and exons

68. The acrosome of sperm contains:
(A) Endoplasmic reticulum (B) Golgi apparatus
(C) Mitochondria (D) Nucleus

69. Which of the following types of vector would be most suitable for introducing DNA
into a human cell?
(A) Plasmid (B) Bacteriophage (C) Cosmid (D) Adenovirus

70. Edmann degradation is used for the
(A) Determination of amino acid sequence from the N-terminus of a protein
(B) Nucleotide sequence of DNA
(C) Determination of amino acid sequence from C-terminus of a protein
(D) Determination of RNA structure

71. SDS-PAGE does not involve
(A) Separation of proteins based on their molecular weights
(B) Denaturation of proteins with heat and chemicals
(C) Application of an electric field to proteins
(D) Creating a temperature gradient for denaturation of proteins

72. Which of the following is a clinically relevant protein produced by recombinant
technology?
(A) Insulin (B) Chymotrypsin
(C) Fibrinogen (D) Alkaline phosphatase

(7)

Page 37

73. Besides a high voltage shock, what is another method to make E. coli competent to take
up “naked” DNA?
(A) High concentrations of calcium ions followed by high temperature
(B) High concentrations of calcium ions and several hours on ice
(C) Large amounts of DNA added directly to a bacterial culture growing at 37 °C
(D) High concentrations of minerals followed by high temperature

74. Restriction enzymes are also known as:
(A) Molecular scissors (B) Molecular glue
(C) Ligases (D) Topoisomerases

75. Role of SDS in SDS-PAGE is:
(A) Detergent (B) Polymerizing agent
(C) Denaturing agent (D) Detergent and denaturing agent

x-x-x

(8)

Page 38

MSc(HS/2Yr)(Biotechnology) (MBIOT)
1 Orthologous genes are homologous genes that diverge after
A) Speciation B) Before speciation
C) Reaction rate with temperature D) Reaction rate with catalysis

2 Cis regulatory elements in genomes
A) Code for genes B) Regulate distant genes
C) Regulate neighbouring genes D) Code for essential genes

3 The experimental drug dostarlimab showing great promise in cancer therapy is
A) Cell cycle regulator B) Immune checkpoint inhibitor
C) Cell damaging molecule D) VGEF inhibitor

4 Barbara McClintock is famous for her work on
A) Enzymes B) RNA
C) Transposable genetic elements D) Cloning

5 Genome sequencing by synthesis refers to
A) Sanger sequencing B) Next generation sequencing
C) Classical sequencing D) Slow sequencing technique

6. t-RNA has a structure which usually terminates with the following nucleotides
A) CCA at 3’end B) CCA at 5’end
C) TGA at 3’end D) GGA at 3’end

7. Genetically modified brinjal is
A) Pesticide tolerant B) Herbicide tolerant
C) Cold resistant D) Modified with crystal protein gene

8. Alfred Henry Sturtevant is best remembered for his work on
A) Structure of RNA B) Drosophila
C) Human genome D) Statistics

9. Human mitochondrial DNA is transmitted to the offsprings
A) Maternally B) Paternally
C) Through mendelian inheritance D) Through mixed inheritance

10. Nucleolus region in the nucleus mainly consists of
A) r-RNA genes and a distinct membrane B) r-RNA genes and no membrane
C) t-RNA genes D) genes for membrane proteins

11. DNA exists as distinct chromosomes in
A) All phases of cell cycle B) M phase of cell cycle
C) Resting phase of cell cycle D) Non-dividing cell
12. The histone bodies in Nucleosomes are
A) H2A, H2B, H3A, H3B B) H2A, H2B, H3, H5
C) Octamer of H2A, H2B, H3, H4 D) Octamer of H2A, H2B, H3A, H3B
13. Z-DNA is a
A) Right handed helix B) Left handed helix
C) No order D) Single stranded

Page 39

14. The acronym iPSCs is best described for stem cells obtained from
A) Embryo B) Non-reprogrammed, non-embryonic sources
` C) Re-programmed adult cells D) Plant cells

15. The most important reason for carbohydrates structure diversity is because
A) The building blocks are complex sugars
B) They have protein interactions
C) Of many stereoisomers and variable linkages
D) Of geometrical isomerism

16. The domains in proteins refers to
A) Quaternary structures in proteins B) Primary structures in proteins
C) Secondary structure of proteins D) Functional elements of protein

17. One newton force is that force which can
A) Change velocity of 1Kg mass by 1m/s B) Change velocity of 1g mass by 1m/s
C) Accelerate 1Kg mass by 1m/s2 D) Accelerate 1g mass by 1m/s2

18. Mendelian genetics is different from the studies made by Morgan mainly in
A) Law of segregation B) Law of dominance
C) Structure of DNA D) Recombination frequency in inheritance

19. Hydrogen bonds are
A) Electrostatic dipole-dipole interactions B) Apolar polar interactions
C) Permanent D) Weaker than Van der Waal’s interactions

20. The pH of 0.1 N HCl will be
A) 2 B) 3
C) 4 D) 1

21. Dr. Hargobind Khorana got his Nobel prize for
A) Interpretation of genetic code B) DNA duplex
C) DNA replication D) Translation in genes

22. Streptomyces species is a
A) Fungi B) Gram negative bacteria
C) Gram positive bacteria D) Mould

23. Carl Woese is best remembered for his contributions to
A) Understanding tree of life B) Understanding of prokaryotes
C) Understanding of eukaryotes D) Understanding bacterial cell division

24. Deybe Huckel theory of electrolyte solutions takes into account the
A) Mass of solutes B) Activity coefficient of solutes
C) Volume of solutes D) Solvent nature

25. In DNA damage the suicide enzymes repair
A) Cyclobutane pyrimidine dimers B) DNA alkylation
C) Abasic DNA D) DNA lesions

Page 40

26. Mycobacterium tuberculosis is observed with
A) Gram positive staining B) Gram negative staining
C) Ziehle-Neelson staining D) Tryphan blue staining

27. Blackman’s law of limiting factors in photosynthesis discusses
A) Reaction rate limitations B) Photon flux
C) Mechanism of glucose synthesis D) Co2 exchange rates

28. Amongst the following phytohormones which has only least member
A) Auxin B) Giberellin
C) Cytokinin D) Abscisic acid

29. Fas-Fas ligand mediated apoptosis in cells belongs to the
A) Extrinsic pathway B) Intrinsic pathway
C) Necrotic pathway D) Inflammatory pathway

30. Lysozyme an important enzyme in body fluids belongs to the class
A) Oxidoreductase B) Hydrolase
C) Transferase D) Isomerase

31. Km in Michaelis Menten equation relates
A) Substrate concentration and reaction velocity
B) Reaction velocity and temperature
C) Ratio of initial substrate concentration and reaction velocity against [S]
D) Ratio of initial substrate concentration and reaction velocity against V max

32. Isozymes have
A) Similar function but different structures B) Different function but similar structure
C) Are metallozymes D) A redox centre

33. Kcat in enzyme kinetics calculates
A) [S] (substrate concentration) B) The enzyme turnover number
C) Km (Micaelis menten constant) D) Km and T (reaction time)

34. Site directed mutagenesis in protein engineering can be best achieved through
A) PCR of existing clone in a vector using designed primers
B) By using transposons
C) By mutations
D) By biochemical methods
35. In action potential along muscle or nerve cells the sequence of events is
A) Refractory period, depolarization, repolarization
B) Repolarisation, depolarization, refractory period
C) Refractory period, reploarization, depolarization
D) Depolarization, repolarization, refractory period
36. Sigma factors in E. coli transcription are important because they
A) Are involved in m-RNA sysntheis B) Are important in promoter recognition
C) Speed up transcription rate D) Help in RNA recognition
37. Cryptochromes in plants are
A) Blue light receptors B) Green light receptors
C) Phytohormones D) Secondary metabolites

Page 41

38. Nicotine is a
A) True alkaloid B) Pseudo alkaloid
C) Protoalkaloid D) Terpene

39. Paclitaxel acts as anti cancer agent by
A) Inhibiting microtubule assembly B) By stabilizing microtubule assembly
C) Acting as cytotoxic agent D) By acting on DNA directly

40. The relative centrifugal force (RCF) in a centrifuge is calculated by considering
A) Radius of rotor only B) Revolutions per minute only
C) Both radius and revolutions per minute D) Speed of centrifuge

41. One angstrom is equal to how many nanometers
A) 0.1 B) 1
C) 10 D) .01

42. In chromatography the resolving power increases as the
A) Number of theoretical plates increases B) Retention time decreases
C) Peak height increases D) As particle size increases

43. In SDS PAGE as compared to resolving gel the stacking gel has
A) Low pH and high resistance to flow B) High pH and low resistance to flow
C) Low pH and low resistance to flow D) High resolving power

44. The temperature of 273 Kelvin is equivalent to
A) 32 Fahrenheit B) 31.73 Fahrenheit
C) 30 Fahrenheit D) -180 celsius

45. Protoplast fusion is an important technique for
A) Plant growth regulation B) Understanding impact of soil on plant growth
C) Somatic hybridization D) Plant sterility

46. Pseudomonas spp are useful too because of their role in
A) Detergents B) Enzymology
C) Food technology D) Bioremediation
47. Insulin is usually biologically active when it is a
A) Hexamer B) Monomer
C) Dimer D) Tetramer

48. RTS/S vaccine is approved for use against
A) Measles B) Tuberculosis
C) Chikunguniya D) Malaria

49. Freund’s incomplete adjuvant is composed of
A) Alum
B) Antigen in water, miner oil emulsion
C) Antigen in water, miner oil emulsion and active Mycobacterium
D) Antigen in water, miner oil emulsion and inactive Mycobacterium

Page 42

50. Kohler and Milstein are best remembered for their work on
A) T cells B) Regulatory cells
C) Erythrocytes D) Hybridoma technology

51. Granzymes in immunology are
A) Cysteine proteases B) Serine proteases
C) Secondary metabolites D) Secretory cells

52. GMO Roundup ready soyabean are
A) Glyphosate herbicide resistant plants B) Insect resistant plants
C) Cold resistant plants D) Plants with high sugar content

53. Toll like receptors on macrophages are activated by
A) T cells B) B cells
C) Helper cells D) Pathogen associated molecular patterns

54. The phenotypic ratio of RrYyCc x RrYyCc cross in mendelian inheritance is
A) 27:9:9:9:3:3:3:3 B) 27:9:9:9:1:1:1:1
C) 9:3:3:3:3:3:3:3 D) 27:9:9:9:3:3:3:1

55. What is the percent of carrier population for an autosomal recessive allele with
frequency of 0.01?
A) 2%
B) 1%
C) 5%
D)4%

56. Polytene chromosomes are
A) Mutated genetic material B) Mitochondrial genome
C) Extranuclear genetic material D) Large chromosomes with many DNA strands

57. Down syndrome is caused
A) DNA mutation in chromosome 10 B) By trisomy 21
C) DNA deletion D) DNA excision
58. Holandric genes are
A) Passed by mother to son B) Passed by mother to daughter
C) Passed equally to daughters and sons D) Passed by father to son only

59. Adalimumab is a
A) Gene therapy B) Ribozyme
C) Monoclonal antibody active against TNF D) Prodrug

60. In gene mapping a distance of one centimorgan between two genes denotes
A) A distance of one micrometer between the two genes
B) A distance of one nanometer between the two genes
C) Recombination frequency of 1% between them during crossing over
D) The two genes are on same chromosome and next to each other
61. In semi conservative DNA replication
A) Parent strands remain intact
B) Parent strands are destroyed

Page 43

C) Parent strands form duplex stands with daughter strands
D) DNA is retained

62. The peptidyl transferase centre in ribosomes is found in the
A) Small subunit B) Large subunit
C) Interface of two subunits D) At the m-RNA

63. Edward Jenner is credited for the development of
A) Rabies vaccine B) Snake anti venom
C) Small pox vaccine D) Vaccine against mycobacterium

64. The intrinsic transcription termination utilizes
A) Rho proteins B) GC rich m RNA having a stem loop structure
C) Termination enzymes D) RNA polymerase deactivators

65. In size exclusion chromatography
A) Large molecules are eluted first B) Small molecules are eluted first
C) Molecules are eluted based on charge D) Hydrophobic interactions occur

66. The human genome sequencing project has
A) Deciphered role of all genes
B) Given accurate number of genes
C) Helped in understanding genomic variability
D) Been abandoned

67. The forward primer for the sequence 5’atgcgttaattccgct3’ in double stranded DNA is
A) 5’ tacgaa3’ B) 3’ tacgaa5’
C) 3’atgcggg5’ D) 5’atgcgtt3’
68. Venkatraman Ramakrishna got the Nobel Prize for
A) Solving the crystal structure of 30S subunit of ribsomes
B) Solving the structure of chromatin
C) Solving the structure of antibiotics
D) Understanding chromosomal aberrations

69. The termination codons are able to stop translation because
A) They interact with RNA B) They interact with elongation factors
C) They are recognized by release factors D) The ribosome is inactivated by them

70. Transfer messenger RNA (tm RNA) is important in prokaryotic translation because
A) It has proof reading activity B) In initiates translation
C) It rescues stalled protein biosynthesis D) It speeds up translation

71. Palatase is a
A) Lipase enzyme B) Protease enzyme
C) Peptidase enzyme D) Glycosyl hydrolase

72. Geiger counter is an instrument used for measuring
A) Light intensity B) UV rays
C) Ionizing radiations D) Electronic transitions
73. Human genome sequencing could be completed rapidly because of

Page 44

A) Sanger sequencing B) Cloning vectors
C) Shot gun technique D) Restriction enzymes

74. The information repository for solved 3-D protein structures is
A) Protein data bank B) NCBI
C) EBI D) KEGG

75. In BLAST alignment e-value is indicative of
A) Alignment because of chance B) Scoring matrix
C) Score D) Absolute score
x-x-x

Page 45

MSc(HS/2Yr)(Botany) (BOT)
1. Which of the following plants yields drug used in the treatment of hypertension?
(A) Psyllium (B) Sarpagandha
(C) Ashwagandha (D) Licorice

2. Ligulate leaf and versatile anther is found in:
(A) Ranunculaceae (B) Poaceae
(C) Rutaceae (D) Malvaceae

3. Which of the following shows secondary growth by successive cambia?
(A) Boerhaavia diffusa (B) Thunbergia coceinea
(C) Aristolichia triangularis (D) Serjania corrugate

4. Recalcitrant seeds are those which:
(A) Remain dormant for long periods (B) Show a high degree of sterity
(C) Require cold treatment for germination (D) Get killed on drying or freezing

5. Which of the following statements about DNA is wrong?
(A) Diameter of DNA is constant
(B) Amount of DNA is constant per haploid set of chromosomes in cells of a species
(C) There are three hydrogen bonds between adenine and thymine, and two hydrogen
bonds between guanine and cytosine
(D) DNA invariably contains equivalent amounts of purines and pyrimidines

6. Which of the following is common in India and is not a rooted aquatic fern?
(A) Salvia (B) Pilularia
(C) Marsiles (D) Regnellidium

7. Manila hemp is obtained from:
(A) Crotolaria juncea (B) Cannabis sativa
(C) Musa textilis (D) Hibiscus cannabinus

8. In Malvaceae, epicalyx is absent in:
(A) Hibiscus (B) Malva
(C) Sida (D) Malvastrum

9. The insecticide pyrethrin is obtained from:
(A) Nicotiana rustica (B) Ageratum conyzoides
(C) Azadirachta indica (D) Chrysanthemum cinerariafolium

10. Total number of series in Bentham and Hooker’s system of classification is
(A) 9 (B) 15 (C) 21 (D) 18

11. Cystolyth is made up of:
(A) Calcium oxalate (B) Inulin
(C) Silica (D) Calcium carbonate

12. Which part of moss capsule is haploid?
(A) Calyptra (B) Operculum
(C) Annulus (D) Columella

Page 46

13. Who gave Bubble diagram showing probable relationship between different sub classes
and sub-order of dicotyledons?
(A) Arthur Cronquist (B) G. Bentham & J.D. Hooker
(C) Armen Takhtajan (D) John Hutchinson

14. “Tiger project” in India is financed by:
(A) International Union of Conservation of Nature and Natural resources
(B) World Wildlife Fund
(C) World Forest Department
(D) Indian Board of Wildlife

15. In a biochemical pathway controlling the pigmentation of leaves two independently
assorting wild type alleles of genes A and B encode enzymes as shown below, mutant
alleles a and b produce non functional proteins
A B
↓ ↓
X-------------------------------→ Y----------------------------→Z
White substrate Yellow intermediate Green Product
What is the expected progeny after selfing AaBb
(A) Green 9: white 4: yellow 3 (B) Green 9: yellow 4: white 3
(C) Green 12: yellow 3: white 1 (D) Green 9: White 7

16. Algal bloom in a pond ecosystem is an example of:
(A) Antagonism (B) Ammensalism
(C) Parasitism (D) Commensalism

17. Fragrant flowers with well developed nectarines are adapted for:
(A) Anemophily (B) Zoophily
(C) Hydrophily (D) Entomophily

18. The stage of lysogenic cycle where the viral DNA segment is integrated into a host cell
genome is called as
(A) Lytic phage (B) Lysogenic phage
(C) Prophage (D) Bacteriophage
19. Endosperm in gymnosperm is formed:
(A) At the time of fertilization (B) Before fertilization
(C) After fertilization (D) Alongside the development of embryo
20. Select the fungal groups belonging to Basidiomycetes:
(A) Morchella and Mushrooms (B) Birds nest fungi and Puffballs
(C) Puffballs and Claviceps (D) Peziza and Stinlhorns
21. Receptor mediated endocytosis from plasma membrane requires which one of the
following coat protein?
(A) Clathrin (B) Arrestin (C) Glycophori (D) Adaptin

22. Water held tightly by soil particles around them is known as:
(A) Field capacity (B) Runway water
(C) Hygroscopic water (D) Chemically combined water
(2)

Page 47

23. In vacuole, Ca is frequently precipitated as insoluble:
(A) Sulphate (B) Oxalates (C) Carbonates (D) Silicate

24. Wheat rust spreads from barberry to wheat plants by:
(A) Uredospores (B) Teliospores (C) Basidiospores (D) Aeciospores

25. ‘Stylopodium’ is found in:
(A) Foeniculum (B) Cucumis (C) Lathyrus (D) Triticum

26. C3 cycle represents which of the following reaction?
(A) Reductive carboxylation (B) Oxidative carboxylation
(C) Salt respiration (D) Substrate level phosphorylaton

27. The bryophyte, Radula may occur as:
(A) Psammophyte (B) Parasite
(C) Epiphyllous (D) Sporophyte

28. Which of the following statement is correct?
(A) Blue light causes phototropism (B) Auxin movement is non-polar
(C) TIBA is not an antiauxin substance (D) ABA is transported only through phloem

29. Digitoxin, a steroid glycoside obtained from digitalis is prescribed for:
(A) Liver ailments (B) Heart ailments
(C) Kidney ailments (D) Nerve ailments

30. Who introduced the concept of binomial nomenclature?
(A) Gaspard Bauhin (B) Carolus Linnaeus
(C) Bentham & Hooker (D) A. Engler & Karl A. Prantl

31. Which of the following phytohormones play a role in seed dormancy?
(A) Gibberellins (B) ABA (C) Cytokinin (D) Auxins

32. Which of the alkaloid does not contain nitrogen in heterocyclic ring?
(A) Ephedrine (B) Nicotine (C) Morphine (D) Quinine

33. What is tropism?
(A) An internal chemical signal that controls a plant’s growth and development
(B) A movement in response to an external stimulus
(C) A movement in response to light stimulus
(D) A pigment that absorbs light and affects seed germination.

34. Monocarpic plant:
(A) Has only one carpel (B) Produces one seed
(C) Flowers once in life (D) Produce one fruit

35. Which of the following is not a viral disease?
(A) Tobacco Mosaic (B) Red rot of sugarcane
(C) Leaf curl of papaya (D) Tristeza disease of Citrus

(3)

Page 48

36. Which is highly poisonous fungus called ‘Poison cup”?
(A) Clavatia (B) Amanita (C) Polyporus (D) Geaster

37. Banana gets destroyed when kept in refrigerator because of:
(A) Chilling stress (B) Freon gas pollination stress
(C) Osmotic stress (D) Water stress

38. Filaments of Ulothrix are:
(A) Unbranched (B) Branched
(C) Brick-shaped (D) Girdle-shaped

39. Which one of the following is the main cause of photochemical smog?
(A) Environmental conditions favouring excessive evaporation resulting in smog
formation in the morning
(B) Nitrogen oxides and hydrocarbons in the air exposed to ultraviolet light
(C) Increase in atmospheric carbon dioxide concentration leading to greenhouse effect
(D) Carbon dioxide acting as nuclei for water droplet formation
40. Gynobasic style is found in:
(A) Lamiaceae (B) Poaceae (C) Liliaceae (D) Asteraceae

41. Richmond-Lang effect is shown by:
(A) Auxins (B) Gibberellins (C) Cytokinins (D) ABA

42. Pollinia occur in:
(A) Citrus (B) Psidium (C) Calotropis (D) Mangifera

43. The gymnosperms differ from angiosperms in:
(A) Habit (B) Habitat
(C) Presence of wood (D) Absence of ovary

44. In C4 plants, phosphoenol pyruvate carboxylase is located in:
(A) Cytosol (B) Mitochondria (C) Peroxysome (D) Chloroplast
45. Which alga is the richest source of proteins?
(A) Porphyra (B) Ulva (C) Rhodymenia (D) Chlorella

46. Which family belongs to Thalamiflorae under polypetalae in Bentham and Hooker’s
classifications?
(A) Cucurbitaceae (B) Malvaceae (C) Leguminosae (D) Asteraceae

47. Nyctinasty occurs due to:
(A) Movement of bulliform cell (B) Differential growth rate
(C) Change in pressure potential (D) Stimulation by light

48. An anticancer substance is obtained from a fungus:
(A) Lycoperdon (B) Clavatia (C) Psaliota (D) Amanita

49. Which among the following is chill-tolerant plant:
(A) Arabidopsis (B) Dieffenbachia (C) Coleus (D) Croton

(4)

Page 49

50. The tallest of moss is:
(A) Buxbaumia (B) Polytrichum (C) Sphagnum (D) Dawsonia

51. Which class of algae show adaptability to extremes of environment?
(A) Chlorophyceae (B) Cyanophyceae (C) Phaeophyceae (D) Rhodophycea

52. Azygospore is:
(A) Haploid (B) Diploid (C) Triploid (D) Sporophyte

53. Spore dissemination in many ferns is affected by:
(A) Indusium (B) Annulus (C) Sorus (D) Tapetum

54. Which of the following hormones plays dual role of a plant growth regulator and an
important signalling agent in plant defense responses?
(A) Ethylene (B) Brassinosteroids
(C) Jasmonic acid (D) Cytokinins

55. Canada balsam is obtained from:
(A) Pinus (B) Cedrus (C) Abies (D) Cupressus

56. Funaria is included in bryophytes because:
(A) Sporophytes is attached to gametophyte
(B) It has heteromorphic alternation of generations
(C) It lacks roots
(D) It lacks xylem

57. The distinctive diurnal fluctuation in acidity shown by CAM plants in pre-dominantly
due to the changes in the amounts of:
(A) Cytosolic citric acid (B) Vacuolar malic acid
(C) Cytosolic malic acid (D) Vacuolar citric acid

58. Root like character of rhizophore is not:
(A) Positively geotropic (B) Colourless without nodes and internodes
(C) Monostelic condition (D) Exogenous origin

59. In maize and banana inflorescence is:
(A) Spadix (B) Spike (C) Catkin (D) Corymb

60. Ovule in gymnosperm is generally:
(A) Anatrophic and bitegmic (B) Orthotropous and bitegmic
(C) Orthotropous and Unitegmic (D) Anatropous and unitegmic

61. Pin mould is:
(A) Yeast (B) Rhizopus (C) Penicillium (D) Aspergillus
62. Pycnoxylic wood is:
(A) Compact and hard (B) Soft and Loose
(C) Porous (D) Thick

(5)

Page 50

63. ‘Air gun mechanism’ of spore dispersal occurs in:
(A) Riccia (B) Marchantia (C) Funaria (D) Sphagnum

64. ‘Red wood of China’ is:
(A) Pinus roxburghii (B) P. longifolia
(C) Dalbergia (D) Sequoia

65. Which of the following is also known as ‘Kornberg’s enzyme’:
(A) DNA Polymerase-I (B) DNA Polymerase-II
(C) DNA Polymerase-III (D) RNA Polymerase-I

66. Mucilaginous tissues and chlorenchymatous cortex are found in:
(A) Halophytic xerophytes (B) Mesophytes
(C) Epiphytes (D) Insectivorous plants

67. In which of the following the ripened ovary forms an inedible core?
(A) Mangifera indica (B) Pyrus malus
(C) Psidium guajava (D) Cocos nucifera

68. Histogen ‘periblem’ gives rise to:
(A) Vascular tissue and pith (B) Epidermis
(C) Cortex including endodermis (D) Cork

69. Nucleosomes are:
(A) Units of DNA (B) Units of RNA
(C) Units of Protein (D) Units of Chromosome

70. Girdling or removal of a ring of tissue outside the vascular cambium from a tree trunk
kills it because:
(A) Water cannot move up
(B) Food does not travel down and root becomes starved
(C) Shoot becomes starved
(D) Annual rings are not produced

71. ‘Cork of commerce’ is obtained from:
(A) Quercus suber (B) Tectona grandis
(C) Ficus religiosa (D) Pinus roxburghii
72. Lysosomes are the store house of:
(A) Enzymes (B) Hydrolytic enzymes
(C) Proteins (D) Fats
73. Which of the following are plants of one group?
(A) Mangifera and Rhizophora (B) Rhizophora and Balanophora
(C) Rhizophora and Avicinia (D) Balanophora and Avicinia

(6)

Page 51

74. In an ecosystem in abiotic components which of the following occurs:
(A) Flow of energy (B) Cycling of materials
(C) Consumers (D) Flow of energy and cycling of material

75. Which of the following is source of drying oil?
(A) Arachis hypogea (B) Linum usitatissimum
(C) Cocus nucifera (D) Helianthus annus

x-x-x

Page 52

MSc(HS/2Yr)(Chemistry) (CHEM)
1. How many geometrical isomers are possible for the given compound?

(A) 2 (B) 4 (C) 3 (D) 1

2. The treatment of benzene with benzoyl chloride in the presence of AlCl 3 gives
(A) Benzaldehyde (B) Benzophenone
(C) Diphenyl (D) Cyclohexane

3. Reaction of chlorobenzene with NaNH2/NH3 to form aniline is
(A) An electrophilic substitution (B) Nucleophilic substitution
(C) An addition-elimination reaction (D) An elimination-addition reaction

4. Rank the following species in order of decreasing nucleophilicity in a polar protic solvent
(most least nucleophilic)
O

CH3CH2CO
1 2 3
(A) 3 > 1 > 2 (B) 2 > 3 > 1 (C) 1 > 3 > 2 (D) 2 > 1 > 3

5. Increasing order of dehydration of the following compounds is

I II

III IV
(A)I<II<III<IV (B)II<III<IV<I (C) I<II<IV<III (D)I<IV<II<III

6.

The final product obtained in the given reaction is

H3C Br

(A) (B)

(C) (D)

Page 53

7.

Product is

(A)

(B)

(C)

(D)

8. In the reaction

Here, the final product R is
(A) Acetic acid (B) Cinnamic acid
(C) Adipic acid (D) Propanoic acid

9. When ethyl acetate is heated with sodium ethoxide and then on acidification, it gives ethyl
acetoacetate. This reaction is known as
(A) Aldol condensation (B) Claisen condensation
(C) Wurtz reaction (D) Cannizzaro reaction

10. Phosphamides on hydrolysis gives
(A) Phosphate and amides (B) Phosphates only
(C) Amides only (D) Phosphate and amine
11.

The end product of the above reaction series is

(A) (B) (C) (D)

(2)

Page 54

12. Which one of the following heterocyclic compounds is not aromatic?
(A) Pyridine (B) Pyrrole (C) Furan (D) Piperidine

13. Which one of the following aryl amines undergoes diazotisation most readily?
(A)

(B)

(C)

(D)

14. Consider the following reactions

The name of the reaction and intermediate via which it is known to proceed are respectively
(A) Hunsdiecker and benzyne (B) Sandmeyer and a free radical
(C) Meerwein and a free radical (D) Sandmeyer and a carbanion

15. When adenine is attached to ribose sugar, it is called adenosine. To make a nucleotide from
it, it would require
(A) Oxygenation (B) Addition of a base
(C) Addition of phosphate (D) Hydrogenation

16. The electrophilic aromatic substitution proceeds through a
(A) Free radical (B) Sigma complex
(C) Benzyne (D) Carbene
(3)

Page 55

17. Which of the following protons in the given molecule appear at the highest delta value in
H NMR spectrum?

D C B A
(A) A (B) B (C) C (D) D

18. A compound shows a proton-NMR peak at 240 Hz downfield from TMS peak in a
spectrometer operating at 60 MHz. Then the value of chemical shift (δ) and τ (in ppm)
relative to TMS is
(A) 6 ppm, 4 ppm (B) 4 ppm, 6 ppm (C) 2 ppm, 3 ppm (D) 3 ppm, 2 ppm

19. Which of the following functional groups exhibits the highest frequency in IR spectrum?
(A) Alcohol (B) Aldehyde (C) Nitrile (D) Ester

20. Select the correct IUPAC name for

(A) 4-ethyl-3, 3-dimethylheptane (B) 4-ethyl-4, 3-dimethylheptane
(C) 3-ethyl-3, 4-dimethylheptane (D) 3-ethyl-4, 4-dimethylheptane

21. The given pairs are

and
(A) Enantiomers (B) Diastereomers
(C) Homomers (D) Constitutional isomers
22. When t-butyl carbonium ion combine with hydroxy ion, the mechanism involves
(A) SE2 (B) SN2 (C) SE1 (D) SN1

23. Which one of the following compounds possesses a chiral center?
(A)
H OH

O
(4)

Page 56

(B)

(C)

H Br
(D)

24. Which of the following gives ninhydrin test
(A) Lipid (B) Carbohydrate (C) Vitamin (D) Protein

25. In singlet state of carbene, carbon atom is
(A) sp-hybridised (B) sp3-hybridised (C) sp2-hybridised –(D)sp3d-hybridised

26. A gas obeys the van der Waals equation. It will approach ideality at
(A) High pressures (B) Low values of pV product
(C) Extremely low pressures (D) Low temperatures

27. Which one of the following has the largest band gap
(A) Germanium (B) Silicon (C) Tellurium (D) Diamond

28. The half-life period of any first order reaction
(A) is half the specific rate constant
(B) is independent of the initial concentration
(C) is always the same whatever the reaction
(D) is directly proportional to the initial concentration of the reactant.

29. If the rate of reaction is equal to the rate constant, the order of reaction is
(A) 3 (B) 0 (C) 1 (D) 2

(5)

Page 57

30. The rate of a chemical reaction generally increases rapidly even for small temperature
increase because of rapid increase in the
(A) Collision frequency
(B) Activation energy
(C) Fraction of molecules with energies in excess of activation energy
(D) Average kinetic energy of molecules

31. Which one of the following is temperature dependent?
(A) A (Arrhenius factor) (B) Ea (energy of activation)
(C) k (rate constant) (D) None of these
32. When a gas is subjected to adiabatic expansion, it gets cooled due to
(A) Increase in pressure (B) Loss in kinetic energy
(C) Decrease in velocity (D) Energy spent in doing work

33. Consider the following statements for entropy
(1) It is a state function
(2) It is a path independent function
(3) It is always positive quantity for random process
Which of the statement given above are correct?
(A) 1 and 2 only (B) 2 and 3 only (C) 1 and 3 only (D) 1, 2 and 3

34. Brownian movement is which property of a colloid
(A) Electrical (B) Mechanical (C) Optical (D) Colligative
35. Minimum concentration of electrolyte which can precipitate any sol is
(A) Peptization value (B) Gold number
(C) Avogadro’s number (D) Flocculation value

36. Sorption is the term used when
(A) Adsorption takes place (B) Absorption takes place
(C) Both (A) and (B) (D) Desorption takes place

37. At the equilibrium position in the process of adsorption,
(A) ΔH > 0 (B) ΔH = TΔS (C) ΔH < TΔS (D) ΔH > TΔS

38. When a fresh precipitate is turned black in colloidal form, the process is known as
(A) Dialysis (B) Coagulation (C) Peptization (D) Electro-osmosis

39. The concentration unit independent of temperature would be
(A) Normality (B) Mass volume percent
(C) Molality (D) Molarity

40. In liquid state, the water molecules are associated due to
(A) Viscosity (B) Surface tension
(C) Hydrogen bonding (D) Intrinsic viscosity

41. Which of the following is not covered under van der Waals forces
(A) Dipole-dipole attractions (B) Dipole-induced dipole interactions
(C) London-dispersive forces (D) Ion-dipole forces
(6)

Page 58

42. The relation, dU = TdS – pdVis true for
(A) Reversible process only (B) Reversible adiabatic process only
(C) All processes (D) A reversible cycle only

43. According to Le-Chatelier’s principle, if the heat is given to solid-liquid system, then
(A) Quantity of solid will reduce (B) Quantity of liquid will reduce
(C) Temperature will increase (D) Temperature will decrease

44. The incongruent melting point is also called _____ point.
(A) Triple point (B) Eutectic point
(C) Peritectic point (D) Dissociation point

45. Transport number is
(A) Total current carried by cation or anion
(B) The fraction of the total current carried by cation or anion
(C) Total speed of the cation or anion
(D) Ratio of the charge to the speed of the cation or anion

46. Cell reaction is spontaneous when
(A) E°red is positive (B) ΔG° is (-) ve (C) ΔG° is (+) ve (D) E°red is negative

47. Which is not true about an electromagnetic radiation
(A) The frequency and energy are directly proportional
(B) Energy and wavelength are inversely proportional
(C) Frequency and wavenumber are inversely proportional
(D) Energy is directly proportional to wave number

48. The increase in rotational energy of the molecule results in absorption spectrum
(A) IR region (B) Microwave region
(C) Visible region (D) UV region

49. Identify the intensive quantity from the following:
(A) Enthalpy (B) Temperature (C) Volume (D) Internal Energy

50. Which of the following is the process reverse of a photochemical reaction?
(A) Chemiluminescence (B) Fluorescence
(C) Phosphorescence (D) Photosensitization

51. The angular momentum of an electron is zero. In which orbital, it may be present?
(A) 2s (B) 2p (C) 3d (D) 4f

52. The correct ground state configuration from chromium is
(A) [Ar]3d44s2 (B) [Ar]3d54s1 (C) [Ne]3d54s1 (D) [Ne]3d44s2

53. Na+, Mg2+, Al3+, Si4+ are isoelectronic. Their ionic size will follow the order
(A) Na+> Mg2+> Al3+> Si4+ (B) Na+< Mg2+< Al3+< Si4+
+ 2+ 3+ 4+
(C) Na > Mg < Al < Si (D) Na+< Mg2+> Al3+> Si4+

(7)

Page 59

54. The bond angle decreases in the order
(A) CH4> NH3> H2O (B) CH4< NH3< H2O
(C) CH4> NH3< H2O (D) CH4< NH3> H2O

55. Intramolecular H-bonding is present in
(A) Meta-Nitrophenol (B) Salicylaldehyde
(C) Hydrogen chloride (D) Benzophenone

56. The arrangement of Cl- ions in CsCl structure is:
(A) Hcp (B) Ccp
(C) Body-centered cubic (D) Simple cubic

57. Which of the following has strongest hydrogen bond?
(A) (B)
(C) (D)

58. Heavy water is used in atomic reactor as
(A) Moderator (B) Coolant
(C) Both moderator and coolant (D) Neither coolant nor moderator

59. The amphoteric oxide is
(A) Li2O (B) BeO (C) MgO (D) Cs2O

60. Lithium shows diagonal relationship with
(A) Na (B) Be (C) Mg (D) He

61. Which one of the following carbides is covalent?
(A) CaC2 (B) Al4C3 (C) SiC (D) Be2C

62. XeF6 on hydrolysis gives
(A) XeO3 (B) XeO2 (C) XeO (D) Xe

63. The true statement for 𝑁
(A) It has nonlinear structure
(B) It is called pseudo halogen
(C) The formal oxidation state of nitrogen in this anion is +1
(D) It is isoelectronic with N2O

64. Which of the following is known as inorganic benzene?
(A) Borazine (B) Phosphonitrillic acid
(C) Boron nitride (D) P-dichlorobenzene

65. The element which forms oxides in all oxidation states +1 to +5 is
(A) N (B) P (C) As (D) Sb

(8)

Page 60

66. Among Sc3+, Ti4+, Zn2+ and Cu+ ions are
(A) All diamagnetic (B) All paramagnetic
(C) All ferromagnetic (D) A mixture of all

67. An artificially synthesized element is
(A) Rh (B) Mo (C) Re (D) Tc

68. TiCl4 is a
(A) Bronsted-Lowry acid (B) Bronsted-Lowry base
(C) Lewis acid (D) Lewis base

69. Conjugate base of bicarbonate ion is
(A) CO2 (B) CO (C) HCO (D) H2CO3

70. According to HSAB principle, H+ ion is
(A) Hard acid (B) Soft acid (C) Soft base (D) Hard base

71. The number of unpaired electrons in tetrahedral [Ni(CO)4] complex is
(A) 0 (B) 2 (C) 3 (D) 4

72. Which one of the following is organometallic compound?
(A)
(B)

(C) (D)

73. The oxidation state of Fe in the brown ring complex [Fe(H2O)5(NO)]SO4 is
(A) +3 (B) 0 (C) +2 (D) +1

74. For an octahedral complex, which of the following d-electron configurations will give
maximum crystal field stabilization energy?
(A) High spin d5 (B) Low spin d4 (C)Low spin d5 (D) High spin d7

75. The metal present in chlorophyll is
(A) Mg(II) (B) Ca(II) (C) Zn(II) (D) Fe(II)

x-x-x

Page 61

Masters in Disaster Management (DM)
1. There was forest fire reported in Simlipal wildlife sanctuary in March 2022. It is
located in:
(A) Odisha (B) Karnataka (C) West Bengal (D) Assam

2. There was serious devastation reported from Dima Haso District of Assam in May
2022 due to
(A) Earthquake (B) Mudslides (C) Snow fall (D) Fire

3. Which state cabinet has approved to conduct Caste Census on its own?
(A) Delhi (B) Rajasthan (C) Madhya Pradesh (D) Bihar

4. When is the World Environment Day celebrated?
(A) Jan 26 (B) June 10 (C) June 5 (D) Oct 24

5. Which of the following states does not have coast?
(A) Odisha (B) Goa (C) Telangana (D) Gujarat

6. The point inside the earth where earthquake triggers is called
(A) Focus (B) Epicenter (C) Centroid (D) Geocentre

7. How many seismic zones are there is India?
(A) Two (B) Three (C) Four (D) Five

8. Which of the following is a greenhouse gas that traps heat, gradually causing global
warming?
(A) Hydrogen (B) Nitrogen (C) Carbon Dioxide (D) Methane

9. Kutch is in the
(A) East of Gujarat (B) West of Gujarat
(C) South East of Gujarat (D) South of Gujarat

10. The territorial water of India extends into the sea to a distance of ______ nautical
miles measure from the appropriate base line.
(A) 12 (B) 15 (C) 250 (D) 7

11. Prime Minister of India is the head of NDMA, the apex body for disaster
management, as
(A) Chairman (B) President (C) Governor (D) CEO

12. Which of the following is incorrectly matched?
(A) Kudremukh: Karnataka (B) Bailadila: Chattisgarh
(C) Kurnool: Tamil Nadu (D) Panna: Madhya Pradesh

13. Which of the following is not a vaccine for Covid 19?
(A) Covishield (B) Sinovac (C) Corilvax (D) Covaxin

14. Which of the following state is not crossed by tropic of cancer?
(A) Rajasthan (B) Chattisgarh (C) Manipur (D) Madhya Pradesh

Page 62

15. Lake Chilika is located in
(A) Odisha (B) Andhra Pradesh (C) Rajasthan (D) West Bengal

16. Match the following.

Places State
(i) Riasi a. Odisha
(ii) Koraput b. Assam
(iii) Digboi c. West Bengal
(iv) Asansol d. Jharkhand
e. Jammu & Kashmir
(i) (ii) (iii) (iv)
(A) e a b d
(B) d a b e
(C) e a b c
(D) e c b a

17. Which of the crops is best suited for black soil?
(A) Wheat (B) Paddy (C) Cotton (D) Jute

18. Which of the following is the innermost layer of earth?
(A) SIAL (B) SIMA (C) NIFE (D) Lithosphere

19. CFCs stand for
(A) Central Forensic Centres (B) Chlorofluorocarbons
(C) Chlorine Fluorine Compounds (D) Combined family of carbons

20. The standard atmospheric pressure at sea is
(A) 900 mb (B) 1000 mb (C) 1013 mb (D) 1023 mb

21. The rate of decline in temperature with altitude in the troposphere is:
(A) 6.5  C per 100 m (B) 6.5  C per 1000 m
(C) 6.5  C per 10 m (D) 6.5  C per 100 km

22. Tuticorin is in
(A) Tamil Nadu (B) Andhra Pradesh
(C) Kerala (D) Odisha
23. Anemometer is used for measuring:
(A) Humidity (B) Precipitation
(C) Atmospheric pressure (D) Wind speed

24. Which of the following is not a planetary wind?
(A) Trade wind (B) Westerlies (C) Polar winds (D) Monsoon
25. Palk Strait is between
(A) India and Pakistan (B) Pakistan and Iran
(C) India and Sri Lanka (D) India and Bangladesh

(2)

Page 63

26. Which of the following nuclear plants (including proposed) is incorrectly matched?
(A) Kudankulam Tamil Nadu
(B) Tarapur Maharashtra
(C) Jaitapur Karnataka
(D) Gorakhpur Haryana

27. Shifting cultivation is called
(A) Jhuming (B) Sedentary (C) Extensive (D) Commercial

28. Which of the following is a surface wave?
(A) L (B) P (C) S (D) Push waves

29. Which of the following spectral ranges denote visible light?
(A) 0.2 to 0.5 um (B) 0.4 to 0.7 um (C) 0.4 to 0.8 um (D) 0.2 to 0.7 um

30. Which one of the following is referred to as India Standard Time Meridian:
(A) 82° 30ʼ (B) 82° 30ʼ E longitude
(C) 82° 30ʼ W longitude (D) 6° longitude

31. Glasgow where COP 26 meeting was held is in
(A) USA (B) Germany (C) Italy (D) UK

32. Which of the following is the easternmost place in India?
(A) Nasik (B) Gangtok (C) Imphal (D) Guwahati

33. Uttarakhand, Uttar Pradesh, Bihar, West Bengal and Sikkim have common frontiers
with
(A) China (B) Nepal (C) Bhutan (D) Myanmar

34. If you intend to visit Kavarati during your summer vacations, which one of the
following Union Territories of India you will be going to
(A) Puducherry (B) Andaman and Nicobar
(C) Lakshadweep (D) Diu and Daman

35. A person visited Manila. What was the country he visited?
(A) Bhutan (B) Bangladesh (C) Thailand (D) Philippines

36. Atal Tunnel is in
(A) Himachal Pradesh (B) Arunachal Pradesh
(C) Sikkim (D) Uttarkhand

37. Which of the following peaks is not in Himalayas?
(A) Everest (B) Guru Sikhar (C) Kanchenjunga (D)Namcha Burwa

38. Barren Island is
(A) Bay of Bengal (B) Arabian Sea (C) Indian Ocean (D) Pacific Ocean

(3)

Page 64

39. Which of the following colours is not used by IMD for weather warnings?
(A) Yellow (B) Orange (C) Red (D) Pink

40. Which of the following is a tribal majority state?
(A) Himachal Pradesh (B) Manipur
(C) Arunachal Pradesh (D) Tripura

41. In which of the following states is the Konark Temple located?
(A) Rajasthan (B) Punjab (C) Uttar Pradesh (D) Odisha

42. The river Narmada has its source at
(A) Satpura (B) Amarkantak
(C) Brahmagiri (D) Slopes of the Western Ghats

43. Which one of the following lakes is a salt water lake?
(A) Sambhar (B) Wular (C) Dal (D) Gobind Sagar

44. Which one of the following is the longest river of the Peninsular India?
(A) Narmada (B) Godavari (C) Krishna (D) Mahanadi

45. Which one amongst the following rivers flows through a rift valley?
(A) Mahanadi (B) Krishna (C) Tungabhadra (D) Tapi

46. Which one of the following type of resource is iron ore?
(A) Renewable (B) Flow (C) Biotic (D) Non-
renewable

47. Under which of the following type of resource can tidal energy be put?
(A) Replenishable (B) Abiotic (C) Human-made (D) Non-
recyclable

48. Ramshar, popular for Convention on Wetlands is in
(A) Indonesia (B) Iran (C) UAE (D) Jordon

49. In which one of the following states is terrace cultivation practised?
(A) Punjab (B) Haryana
(C) Plains of Uttar Pradesh (D) Uttarakhand

50. In which of the following states is black soil found?
(A) Jammu and Kashmir (B) Rajasthan
(C) Gujarat (D) Jharkhand

51. Which of the following places was under France?
(A) Pondicherry (B) Goa (C) Bhopal (D) Ahmedabad

52. Komagata Maru was the name of a
(A) Ship (B) Temple (C) Country (D) Lake

(4)

Page 65

53. India's National Forest Policy 1988 aims at maintaining _____of the
geographical area in hills and mountains under forest
(A) one third (B) two third (C) three fourth (D) one fifth

54. Which of the following is the first state in India which has made roof top rainwater
harvesting structure compulsory to all the houses across the state?
(A) Tamil Nadu (B) Kerala (C) Gujarat (D) Punjab

55. In the first century B.C. Allahabad had sophisticated water harvesting system
channeling the flood water of the river Ganga at
(A) Kampti (B) Shringaverapura (C) Koshi (D) Gorakhpur

56. According to Falkenmark, a Swedish expert, water stress occurs when water
availability is between
(A) 1,000 and 1,600 cubic meter per person per year
(B) 2000 and 2500 cubic meter per person per year
(C) 100 and 250 cubic meter per person per year
(D) 1600 and 2500 cubic meter per person per year

57. The total volume of world’s water estimated to exist as oceans, seas and bays is
(A) 75 per cent (B) 78 per cent (C) 96.5 per cent (D) 90.5 per cent

58. Tsunami is a
(A) Japanese word (B) Greek word (C) Roman word (D) Arabic word

59. Dadar and Nagar Haveli and Daman and Diu have been merged to form a
(A) State (B) Union Territory (C) Capital Region (D) Metropolitan

60. UN Sustainable Development Goals are
(A) 8 (B) 15 (C) 17 (D) 21

61. As per Human Development Report 2021, 2022, India’s rank is
(A) 121 (B) 131 (C) 145 (D) 123

62. Which of the following is not a QUAD member?
(A) India (B) Australia (C) UK (D) USA

63. Which of the following is the most dominant gas in the atmosphere?
(A) Hydrogen (B) Oxygen (C) Carbon dioxide (D) Nitrogen

64. La Nina is associated with
(A) Industries (B) Monsoon (C) Satellites (D) Cyclones

65. Phailin cyclone derives its name from a
(A) Thai word (B) Burmese word (C) Bengali word (D) Sanskrit word

66. Tribhuvan International Airport is in
(A) India (B) Indonesia (C) Nepal (D) Bhutan

(5)

Page 66

67. If it is lunar eclipse, which one is correct?
(A) Earth is between Moon and Sun (B) Sun is between Earth and Moon
(C) Moon is between Earth and Sun (D) Earth, Sun and Moon form a right angle

68. International Date Line is
(A) 180 degree Longitude (B) 90 degree Longitude
(C) 90 degree Latitude (D) 0 degree Longitude

69. Which of the following is a marsupial?
(A) Kangaroo (B) Camel (C) Lion (D) Parrot

70. As per Union Cabinet decisions, the percentage of ethanol in petrol with effect from
April 1, 2023 in India will be
(A) 5 (B) 10 (C) 15 (D) 20

71. Carbon monoxide affects
(A) Oxygen carrying capacity of blood (B) Skin
(C) Bones (D) Eye sight

72. Which of the following is a disease caused by deficiency of vitamin C?
(A) Cholera (B) Typhoid (C) Scurvy (D) Diarrhea

73. Monkeypox is an infectious
(A) Viral disease (B) Bacterial disease
(C) Protozoa Disease (D) Food Poisoning Disease

74. Which of the following is a para- military force in India?
(A) Army (B) Navy (C) ITBP (D) Air Force

75. Which app is used for monitoring of COVID cases in India?
(A) Jan Setu (B) Aarogya Setu (C) Gandhi Setu (D) Ram Set

x-x-x

Page 67

M.A. (Economics) (ECO)
1. Who defined economics as “Economics is a study of mankind in the ordinary business of life.”
(A) Keynes (B) Joseph Stiglitz (C) Marshall (D) J.B. Say

2. “An Enquiry into the Nature and Causes of the Wealth of Nations” is the classic work of
(A) Karl Marx (B) A. Marshall (C) A.C. Pigou (D) Adam Smith

3. As long as the principle of diminishing marginal utility is operating, any increased consumption
of a good
(A) Lowers total utility
(B) Produces negative total utility
(C) Lowers marginal utility and therefore total utility
(D) Lowers marginal utility but may raise total utility

4. If Isoquants are drawn at right angles
(A) The two inputs are perfect substitutes for each other
(B) The MRTS is constant
(C) The inputs must be used in fixed proportions
(D) None of the above

5. At the point where a straight line from the origin is tangent to the TC curve, AC
(A) Is minimum (B) Equals MC (C) Equals AVC+AFC (D) All of these

6. The Kinked Demand Curve Theory was an initial attempt to explain
(A) Rigid prices (B) Liquid prices (C) Fixed prices (D) None of these

7. In a perfectly competitive market a typical firm attains equilibrium when
(A) MR=MC with MC falling (B) MC=MC with MC constant
(C) MR=MC with MC rising (D) MR=MC with AC falling

8. When a monopolist sells his product to different customers at different prices, it is a case of
(A) Duopoly (B) Oligopoly
(C) Discriminating monopoly (D) Perfect competition

9. One of the earliest theories of rent was given by
(A) Marshall (B) Adam Smith (C) Robbins (D) Ricardo

10. According to Joseph Schumpeter economic profits arise because of
(A) Monopoly power of the firm (B) Successful innovations by the entrepreneurs
(C) Uncertainty of future (D) Managerial efficiency

11. The term ‘macro’ has been derived from _________
(A) Greek word ‘makros’ which means large
(B) English word ‘makros’ which means large
(C) Greek word ‘makros’ which means small
(D) French word ‘makros’ which means large

Page 68

12. Classical views on labour market equilibrium are based on
(A) Say’s law of market (B) Perfect wage-price flexibility
(C) Perfect competition in the market (D) All of these
13. The investment which is undertaken independently of the level of income is
(A) Autonomous Investment (B) Induced Investment
(C) Public Investment (D) Private Investment
14. According to Keynes’ psychological law of consumption,
(A) Consumption decisions of the households are interdependent
(B) The APC remains fixed as income increase, and APC is equal to MPC
(C) The APC decreases as income increases , and APC is greater than MPC
(D) The APC increases as income increases, and APC is smaller than MPC
15. Given the stock of money, if the liquidity preference function for a given level of income shifts
upward it will lead to
(A) Decrease in the rate of interest for a given level of income
(B) Rise in the rate of interest for a given level of income
(C) No change in the rate of interest for a given level of income
(D) None of the above
16. The rate of discount (r) which equalizes the present value of the prospective yield of an asset
with its supply price is known as
(A) Prospective income
(B) Marginal Efficiency of Investment
(C) Prospective yield
(D) Marginal Efficiency of Capital
17. Higher the value of MPC
(A) Lower will be the value of multiplier
(B) Higher will be the value of multiplier
(C) No effect on the value of multiplier
(D) None of the above
18. In trade/ business cycle, the cycles follow the sequence
(A) Prosperity or boom → recession → depression or slump and then → recovery
(B) Prosperity or boom → depression or slump → recession and then → recovery
(C) Depression or slump → recession → recovery and then → prosperity or boom
(D) Recovery → depression or slump → recession and then → prosperity or boom

Page 69

19. According to Keynes money is demanded for
(A) Transaction and precautionary purpose only
(B) Speculative purpose only
(C) Both (A) and (B)
(D) Neither (A) nor (B)
20. Which of the following is not a tool of monetary policy
(A) Exchange rate (B) Interest rate
(C) Open market operations (D) Reserve requirements
21. The emphasis on public sector to “attain commanding heights of the economy” was laid in the
(A) Tenth Five Year Plan (B) Second Five Year Plan
(C) IPR, 1956 (D) Both (B) and (C)

22. Planning Commission of India was replaced by
(A) Finance Commission (B) Competition Commission
(C) MRTP Commission (D) NITI Aayog
23. Green Revolution in India resulted in
(A) Food self-sufficiency (B) Environmental degradation
(C) Increase in productivity (D) All of these

24. Flagship programme of Government of India providing minimum 100 days of guaranteed
employment is
(A) National Rural Employment Programme
(B) Employment for poor
(C) Integrated Rural Development Programme
(D) Mahatma Gandhi National Rural Employment Guarantee Act, 2005

25. Pre-reform trade policy of India focussed on
(A) Import substitution (B) No tariffs
(C) Free trade (D) Agri - development
26. GST in India was implemented in
(A) 2010 (B) 1991 (C) 1951 (D) 2017
27. The main focus of Competition Act of India is on
(A) Abuse of dominant position (B) Regulation of combinations
(C) Competition advocacy (D) All of these

28. Which of the following is NOT a part of the federal structure in India
(A) Panchayati Raj Institutions and Urban Local Bodies
(B) Central Government
(C) State Governments
(D) Media
29. Consumer Protection Act currently applicable was enacted in
(A) 2019 (B) 2004 (C) 1991 (D) 1986

30. Outward FDI was facilitated after the adoption of
(A) FERA (B) MRTP (C) Economic Reforms (D) SEBI

31. Which is the best measure of economic development
(A) Per capital income (B) Human Development Index
(C) Physical Quality of Life index (D) Gross domestic product

Page 70

32. Who developed Physical Quality of Life Index?
(A) Amartya Sen (B) Morris D Morris
(C) Mahbub ul Haq (D) Simon Kuznets
33. Disguised unemployment means
(A) Zero marginal productivity of labour (B) Zero total productivity of labour
(C) Zero average productivity of labour (D) None of these
34. The theory of Vicious Circles of poverty was given by
(A) A. W. Lewis (B) J. Schumpeter (C) R. Nurkse (D) W.W. Rostow
35. The Gini index value = 1 represents
(A) Low inequality (B) Maximum inequality
(C) No inequality (D) 1% inequality
36. Which of the following is correct
(A) Critical minimum efforts: David Ricardo
(B) Invisible hands: Thomas Malthus
(C) Effective demand: Alfred Marshall
(D) Surplus value: Karl Marx.

37. The use of capital-output ratio for development planning was inspired by
(A) Harrod-Domar model (B) Solow's model
(C) Kaldor's model (D) Rodan model

38. Which of the following is not correctly matched?
(A) Big-push strategy: Rosenstein- Rodan
(B) Development with unlimited supplies of labour: A. Lewis
(C) Critical minimum strategy: Harvey Leibenstein
(D) Balanced growth theory: A.O. Hirschman

39. Amartya Sen defines poverty as
(A) Lack of material well-being
(B) Failure to achieve basic capabilities
(C) Lack of minimum income
(D) Lack of religious and cultural participation

40. The relationship between economic development and income inequality is explained by
(A) Kuznets inverted U shape curve (B) Indifference curve
(C) Pareto optimality (D) Marginal distribution of income
41. Find the derivative of Y = X3/4
(A) X1/4 (B) / (C) X-4 (D) X-1/4

42. A set consisting of only one element is called a _____ set.
(A) Universal (B) Null (C) Unit (D) Finite

43. A function [say Y= f(X)] expressed directly in terms of the dependent variable X is said to be
______ function.
(A) An explicit (B) Polynomial (C) An implicit (D) Finite

(4)

Page 71

44. If for Demand function q = 100 - 4p - 2p2 at price p = 2, the price elasticity of demand is 0.29
then demand is said to be
(A) Inelastic (B) Elastic
(C) Proportional to price (D) Perfectly elastic
2 0 0
45. A = 0 2 0 is _____Matrix.
0 0 2
(A) Skew-symmetric (B) Identity (C) Scalar (D) Null

46. Typist A can type a letter in 5 minutes, typist B in 10 minutes and typist C in 15 minutes. What
is the average number of letters typed per hour per typist?
(A) 7.23 (B) 7.53 (C) 7.33 (D) 7.43

47. The coefficient of correlation between two variables X and Y is 0.38. Their covariance is 10.2.
The variance of X is 16. Find standard deviation of Y.
(A) 6.80 (B) 6.71 (C) 6.81 (D) 6.61

48. Fisher’s price index is
(A) Geometric mean between Laspeyres (L) and Paasche (P) index
(B) Arithmetic mean between L and P
(C) Weighted average of L and P
(D) None of the above

49. Given the numbers 2,6,1,5,3,7,2, a moving average of order 3 is given by
(A) 3,4,3,5,4 (B) 3,2,3,5,4 (C) 6,5,7,1,2 (D) 2,3,4,5,6

50. Estimation of a value within the given range of the series is called
(A) Extrapolation (B) Interpolation
(C) Binomial expansion (D) Central value

51. The following is a function of econometrics
(A) To test economic theories or hypotheses
(B) To provide numerical estimates of the coefficients of economic relationships
(C) To forecast the events
(D) All of the above

52. Type I error in testing of hypotheses is
(A) Reject a true hypothesis (B) Accept a true hypothesis
(C) Accept a false hypothesis (D) Reject a false hypothesis

53. BLUE is
(A) Best Logical Universal Estimate (B) Best Loglinear Unbiased Estimator
(C) Best Linear Unbiased Estimator (D) Basic Linear Unbiased Estimator

54. The ratio of explained variations to total variation is known as
(A) Sum of squares due to regression (B) Coefficient of correlation
(C) Coefficient of determination (D) Residual sum of square

(5)

Page 72

55. An assumption about the classical Linear Regression Model (OLS) is
(A) The random error term u is normally distributed
(B) The expected value of the error term is zero
(C) The value which the error term assumes in one period is uncorrelated to its value in any
other period
(D) All of the above

56. The BLUE properties of the OLS estimator are often referred to as
(A) Durbin-Watson Test (B) Gauss-Markov Theorem
(C) Chi-Square Test (D) Type-II error

57. If the assumption that the variance of the error term is constant for all observations does not
hold, it is the problem of
(A) Multicollinearity (B) Auto-correlation
(C) Heteroscedasticity (D) None of these

58. Autocorrelation is common in
(A) Panel data (B) Time series analysis
(C) Cross section data (D) F test

59. The problem of multicollinearity can be corrected/reduced by
(A) Extending the size of the sample data
(B) Using a priori information
(C) Transforming the functional relationship
(D) All of these

60. A statistic used to test hypothesis about a single population parameter is
(A) F statistic (B) T statistic
(C) Chi-square statistic (D) Durbin Watson statistic

61. Vertical integration refers to a firm aiming at
(A) Higher scale economies in an industry
(B) Operating in two or more industries with input output relationship
(C) Operating in two or more unrelated industries
(D) Product differentiation

62. The concept of product differentiation was proposed by
(A) E. Chamberlin (B) A.C. Pigou (C) Paul Sweezy (D) None of these
63. The following is not a stage of agricultural development as suggested by Mellor
(A) Traditional agriculture
(B) Technologically stagnant agriculture with high capital technology
(C) Technologically dynamic agriculture with high capital technology
(D) All of these
64. According to Schultz, solution to the problem of transformation of traditional agriculture into
modern agriculture is
(A) Making new investments in agriculture
(B) Making famers cooperatives
(C) Creating new business integrations opportunities
(D) All of these
(6)

Page 73

65. Classical Theory of International Trade is known as
(A) Heckscher-Ohlin Theorem (B) Theory of Comparative Cost Advantage
(C) Ohlin’s Theory (D) Factor-Endowment Theory

66. Some methods of protection include
(A) Tariffs (B) Quotas (C) Subsidies (D) All of these

67. Goods and Services Tax is
(A) A direct tax (B) An indirect tax
(C) Excise duty (D) None of these

68. Public debt is an instrument of
(A) Monetary policy (B) Fiscal policy
(C) Industrial policy (D) Defence policy

69. The main function of commercial banks is to
(A) Give reference for their customers
(B) Issue letters of credit
(C) Make arrangement of lockers for the safe custody of valuable assets of their
customers such as gold, silver, legal documents etc.
(D) Accept deposits from the public and advance them loans
70. Based on Fisher’s exposition of Quantity Theory of Money
(A) If money supply is doubled, the prices will also be doubled
(B) If money supply is doubled, the prices will remain constant
(C) If money supply is doubled, the prices will be halved
(D) If money supply is doubled, the prices will fall
71. Spot the odd one out
(A) Carrot (B) Turnip (C) Potato (D) Lemon
72. Parts:strap :: wolf:?
(A) animal (B) fox (C) flow (D) tree
73. Which word does NOT belong with the others?
(A) Index (B) Glossary (C) Chapter (D) Book
74. What number should be the next in the series: 2,1,1/2,1/4,…..
(A) 3 (B) 4 (C) 1/8 (D) 3/5
75. At the baseball game, Henry was sitting in seat 253.
Marla was sitting to the right of Henry in seat 254. In the seat to the left of Henry was
George. Inez was sitting to the left of George. Which seat is Inez sitting in?
(A) 251 (B) 254 (C) 255 (D) 256

x-x-x

Page 74

MSc(2Yr)(Environment Science) (ENV)

1. The stratospheric ozone is considered as a friend of living being. The thickness of this
layer is measured in
(A) Candela (B) Dobson (C) Watts (D) Decibel

2. Crude oil can be categorized as either "sweet crude" where the ________content less
than 0.5%
(A) Sulphur (B) Carbon (C) Hydrogen (D) Nitrogen

3. The Pb-Zn mineralization in Zawar belt in India, is mainly confined to the
(A) Schist rocks (B) Sandstone rocks
(C) Dolomite rocks (D) Slate rocks

4. ‘The Cartegena Protocol’ relates to safe use, transfer and handling of
(A) Radioactive substances (B) Dead Modified Organisms
(C) Living Modified Organisms (D) Toxic Substances

5. The appearance of colour in solid alkali metal halides is generally due to
(A) Schottky defect (B) Frenkel defect
(C) Interstitial positions (D) F-centres

6. Maxwell’s equations relate to _______.
(A) Law of gravitation (B) Basic laws of electricity and
magnetism
(C) Laws of electrostatics (D) Laws of Nuclear fission

7. The Red List of IUCN provides the list of which of the following?
(A) Threatened Species (B) Genetically Modified Species
(C) Indigenous Species (D) Endangered species

8. The Richter’s scale used to record earthquake intensity is a
(A) Parabolic Scale (B) Logrithmic Scale
(C) Geometric Scale (D) Linear Scale

9. Which of the following is NOT a component of sustainable agriculture?
(A) Social Justice (B) Environmental health
(C) Economic profitability (D) Social & economic equality

10. Our bone and teeth are generally made up of
(A) Aragonite (B) Calcium sulphate
(C) Calcium oxalate (D) Calcium phosphate

11. Which of the following is the only mineral component of chlorophyll?
(A) Calcium (B) Magnesium (C) Hydrogen (D) Carbon

12. Which of the following are the most abundant rocks found on the crust of the earth?
(A) Sandstone and limestone (B) Basalt and Granite
(C) Limestone and gypsum (D) Gypsum and shale

Page 75

13. Nuclear transmutation is
(A) Conversion of solid directly into gas
(B) Conversion of a nucleated human nerve cell into a non-nucleated one
(C) Conversion of one chemical element or isotope into another
(D) Conversion of gas directly into solid

14. Consider the following statements
Assertion (A): An enzyme is basically a protein which acts like a catalyst in the
metabolic reactions of an organism.
Reason (R): The pancreatic juice is basically composed from three enzymes trypsin,
amylase and lipase.
(A) A is true, but R is false.
(B) A is false, but R is true.
(C) A and R is correct and R is the correct explanation of A.
(D) Both A and R is true, but R is not the correct explanation of A.

15. Ethnocentrism refers to
(A) The belief in the inherent superiority of one’s own ethnic group or culture
(B) Appreciating cultural traits of other people
(C) The tendency of a cultural group to uphold and sustain traditional culture
(D) The attempt to modernize traditional culture

16. The difference between polar and equatorial diameter of earth is
(A) 23 km (B) 33 km (C) 43 km (D) 53 km

17. Arrange the following pond ecosystem zones, staring from the bottom to top
1. Benthic Zone
2. Limnetic Zone
3. Littoral Zone
4. Profundal Zone
(A) 1-2-3-4 (B) 4-3-2-1 (C) 1-4-2-3 (D) 1-2-4-3

18. River piracy is a feature which is more active in its _________ stage.
(A) Incipient (B) Mature (C) Youth (D) Old
19. Consider the following statements:
Assertion (A): Human diet should compulsorily contain glycine, serine and tyrosin.
Reason (R): Essential amino acids cannot be synthesized in the human body.
(A) A and R are correct and R is the correct explanation of A
(B) Both A and R are true, but R is not the correct explanation of A
(C) A is true, but R is false
(D) A is false, but R is true

20. Consider the following statements
1. The winds which blow between 30o N and 60o S latitudes throughout the year are
known as westerlies.
2. The moist air masses that cause winter rains in North-Western region of India are
part of westerlies.
Which of the statements given above is/are correct?
(A) 1 only (B) 2 only
(C) Both 1 and 2 (D) Neither 1 nor 2

Page 76

21. From which part of the plant is ‘clove’, a commonly used spice, obtained?
(A) Root (B) Stem (C) Fruit (D) Flower bud

22. Which of the following is the force required to move a body uniformly in a circle?
(A) Centripetal (B) Centrifugal (C) Linear (D) Frictional

23. Estuaries possess distinct blooms excessive growth of pigmented diano-flagellates.
These blooms are referred to
(A) Blue tides (B) Green tides (C) Red tides (D) Yellow tides

24. The time taken by the earth to complete one rotation about its axis with regard to a fixed
star is called
(A) Sedrial day (B) Tropical day (C) Solar day (D) Stellar day
25. Which of the following layer of atmosphere is responsible for the deflection of radio
waves?
(A) Troposphere (B) Stratosphere (C) Mesosphere (D) Ionosphere
26. The sum of three numbers is 98. If the ratio of first number to second is 2:3 and that of
second to third is 5:8; the second number is
(A) 26 (B) 30 (C) 48 (D) 50

27. Which of the following formation neither contains water nor transmits water?
(A) Aquifer (B) Aquitard (C) Aquiclude (D) Aquifuge

28. What is the apparent weight of a person when the elevator is accelerated downwards?
(A) Greater than the actual weight (B) Less than the actual weight
(C) Same as the actual weight (D) Zero

29. India’s first national park, Hailey National Park is now known as
(A) Nokrek Biosphere Reserve (B) Kaziranga National Park
(C) Jim Corbett National Park (D) Ranthambore National Park

30. Population Census is conducted through
(A) Random survey (B) Accounting
(C) Complete Enumeration (D) Partial Enumeration
31. Skewness is a measure of
(A) Peakedness (B) Symmetry (C) Correlation (D) Regression
32. The environmental planning is
(A) The analysis of how we can prevent the poaching of environment
(B) The analysis of how people impact natural resources
(C) The analysis of how we can preserve our biodiversity
(D) The supply of management tool to conserve our environment

33. Nelong valley, which was opened for tourists in 2015, first time since 1962 is situated
in
(A) Sikkim (B) Uttrakhand (C) Manipur (D) Mizoram
34. Which of the following biospheres in India MISSES a mention in UNESCO’s ‘Man
and Biosphere’ list?
(A) Nokrek (B) Nicobar (C) Sunderbans (D) Manas

Page 77

35. The quantity of water that can be withdrawn annually and also the rate at which this
withdrawal could be made without adversely affecting the inventory of the aquifer is
called
(A) Annual yield (B) Percent yield (C) Operational yield (D) Monthly yield

36. Amnesty International is
(A) a global Human Rights Movement
(B) a non-governmental organization to help people voluntary very poor people
(C) an agency of the United Nations to help refugees of civil wars
(D) an inter-governmental agency to cater to medical emergencies in war-ravaged

regions

37. In India, the steel production industry requires the import of
(A) Saltpeter (B) Rock phosphate
(C) Coking coal (D) Gold

38. 'BioCarbon Fund Initiative for Sustainable Forest Landscapes' is managed by the
(A) Asian Development Bank
(B) International Monetary Fund
(C) United Nations Environment Programme
(D) World Bank

39. The Genetic Engineering Appraisal Committee is constituted under the
(A) Food Safety and Standards Act, 2006
(B) Geographical Indications of Goods (Registration and Protection) Act, 1999
(C) Environment (Protection) Act, 1986
(D) Wildlife (Protection) Act, 1972

40. Which of the following sound waves are used in echo cardio-graphy?
(A) Ultrasonic (B) Infrasonic
(C) Between 20 Hz to 2000 Hz (D) Between 20 Hz to 20,000 Hz

41. The normal rainfall in clean atmosphere at mean sea level is _________ in nature.
(A) Acidic (B) Alkaline
(C) Neutral (D) May be acidic or alkaline

42. Which of the following transitions are studied by UV Spectrometer?
(A) Rotational (B) Electronic (C) Nuclear (D) Vibrational

43. Which of the following weather condition is indicated by the fall of barometer reading?
(A) Stormy (B) Calm (C) Cold and dry (D) Hot and dry

44. Which of the following relates to ‘sustainable development’??
(A) Kyoto Protocol (B) Brundtland Report
(C) Paris Agreement (D) Montral Protocol

45. Which one of the following is the best description of the term 'ecosystem'?
(A) A community of organisms interacting with one another and their physical
environment

Page 78

(B) That part of the Earth which is inhabited by living organisms
(C) A community of organisms without any interaction
(D) The flora and fauna of a geographical area

46. H1N1 virus is sometimes mentioned in the news with reference to which one of the
following diseases?
(A) AIDS (B) Bird flu (C) Dengue (D) Swine flu

47. UNEP is celebrating ____anniversary of UN Conference on Human Environment in
2022.
(A) 50th (B) 25th (C) 75th (D) 10th
48. What happens to the level of dissolved oxygen during eutrophic conditions in lakes?
(A) Remains same (B) Increases
(C) Decreases (D) May increase or decrease

49. The artificial sweetener containing chlorine that has the appearance and taste of sugar
and is stable at the cooking temperature is
(A) Saccharine (B) Sucralose (C) Aspartame (D) Sucrose

50. Which one of the following is the national aquatic animal of India?
(A) Saltwater crocodile (B) Olive Ridley turtle
(C) Gangetic dolphin (D) Gharial

51. Hydro-fluoric acid is not kept in glass bottles because it reacts with
(A) Visible light (B) Sodium oxide of glass
(C) Aluminium oxide of glass (D) Silicon dioxide of glass

52. Which of the following lakes are poorly nourished and have low biological
productivity?
(A) Mesotrophic (B) Oligotrophic (C) Eutrophic (D) Heterotrophic

53. Which one of the following pairs in mismatched?
(A) Permafrost - Tundra (B) Epiphytes -Prairies
(C) Evergreen trees -Coniferous forest (D) Acacia trees-Savanna

54. On the Mho’s scale of hardness which of the following is the softest?
(A) Talc (B) Gypsum (C) Topaz (D) Diamond

55. Sustainable development goals have specific targets to be achieved by
(A) 2022 (B) 2030 (C) 2032 (D) 2040
56. Zeolite softening process removes
(A) Only temporary hardness
(B) Only permanent hardness
(C) Both temporary and permanent hardness
(D) The dissolved gases permanent hard water

57. In which of the following activities are Indian Remote Sensing (IRS) satellites used?
1. Assessment of crop productivity
2. Locating groundwater resources

Page 79

3. Mineral exploration
4. Telecommunications
5. Traffic studies
Select the correct answer using the code given below.
(A) 1, 2 and 3 only (B) 4 and 5 only (C) 1 and 2 only (D) 1, 2, 3 and 4

58. The cancer causing potential is greater in emissions of
(A) Diesel operated vehicles (B) Petrol operated vehicles
(C) CNG operated vehicles (D) Ethanol operated vehicles

59. Which of the following is the fermentation product of molasses?
(A) Ammonia (B) Ethanol (C) Formaldehyde (D) Methanol

60. Which one of the following is associated with the issue of control and phasing out of
the use of ozone-depleting substances?
(A) Montreal Protocol (B) Kyoto Protocol
(C) Nagoya Protocol (D) Bretton Woods Conference

61. Which one of the following is useful biological indicator of SO 2 pollution?
(A) Pseudomonas (B) Algal blooms (C) Lichens (D) Bryophytes

62. Persons working in cement industry and limestone quarries are more prone to
(A) Cancer (B) Silicosis (C) Asthma (D) Fluorosis

63. Which one of the following pair of States of India indicates its easternmost and
westernmost State?
(A) Assam and Rajasthan (B) Arunachal Pradesh and Rajasthan
(C) Assam and Gujarat (D) Arunachal Pradesh and Gujarat

64. Bharat Stage (BS) emission standards based on European regulation were first
introduced in India in
(A) 2003 (B) 2000 (C) 1998 (D) 1994

65. Which of the following National Park is unique in being a swamp with floating
vegetation that supports a rich biodiversity?
(A) Bhitarkanika National Park (B) Keibul Lamjao National Park
(C) Keoladeo Ghana National Park (D) Sultanpur National Park

66. Which of the following is NOT a greenhouse gas?
(A) Carbon dioxide (B) Methane
(C) Water vapour (D) Hydrogen

67. Which of the following vehicles produce Zero emissions?
(A) Electric (B) Diesel and Electric hybrid
(C) Petrol and Electric hybrid (D) Coal based
68. Which of the following organ of the human body does NOT act like a remote sensor?
(A) Ears (B) Nose (C) Eyes (D) Tongue

Page 80

69. Aurora is a natural display of lights in the Earth’s atmosphere and is also referred to
(A) Tropical Lights (B) Temperate Lights
(C) Equatorial Lights (D) Polar Lights

70. Which of the following is most tolerant to sewage pollution?
(A) Scenedesmus (B) Chlorella (C) Daphnia (D) Chironomous

71. Where is the headquarters of United Nations Population Fund located?
(A) Washington DC (B) New York (C) Geneva (D) Perth

72. Which of the following is a derived unit of pressure?
(A) Steradian (B) Candela (C) Kelvin (D) Pascal

73. Sound travels fastest in which of the following?
(A) Steel (B) Water (C) Vaccuum (D) Air

74. Optical fibre works on the principle of
(A) Refraction (B) Total Internal Reflection
(C) Scattering (D) Interference

75. ANOVA stands for
(A) Analysis of Variance (B) Analysis of Velocity
(C) Analysis of Viscosity (D) Analysis of Visibility

x-x-x

(7)
Space for Rough Work

Page 81

MSc(2Yr)(Forensic Science & Criminology)

General Science:
1. Name the type of joint that joins head to shoulders:
(A) Pivotal joint (B) Hinge joint

(C) Ball and socket joint (D) None of these

2. What type of shadow is formed due to extended source of light?
(A) Umbra (B) Penumbra

(C) Both umbra and penumbra (D) None of these

3. Name the micro-organism that causes malaria:
(A) Mosquito (B) Virus (C) Bacteria (D) Protozoa

4. Which of the following chemical is responsible for muscle cramps after heavy exercise?
(A) Ascorbic acid (B) Tartaric acid (C) Lactic acid (D) Hydrochloric acid

5. Which part of Bryophyllum plant can be used as vegetative propagation?
(A) Flower (B) Leaf (C) Stem (D) Root

6. Which of the following is a good conductor of electricity?
(A) Graphite (B) Diamond (C) Charcoal (D) None of these

7. Which of the following chemical shows pink colour in basic solution?
(A) Red litmus (B) Phenolphthalein (C) Blue litmus (D) Vinegar

8. If a solution has pH 4, then the chemical nature of solution is:
(A) Basic (B) Neutral (C) Acidic (D) Salt

9. Splitting of light into its constituent colours is known as:
(A) Reflection (B) Refraction (C) Dispersion (D) Interference

10. Which of the following will form base of energy pyramid in an ecosystem?
(A) Carnivore (B) Scavenger (C) Herbivore (D) Producer

11. What will be the amount of energy available to the organisms of the second trophic level of
food chain if the energy available at first trophic level is 10000 J?
(A) 100 J (B) 1000J (C) 10000J (D) 100000J

12. Which part of plant will show positive geotropism?
(A) Main stem (B) Stem branches (C) Main root (D) All buds

13. The plant hormone which is responsible for growth inhibition in plants is :
(A) Abscisic acid (B) Gibberellins (C) Cytokinin (D) All of these

14. The hormone which is responsible for metabolism of carbohydrates, fats and proteins:
(A) Aldosterone (B) Parathormone (C) Thyroxin (D) Adrenaline

15. Which of the following ratio is associated with “Law Of Independent Inheritance”:
(A) 3:1 (B) 9:3:3:1 (C) 1:1 (D) All of these

Page 82

16. Which of the following law is called as “law of inertia”
(A) Newton’s first law (B) Newton’s second law

(C) Newton’s third law (D) Law of conservation of momentum

17. What is the unit of astronomical distances?
(A)Weber (B) Lux (C) Astronomic year (D) Light year

18. The working principal of a washing machine is:
(A) Centrifugation (B) Dialysis (C) Osmosis (D) Diffusion

19. The speed of light will be minimum while passing through:
(A) Vacuum (B) Glass (C) Air (D) Oxygen gas

20. The most suitable unit for expressing nuclear radius is:
(A) Angstrom (B) Nanometre (C) Fermi (D) Micrometer

Physics:
21. A particle experiences a constant acceleration for 20 seconds after starting from rest. If it
travels a distance ‘x’ in first 10 seconds and a distance ‘y’ in next 10 seconds, then find the
relation between x and y.
(A) y=2x (B) y=3x (C) x=2y (D) x= 3y

22. A man throws balls into the air one after the other in such a way that he throws one ball when
the other is at the highest point. How high the ball rise if he throws twice a second?
(A) 2.45 (B) 1.225 (C) 19.6 (D) 4.9

23. The force of limiting friction between a body and surface of contact is 5N. A force of 7N is
applied on the body and the actual motion starts. The effective force of friction now is :
(A) Zero (B) 5N (C) 7N (D) Less than 5N

24. The force on a particle as a function of displacement ‘x’ (in x direction) is given by:
F= 10 + 0.5 x

The work done corresponding to displacement of particle from x= 0 to x=2 unit is:

(A) 25J (B) 29J (C) 21J (D) 18J
25. Distance of the centre of mass of a solid uniform cone from its vertex is Z. If the radius of its
base is R and height is H, then Z is equal to:
(A) H/4R (B) 3H/4 (C) 5H/8 (D) 3H/8R

26. A satellite is launched into a circular orbit of radius R around the earth. A second satellite is
launched into an orbit of radius 1.01 R. The period of second satellite is larger than the first
one by approximately:
(A) 0.5% (B) 1.0% (C) 1.5% (D) 3.0%

27. The pressure inside the two soap bubbles is 1.01 and 1.02 atmosphere. The ratio of their
respective volume is:
(A) 16 (B) 2 (C) 4 (D) 8

Page 83

28. An incompressible fluid flows steadily through a cylindrical pipe which has radius 2R at a point
‘A’ and radius R at a point ‘B’ farther along the flow direction. If the velocity at a point A is ‘v’
, its velocity at point B is:
(A) 2v (B) v (C) v/2 (D) 4v

29. The black body spectrum of an object ‘A’ is such that its radiant intensity (intensity per unit
wavelength interval) is maximum at a wavelength of 200nm. Another object ‘B’ has maximum
radiant intensity at 600nm. The ratio of power emitted per unit area by source ‘A’ to that of
source ‘B’ is:
(A) 1:81 (B) 1:9 (C) 81:1 (D) 9:1

30. The pressure of a gas is increased by 50% at constant temperature. The decrease in volume
will be nearest to :
(A) 66% (B) 33% (C) 17% (D) 8%

31. Ideal monoatomic gas is taken through a process dQ= 2dU. The molar heat capacity for the
process is :
(A) 2R (B) R (C) 3.5R (D) 3R

32. A certain amount of gas is sealed in a glass flask at 1 atmosphere pressure and 20°C. The flask
can withstand up to a pressure of 2 atmospheres. Find the temperature to which gas can be
heated so that the flask does not break:
(A) 513°C (B) 413°C (C) 313°C (D) 213°C

33. Four cylinders contain equal number of moles of argon, hydrogen, nitrogen and carbon
dioxide at same temperature. The energy is minimum in :
(A) Argon (B) Carbon dioxide (C) Nitrogen (D) Hydrogen

34. A particle executes simple harmonic motion between x= -A and x = +A. The time taken for it
to go from 0 to A/2 is T1 and to go from A/2 to A is T2 . Then:
(A) T1< T2 (B) T1> T2 (C) T1 = T2 (D) T1 = 2 T2

35. A pipe closed at one end and open at the other end resonates with sound waves of frequency
135 Hz and also 165 Hz but not with any wave of frequency intermediate between these two.
Then the frequency of fundamental note is :
(A) 30 Hz (B) 15Hz (C) 60Hz (D) 7.5Hz

36. A galvanometer has coil of resistance 100Ω and gives a full circle deflection for 30 m A current.
If it is to work as a voltmeter of 30 volt range, the resistance required to be added will be:
(A) 1000Ω (B) 1800 Ω (C) 900 Ω (D) 500 Ω

37. A ray of light travelling in a transparent medium of refractive index µ, falls on a surface
separating the medium from air at an angle of incidence 45°. For which of the following value
of µ the ray can undergo total internal reflection?
(A) 1.25µ (B) 1.33 µ (C) 1.40µ (D) 1.50µ

38. Sodium has body centre packing. Distance between the two nearest atoms is 3.7 Å. The lattice
parameter is :
(A) 8.6 Å (B) 6.8 Å (C) 4.3 Å (D) 3.0 Å

Page 84

39. A diamagnetic substance is brought near the north or the south pole of a bar magnet, it is:
(A) Attracted by both poles

(B) Repelled by both poles

(C) Repelled by north pole and attracted by south pole

(D) Repelled by south pole and attracted by north pole

40. The number of photoelectrons emitted when a light of frequency higher than threshold
frequency used is proportional to :
(A) Frequency of light

(B) Difference between frequency of light and threshold frequency

(C) Threshold frequency

(D) Intensity of light

41. The number of beta particles emitted by a radioactive substance is twice the number of alpha
particles emitted by it. The resultant daughter substance is an:
(A) Isotope of parent (B) Isobar of parent

(C) Isomer of parent (D) Isotone of parent

42. The speed of projectile at its maximum height is half of its initial speed. The angle of projection
is :
(A) 15° (B) 30° (C) 45° (D) 60°

43. A monoatomic gas at pressure P1 and volume V1 is compressed adiabatically to 1/8th its original
volume. What is the final pressure of gas:
(A) P1 (B) 16P1 (C) 32P1 (D) 64P1

44. Two parallel metal plates having charges +Q and –Q face each other at a certain distance
between them. If the plates are now dipped in kerosene oil tank, the electric field between
the plates will be:
(A) Increase (B) Decrease (C) Remain same (D) Become zero

45. The electric field at a distance 3R/2 from the centre of a charged conducting spherical shell of
radius R is E. The electric field at a distance R/2 from the centre of sphere is:
(A) E (B) E/2 (C) E/3 (D) Zero

Chemistry:

46. 10g of hydrogen and 64g of oxygen are filled in a steel vessel and exploded. Amount of water
produced in this reaction will be:
(A) 1mol (B) 2mol (C) 3mol (D) 4mol

47. Lithium metal crystallizes in body centric cubic crystal. If length of side of the unit cell of
lithium is 351pm, the atomic radius of lithium will be:
(A) 300.5pm (B) 240.8pm (C) 151.8pm (D) 75.5pm

Page 85

48. In the case of alkali metals, the covalent character decreases in the order:
(A) MI > MBr > MCl > MF (B) MCl > MI > MBr > MF

(C) MF > MCl > MBr > MI (D) MF > MCl > MI > MBr

49. What is the dominant intermolecular force or bond that must be overcome in converting
liquid CH3OH into a gas?
(A) London dispersion forces (B) Hydrogen bonding

(C) Dipole- Dipole interaction (D) Covalent bond

50. Benzene react with CH3Cl in the presence of anhydrous AlCl3 to form:
(A) Xylene (B) Toluene (C) Chlorobenzene (D) Benzylchloride

51. Nitrobenzene can be prepared from benzene by using a mixture of conc. HNO3 and conc.
H2SO4. In this mixture nitric acid acts as:
(A) Catalyst (B) Reducing agent (C) Acid (D) Base

52. Which of the following reaction is an example of Nucleophillic substitution reaction?
(A) RX + MgRMgX (B) RX + KOH  ROH + KX

(C) 2RX + 2Na  R-R + 2NaX (D) RX + H2 RH + HX

53. Which of the following is employed as tranquilizer?
(A) Chlorpheninamine (B) Naproxen (C) Equanil (D) Tetracycline

54. The property of alkaline earth metals that increases with their atomic number is :
(A) Electronegetivity (B) Solubility of their hydroxide in water

(C) Solubility of their sulphate in water (D) Ionization energy

55. Which one of the following compound is a peroxide?
(A) NO2 (B) KO2 (C) BaO2 (D) MnO2

56. In which of the following pairs of molecules/ ions, the central atom have Sp2hybridisation?
(A) BF3and NO2-(B) NO2- and NH3 (C) BF3 and NH2- (D) NH2-and H2O

57. Which of the following alkaline earth metal sulphates has hydration enthalpy higher than the
lattice enthalpy?
(A) SrSO4 (B) CaSO4 (C) BeSO4 (D) BaSO4

58. The existence of two different coloured complexes with the composition of [Co(NH3)4Cl2] + is
due to :
(A) Ionization isomerism (B) Geometrical isomerism

(C) Linkage isomerism (D) Coordination isomerism

59. Which of the following represents the correct order of increasing electron gain enthalpy with
negative sign for the elements O,S,F and Cl?
(A) S < O < Cl < F (B) Cl < F < O < S

(C) O < S < F < Cl (D) F < S < O < Cl

60. Which one of the following molecular hydrides acts as Lewis acid?
(A) CH4 (B) NH3 (C) H2O (D) B2H6

Page 86

61. Liquid hydrocarbons can be converted to a mixture of gaseous hydrocarbon by:
(A) Hydrolysis (B) Oxidation

(C) Crackling (D) Distillation under reduced pressure

62. Which one of the following does not exhibit the phenomenon of mutarotation?
(A) (-) Fructose (B) (+) Sucrose (C) (+) Lactose (D) (+) Maltose

63. Given are cyclohexanol(I), acetic acid(II), 2,4,6- Trinitrophenol(III) and phenol(IV). In these the
order of decreasing acidic character will be:
(A) III > IV > II > I (B) III >II > IV > I

(C) II> III> I> IV (D) II>III>IV>I

64. Which of the following statement about primary amine is FALSE?
(A) Alkyl amines are stronger bases than ammonia.

(B) Alkyl amines are stronger bases than aryl amines.

(C) Alkyl amines react with nitrous acid to produce alcohol.

(D) Aryl amines react with nitrous acid to produce phenol.

65. A solution of sucrose (molar mass=342g/mol) has been prepared by dissolving 68.5g of
sucrose in 1000g of water. The freezing point of the solution obtained will be:
Given Kf for water= 1.86K Kg/mol

(A) – 0.570°C (B) – 0.372°C (C)– 0.520°C (D)+ 0.372°C
66. How many bridging oxygen atoms are present in P4O10?
(A) 4 (B) 2 (C) 5 (D) 6

67. Among the following which one has highest cation to anion size ratio:
(A) CsF (B) LiF (C) NaF (D) CsI

68. Mole fraction of the solute in a 1.00 molal aqueous solution is:
(A) 0.344 (B) 0.0177 (C) 34.4 (D) 17.7

69. If n=6, the correct sequence of filling of electron will be:
(A) ns(n-2)f (n-1)d np (B) ns(n-1)d (n-2)f np

(C) ns(n-2)f np(n-1)d (D) nsnp(n-1)d(n-2)f

70. Which of the following compound has lowest melting point?
(A) CaCl2 (B) CaBr2 (C) CaI2 (D) CaF2

Biology:

71. Which part of brain is effected first in a drunk person?
(A) Cerebrum (B) Olfactory lobe (C) Cerebellum (D) Medulla oblongata

72. Eustachian tube is related with:
(A) Middle ear (B) External ear (C) Inner ear (D) Auditory canal

73. Insulin is produced from:
(A) Alpha cells (B) Beta cells (C) Adrenal cortex (D) Testis

Page 87

74. Hepatic portal system starts from:
(A) Digestive system to liver (B) Kidney to liver

(C) Liver to heart (D) Liver to kidney

75. Blood leaving liver and moving to heart will have more concentration of:
(A) Bile (B) Urea (C) Glycogen (D) Amino acid

76. All arteries carry oxygenated blood except:
(A) Hepatic artery (B) Renal artery

(C) Pulmonary artery (D) Cardiac artery

77. If you want to count chromosomes in root tips of onion which of the following stages will you
most conveniently look into:
(A) Telophase (B) Anaphase (C) Prophase (D) Metaphase

78. Telomerase is an enzyme which is a:
(A) RNA (B) Ribonucleoprotein

(C) Repetitive DNA (D) Simple protein

79. Protein synthesis in an animal cell occur:
(A) On ribosomes present in cytoplasm as well in mitochondria

(B) On ribosomes present in nucleolus as well in cytoplasm

(C) Only on ribosomes attached to nuclear envelope and endoplasmic reticulum

(D) Only on ribosomes present in cytosol

80. Eggs which have yolk in the centre surrounded by cytoplasm are called:
(A) Alecithal (B) Homolecithal (C) Microlecithal (D) Centrolecithal

81. Common feature between cockroach and earthworm is :
(A) Hermaphroditism (B) Moulting of cuticle

(C) Excretion by nephridia (D) Ventral nerve cord

82. Which of the following have no skeleton?
(A) Cockroach (B) Butterfly (C) Jellyfish (D) Mosquito

83. Gymnosperm wood is non-porous because it:
(A) Lacks vessels (B) Contain tracheae

(C) Has abundant fibre (D) Has no fibre

84. Amount of secondary xylem as compared to secondary phloem formed every year is:
(A) Equal (B) 8-10 times (C) Half (D) 4-5 times

85. Collateral, open vascular bundle and eusteleis present in:
(A) Dicot stem (B) Monocot stem (C) Monocot root (D) Dicot root

Page 88

86. The first modern birds appear during the:
(A) Cretaceous period (B) Jurassic period

(C) Triassic period (D) Carboniferous period

87. Wings of insect and wings of birds are example of:
(A) Mimicry (B) Homology (C) Serology (D) Analogy

88. In photorespiration, glycine moves from
(A) Chloroplast to peroxisome (B) Peroxisome to mitochondrion

(C) Mitochondria to peroxisome (D) Chloroplast to mitochondrion

89. Glycogen is stored in:
(A) Liver and muscle (B) Liver only (C) Muscle only (D) Pancreas

90. Chemically enzymes are:
(A) Fats (B) Carbohydrates (C) Hydrocarbons (D) Proteins

91. Translocation of sugars in flowering plants occurs in the form of:
(A) Glucose (B) Sucrose (C) Fructose (D) Maltose

92. First line of defence of body is:
(A) Skin and mucous membrane (B) Neutrophils and monocytes

(C) Fever (D) Interferon

93. Vaccination is a part of:
(A) Treatment (B) Passive immunisation

(C) Diagnosis (D) Prophylaxis

94. Widal test is used for detecting:
(A) Pneumonia (B) Malaria (C) Typhoid (D) Cholera

95. In mammals corpus luteum is found in which organ:
(A) Brain (B) Ovary (C) Liver (D) Eyes

Forensic Science

96. Making of a false document comes under which section of IPC?
(A) 464 (B) 463 (C) 466 (D) 467
97. Which of the following is a principle component of dynamite-
(A) Black powder (B) Nitro-glycerine (C) TNT (D) RDX
98. Pistols have a firing range around-
(A) 50-60 yards (B) 30-50 yards (C) 15-25 yards (D) 45-50 yards

Page 89

99. Who patented the needle gun and in which year?
(A) Frosythe, 1807 (B) Dreyse, 1828 (C) Joshua, 1840 (D) Alexander, 1740
100. 32 CAL is equivalent to
(A) 6 mm (B) 5 mm (C) 9 mm (D) 8 mm
101. Pitch of human male speech sound ranges between
(A) 100- 120 Hz (B) 120-190 Hz (C) 60- 150 Hz (D) 200- 230 Hz
102. NCIC stands for:
(A) National Center for Information Control (B) National Crime Information Center
(C) National Criminal Information Control (D) None of these

103. Copper is a major component in which type of ink-
(A) Iron gallotinate ink (B) Log wood ink
(C) Carbon ink (D) Dyestuff ink

104. Half-life of Archaeological object can be determined by
(A) ICP-AES (B) XRF (C) XRD (D) NAA
105. _______ is a mineral fibre.
(A) Mohair (B) Angora (C) Asbestos (D) Viscose
106. Fractures due to heat are
(A) Radial (B) Spiral (C) Wavy (D) Concentric
107. Control soil sample for forensic analysis is best collected in
(A) Steel container (B) Paper bag (C) Cloth bag (D) Jute bag
108. The database designed for collection, restoration and comparing of tool images is
(A) AFTE (B) TRAX (C) NBTRD (D) NIST
109. VSC was invented by?
(A) Foster (B) Mokrzycki (C) M.A. Casey (D) D.J. Purtell
110. The first GEQD was established in?
(A) Calcutta (B) Shimla (C) Hyderabad (D) Delhi
111. Which compound is seasonally added to gasoline as an adulterant and its detection provide
some beneficial information in arson cases-
(A) Ethanol (B) Methanol (C) Propanone (D) Ethyl Acetate
112. Using which fingerprint method Reversed Print is developed
(A) Iodine Fuming (B) Super Glue
(C) Vacuum Metal Deposition (D) SPR

113. Which of the following would not be an illicit drug:
(A) Aspirin (B) Cocaine (C) Heroin (D) Cannabinoids

114. Lead in petroleum is detected by
(A) AAS (B) NAA (C) GCMS (D) HPLC

Page 90

115. Medico-legal autopsy is ordinarily done, on requisition of:
(A) Superintendent of Police (B) Sub-Inspector of Police
(C) Executive Magistrate (D) Medical Superintendent

116. Section 377 of IPC deals with:
(A) Adultery (B) Incest
(C) Unnatural sexual offence (D) Rape

117. Short term Tandem repeat (STRs) normally consist of repeating sequences of approximately
how many bases:
(A) 3-7 (B) 1-3 (C) 14-17 (D) 10-13

118. Hair become loose after
(A) 90 hrs of death (B) 72 hrs of death
(C) 48 hrs of death (D) 03 months of death

119. Buck Ruxton case is related to:
(A) Video-graphic skull super imposition (B) Facial Reconstruction from skull
(C) Photographic skull super imposition (D) Crime Scene reconstruction

120. Mee’s line noticed in case of
(A) Arsenic poisoning (B) Organophosphorus
(C) Hydrogen sulfide (D) Chloroform

x-x-x

(10)

Page 91

M.A.(Geography) (GEOG)

1. Which of the following is not considered a characteristic feature of the youthful stage of an
ideal normal cycle of erosion?
(A) Pot holes (B) Natural levees (C) Gorges (D) River Capture

2. The theory of Plate Tectonics does not help to explain the origin and location of which of
the following?
(A) Earthquakes (B) Mountains
(C) Ocean Currents (D) Major Sea floor features

3. Which of the following winds fall in the zone of Hadley Cell?
(A) Chinook (B) Trade Winds (C) Westerlies (D) Polar winds

4. Tsunamis are produced by
(A) Tides (B) Cyclones
(C) Sub-marine earthquakes (D) Shrinking of earth’s crust

5. Which one of the following sediment deposits covers the largest proportion of the ocean
floor?
(A) Pelagic (B) Cosmogenous (C) Biogenous (D) Hydrogenous

6. When higher income groups re-occupy and revive older housing to make attractive inner
city areas, the process is called:
(A) Filtering (B) Gentrification
(C) Housing re-development (D) Residential upgradation

7. The Growth Pole concept was successfully applied in Geography by:
(A) Friedman (B) Perroux (C) Frank (D) Boudeville

8. The city region is an example of:
(A) A formal region (B) A functional region
(C) Compage region (D) Adhoc region

9. Population Density is usually shown by:
(A) Choropleth Method (B) Isopleth Method
(C) Chorochromatic Method (D) Decimetric Method

10. Which one of the following islands is volcanic in origin?
(A) Car-Nicobar (B) Little Nicobar (C) Barren (D) North Andaman

11. Which process of chemical weathering causes rusting of iron?
(A) Carbonation (B) Oxidation (C) Dissilication (D) Hydration

12. Sea floor spreading theory was propounded by:
(A) Harry Hess (B) Tuzo Wilson (C) A. Hobbes (D) D.L. Holms

13. Red Sea is an example of
(A) Synclinal valley (B) Volcanic Structure
(C) Rift Valley (D) Eroded Valley

Page 92

14. The “Agenda 21” was adopted in which of the following conventions?
(A) Stockholm Convention (B) Rio-Earth Summit
(C) Rotterdam Convention (D) Ramsar Convention

15. Kant viewed Geography as a
(A) Chorological Science (B) Spatial Science
(C) Regional Science (D) Systematic Science

16. Central Place Theory explaining city-size distribution was given by
(A) G.K. Zipf (B) Walther Christaller
(C) Chauncy Harris (D) Weber

17. Carl Sauer is best identified for his classic work related to
(A) Cultural landscape (B) Economic landscape
(C) Social landscape (D) Physical landscape

18. pH value of moderately alkaline soils varies between
(A) 4.5 to 5.0 (B) 5.0 to 5.5 (C) 5.8 to 6.4 (D) 7.8 to 8.4

19. Which of the following ports has an outer harbour for export of iron ore?
(A) Kolkata (B) Mumbai (C) Vishakapatanam (D) Cochin

20. Which one of them is a footloose industry?
(A) Iron and steel industry (B) Automobile industry
(C) Cement industry (D) Cotton textile industry

21. Which is the geologically oldest physiographic division of India?
(A) Great Northern Plains (B) Great Indian Plateau
(C) Greater Himalayas (D) The Coastal Plains

22. Who developed the concept of areal differentiation in geography?
(A) Richard Hartshorne (B) Paul Vidal de la Blache
(C) Alfred Hettner (D) Ferdinand Von Richthofen

23. “Pays Concept” is associated with
(A) German school (B) French school
(C) American school (D) Russian school

24. Which of the following latitudes passes through India?
(A) Equator (B) Arctic Circle
(C) Tropic of Capricorn (D) Tropic of Cancer

25. Which one of the following longitudes determines the Indian standard time?
(A) 85.5 E (B) 86.5E (C) 84.5 E (D) 82.5 E

26. Among the following Union Territories of India, which one has the largest size?
(A) Pudducherry (B) Lakshadweep (C) Daman and Diu (D) Chandigarh

27. Which foreign country is closest to Andaman Islands?
(A) Sri Lanka (B) Myanmar (C) Indonesia (D) Pakistan

Page 93

28. Among the following States, which one has the largest forest area?
(A) Gujarat (B) Karnataka (C) Orissa (D) Tamil Nadu

29. Which of the following States was formed exclusively by the migrants in the 20th Century?
(A) Maldives (B) Mauritius (C) Israel (D) Myanmar

30. What is ‘Hebrew’?
(A) An animal (B) A language (C) A river (D) A plant

31. . What is ‘Karaganda’?
(A) An animal (B) A mountain (C) A coalfield (D) An ocean deep

32. The most important factor to control the growth and types of forests is—
(A) Soil types (B) Climate
(C) Underground water (D) Soil fertility

33. Which one of the following regions is practising most intensive subsistence farming ?
(A) Pampas region (B) Murray-Darling Basin
(C) California Valley (D) Monsoon Asia

34. By which theory does the population increase geometrically?
(A) Optimum Population Theory (B) Malthusian Theory of Population
(C) Logistic Curve Theory (D) Theory of Demographic Transition

35. Bad-land Topography is the product of the combined action of
(A) Wind and Glacier (B) Wind and Water
(C) Water and Glacier (D) Water and Temperature

36. Tropical deciduous or monsoonal forests occur in :
(A) Siberia, Alaska, USA, Canada (B) New Zealand, Spain, Portugal, France
(C) Netherlands, Russia, Norway, UK (D) Burma, India, Thailand, Brazil

37. Which one of the following is a Taiga Biome ?
(A) Sub-Tropical Biome (B) Sub-Arctic Biome
(C) Savanna Biome (D) Sub-Sahara Biome

38. Diego Garcia is an island in which of the following oceans?
(A) Atlantic (B) Pacific (C) Indian (D) Arctic

39. Demographic transition is a framework that explores the historical sequence of changes in
(A) Fertility and mortality (B) Mortality and age-structure
(C) Mortality and migration (D) Age-structure and sex

40. Marquette range in U.S.A. is known for
(A) Uranium (B) Copper (C) Gold (D) Iron ore

41. Kirkuk, one of the most important oilfields in the world, is located in
(A) Iran (B) Iraq (C) Kuwait (D) Russia

(3)

Page 94

42. Which one of the following States has the longest coast line?
(A) Tamil Nadu (B) Maharashtra (C) Gujarat (D) Kerala

43. The ‘Valley of Kashmir’ lies between which of the following ranges?
(A) Pir-Panjal and Karakoram range (B) Pir-Panjal and Zaskar range
(C) Zaskar and Ladakh range (D) Sulaiman and Kirthar range

44. Occupational structure of population in India at State level is best represented by
(A) Dot Method (B) Isopleth (C) Choropleth (D) Pie diagram

45. Organic Theory of the State was propounded by
(A) Mackinder (B) Ratzel (C) Haushofer (D) Isaiah
Bowman

46. Which of the following was the earliest regional planning exercise in India?
(A) National Capital Region Plan (B) Dandakaranya Area Plan
(C) Damodar Valley Project (D) Bhakra-Nangal Project

47. Delta Kames are the outcome of
(A) Glacial erosion (B) Wind deposition
(C) River deposition (D) Glacial deposition

48. Who was the first Geographer to ascertain the length of the equator?
(A) Eratosthenes (B) Herodotus (C) Anaximander (D) Thales

49. The Savanna biome is usually associated with
(A) Tropical wet-dry climate (B) Equatorial wet climate
(C) Tropical dry climate (D) Monsoon climate

50. Which one of the following is a renewable resource?
(A) Coal (B) Wind energy (C) Iron ore (D) Mica

51. Which of the steel plants is port based?
(A) Bhilai (B) Durgapur (C) Vishakhapatnam (D) Rourkela

52. In which of the following diagrams the relationship of relative humidity and temperature is
depicted?
(A) Hythergraph (B) Climograph (C) Ergograph (D) Band graph

53. The idealised global pattern of surface wind from the equator to pole is
(A) doldrums – trade winds – westerlies – easterlies
(B) doldrums – westerlies – trade winds – easterlies
(C) doldrums – easterlies – trade winds – westerlies
(D) doldrums – trade winds – easterlies – westerlies

54. Theories of spatial organization draw mainly from
(A) Positivism (B) Functionalism (C) Structuralism (D) Behaviouralism

(4)

Page 95

55. Natural population growth is a function of
(A) Births (B) Deaths
(C) Fertility and mortality (D) Migration

56. The spatial distribution pattern of rural settlements can best be observed from
(A) Wall maps (B) Cadastral maps
(C) Geological maps (D) Topographical maps

57. Deciduous trees are those :
(A) That grow up straight
(B) That grow plenty in dry places
(C) That never bear fruits
(D) That shed their leaves during a certain season

58. Which of the following cities is situated on the mouth of river Tapi (Tapti)?
(A) Ankleshwar (B) Vadodara (C) Ahmedabad (D) Surat

59. The projection in which Loxodromes are shown as straight lines is
(A) Gnomonic (B) Mercator’s
(C) Gall’s Stereographic (D) Cylindrical Equal Area

60. A system which consists of data acquisition, data processing and data analysis is called
(A) Digital Image (B) Geographic Information System
(C) Remote Sensing System (D) Global Positioning System

61. “The present is the key to the past.” This statement was made by
(A) W.M. Davis (B) James Hutton
(C) Van Ritchthofen (D) A. Penck

62. Which of the following is formed as a result of tectonic forces?
(A) Hanging valley (B) V-shaped valley
(C) Rift valley (D) Blind valley

63. Insolation reaches the earth surface in the form of
(A) Short waves (B) Long waves (C) Microwaves (D) Lorenz curve

64. “Space is socially or culturally constructed” is the view under
(A) Logical positivism (B) Behaviouralism
(C) Post modernism (D) Structuralism

65. Mediterranean climate is characterized by
(A) Dry summer and Humid winter (B) Humid summer and Dry winter
(C) Dry summer and Dry winter (D) Humid summer with no winter

66. The atmosphere gets heated by which one of the following?
(A) Direct rays of the sun (B) Volcanic activity
(C) Burning of organic material (D) Radiation from the earth

(5)

Page 96

67. Winter rainfall in North-Western part of India is mainly due to
(A) Western disturbance (B) North-East Monsoon
(C) North-West Monsoon (D) Depression in the Bay of Bengal

68. Which one of the following indicates the principle of transport in Central Place Theory?
(A) K3 (B) K4 (C) K7 (D) K9

69. Truck farming is associated with
(A) Vegetables (B) Milk (C) Cereals (D) Poultry

70. The essential feature of shifting cultivation is
(A) Rotation of crops (B) Rotation of fields
(C) Single cropping (D) Use of plenty of fertilizers

71. Which of the following is not considered a geographic pattern?
(A) Centralized (B) Distributive (C) Linear (D) Random

72. Machu Picchu of Inca civilization is located in
(A) Argentina (B) Brazil (C) Columbia (D) Peru

73. The normal cycle of erosion is associated with
(A) Marine Erosion (B) Wind Erosion (C) River Erosion (D) Glacial
Erosion

74. The cold current flowing along the coast of Chile and Peru is known as
(A) Agulhas (B) EL-Nino (C) Humboldt (D) Canary

75. The habitat of the Toda tribe is
(A) Aravalli range (B) Siwalik range (C) Kaimur range (D) Nilgiri hills

x-x-x

Page 97

Master in Geo-informatics (GEOIN)
1. A Choropleth map shows
(A) Density of population (B) Distribution of population
(C) Literacy rate (D) Growth of population

2. Equal area projections are also called
(A) Conformal projections (B) Equivalent projection
(C) True direction projection (D) Non-conformal projection

3. The envelope of air surrounding the earth
(A) Air (B) Wind (C) Atmosphere (D) Breeze

4. Name the rocks that are formed due to cooling of magma deep inside the earth
(A) Plutonic igneous rocks (B) Extrusive igneous rocks
(C) Sedimentary rocks (D) Volcanic rocks

5. Summer solstice occurs on
(A) 21st May (B) 21st June (C) 22nd June (D) 22nd May

6. What is the name given to 23 ½ 0 Latitude in the Northern Hemisphere
(A) Tropic of Capricorn (B) Tropic of Cancer
(C) Prime Meridian (D) Greenwich Line

7. Give an example of a Block mountain in India
(A) Black forest (B) Vosges
(C) Salt range (D) Satpura mountains

8. Continental Drift Theory was given by
(A) Harry Hess (B) Morgan (C) Alfred Wegner (D) Holmes

9. Longitudinal waves are known as
(A) P-waves (B) S-waves (C) L-waves (D) Transverse waves

10. The decomposition of rocks by chemical action is called
(A) Oxidation (B) Hydration
(C) Physical weathering (D) Chemical weathering

11. The floating ice masses are termed as
(A) Ice caps (B) Ice sheets (C) Icebergs (D) Ice mass

12. The erosion which is carried out by the process of abrasion, attrition and deflation
(A) Aeolian (B) Erosion (C) Gradation (D) Blow-out
13. A plateau formed at the foothill of extensive mountains
(A) Piedmont (B) Continental (C) Volcanic (D) Mature
14. The zone of steep slope extending from the continental shelf to the abyssal plain is
called
(A) Continental Rise (B) Continental Slope
(C) Oceanic ridge (D) Mid-oceanic ridge

Page 98

15. The force which deflects the direction of winds is
(A) Hadley’s force (B) Newton force
(C) Ferrel’s force (D) Coriolis force

16. ITCZ is
(A) Inter Tropical Continental Zone (B) Inter Tropical Convergence Zone
(C) Inter Tropical Coverage Zone (D) Inter Temperate Convergence Zone

17. The atmospheric pressure is measured with the help of
(A) Barometer (B) Thermometer (C) Richter Scale (D) Hygrometer

18. Name the largest Ocean in the world
(A) Pacific (B) Atlantic (C) Indian (D) Arctic

19. The conversion of gaseous form of water into solid or liquid form is called
(A) Condensation (B) Evaporation (C) Sublimation (D) Precipitation

20. The high altitude detached clouds having fibrous or silky appearance are called
(A) Cirrocumulus clouds (B) Altostratus clouds
(C) Cirrus clouds (D) Cumulus clouds

21. The Great Barrier Reef is along the eastern coast of
(A) Australia (B) New Zealand (C) India (D) Argentina

22. Contours on topographical maps are denoted by
(A) Red colour (B) Pink colour (C) Brown colour (D) Yellow colour

23. Rainfall is recorded with the help of
(A) Barometer (B) Rain gauge (C) Anemometer (D) Bargraph

24. DIP is
(A) Digital Image Processing (B) Digital Image Procedure
(C) Divided Image Processing (D) Digital Interleaved Processing

25. What can be shown with the help of profiles?
(A) Weather elements (B) Relief features
(C) Distribution of Crops (D) Population density

26. In a cylindrical equal area projection the inter parallel spacing towards poles
(A) Decreases (B) Increases
(C) Varies from case to case (D) Remains same

27. The three primary colours can be called
(A) Additive primaries (B) Subtractive primaries
(C) Natural primaries (D) Compound primaries
28. The power plant at Manikaran based on geothermal energy is in the state of
(A) Arunachal Pradesh (B) Madhya Pradesh
(C) Himachal Pradesh (D) Sikkim
(2)

Page 99

29. Who was the first scholar to divide the world landmass into three continents: Europe,
Asia, Libya (Africa)?
(A) Eratosthenes (B) Herodotus (C) Hecataeus (D) Anaximander

30. What is the full form of RF?
(A) Representative fraction (B) Relief factor
(C) Radio frequency (D) Representative factor

31. The lowest layer of the Atmosphere
(A) Exosphere (B) Mesosphere (C) Stratosphere (D) Troposphere

32. Which projection is most useful for sailors?
(A) Sinusoidal (B) Mollweid’s (C) Gnomonic (D) Mercator’s

33. The degree to which water vapour is present in the atmosphere
(A) Precipitation (B) Condensation (C) Humidity (D) Evaporation

34. Which was the first satellite launched by India?
(A) Bhaskar II (B) INSAT-IB (C ) IRS-IA (D) Cartosat

35. Which colour has the shortest wavelength?
(A) Indigo (B) Blue (C) Yellow (D) Red

36. Which of the following statements is correct?
(A) Prime meridian is not a great circle
(B) The world has 36 standard Time zones
(C) Equator is a small circle
(D) The North and South pole have no parallels

37. Which is the Output device of a computer
(A) Mouse (B) Scanner (C) Printer (D) Keyboard

38. Data collection would involve
(A) Analysis (B) Coding (C) Editing (D) Interview

39. Vegetation in FCC is represented by
(A) Green colour (B) Red colour (C) Blue colour (D) Yellow colour

40. GPS refers to
(A) Global prevention system (B) Global projection system
(C) Global positioning system (D) Global protection system

41. The ozone layer is contained in the
(A) Mesosphere (B)Troposphere (C) Thermosphere (D) Stratosphere
42. Cardinal points are the
(A) Position of two poles
(B) Four main directions on a compass
(C) Four corners of a map
(D) Four positions of the earth in it’s orbit around the sun
(3)

Page 100

43. The actual heights of places above the sea level are shown by
(A) Hill shading (B) Hachures (C) Contours (D) Spot heights

44. Which agency publishes the topographical maps of India
(A) Survey of India (B) Geological survey of India
(C) Government of India (D) Geographical survey of India

45. Which projections show true bearing?
(A) Zenithals (B) Conicals (C) Conventionals (D) Cylindericals

46. Name the device used for getting information in remote sensing
(A) Camera (B) Platform (C) Sensor (D) Radar

47. Wind speed is measured by
(A) Anemometer (B) Wind Vane (C) Chronometer (D) Aerometer

48. The longest day in the southern hemisphere
(A) 22nd December (B) 21st June (C) 25th December (D) 23rd March

49. The sun is vertical over the Tropic of Cancer on
(A) March 21 (B) June 21 (C) September 23 (D) December 22

50. Which of the following is a secondary method of collecting data?
(A) Observation (B) Questionnaire (C) Interview (D) Census

51. A slope which curves inwards is called
(A) Concave slope (B) Convex slope (C) Uniform slope (D) Undulating slope

52. What is normal lapse rate?
(A) Rate of decrease in temperature with increasing height
(B) The temperature is stable
(C) Rate of increase and decrease in temperature
(D) Rate of increase in temperature with height

53. Outermost layer of the earth
(A) Core (B) Crust (C) Mantle (D) Sial

54. People engaged in Tertiary activities are called
(A) Gold collar workers (B) Blue collar workers
(C) Red collar workers (D) Pink collar workers

55. Closely spaced contours represent
(A) Gentle slope (B) Steep slope (C) Uniform slope (D) None of these

56. Denominator in R.F. represents
(A) Ground distance (B) Map distance (C) Vertical distance (D) Horizontal distance
57. In which of the following months is earth farthest from the Sun?
(A) January (B) September (C) July (D) March

(4)

Page 101

58. What is the shape of the Earth?
(A) Sphere (B) Oblate sphere (C) Circle (D) Geoid

59. Which of the ranges is the youngest?
(A) Sahyadri (B) Aravalli (C) Satpura (D) Himalaya

60. Teesta is a tributary of
(A) Ganga (B) Meghna (C) Yamuna (D) Brahamaputra

61. The network of parallels and meridians is called a
(A) Scale (B) Grid (C) Graticule (D) Map projection

62. Isobars connect places with
(A) Equal pressure (B) Equal temperature
(C) Equal height (D) Same values of a phenomenon

63. Dots marked on maps with a number indicating it’s altitude are called
(A) Hachures (B) Spot heights
(C) Bench marks (D) Trigonometrical stations

64. A thematic map is
(A) A large scale map (B) Atlas map
(C) Special purpose map (D) General purpose map

65. Climograph was developed by
(A) Trewartha (B) Miller (C) Taylor (D) Critchfield

66. The term applied to a point vertically below the camera axis, on the ground is called
(A) Principal point (B) Nadir line (C) Nadir point (D) Plumb point

67. ISRO was established in the year
(A) 1969 (B) 1973 (C) 1979 (D) 1956

68. Which of the following is a low cloud in the sky?
(A) Cumulus (B) Stratus (C) Cirrus (D) Nimbus

69. Which is the first state to receive monsoons in India?
(A) Punjab (B) Kerala (C) Sikkim (D) Tamil Nadu
70. The northernmost Himalayan range is called
(A) Himadri (B) Tethys (C) Sagarmatha (D) Siwaliks
71. The Alakananda and Bhagirathi head streams join at
(A) Devigarh (B) Devprayag (C) Mansarovar (D) Amarkantak

72. Which of the following is not a leap year?
(A) 1978 (B) 2000 (C) 2008 (D) 2016

73. Which Indian state occupies the smallest area?
(A) Goa (B) Punjab (C) Sikkim (D) Nagaland
(5)

Page 102

74. The first Nuclear test in India was conducted at
(A) Pokhran (B) Dhuvaram (C) Trombay (D) Kota

75. Broken lines drawn in the direction of slope
(A) Hachures (B) Spot heights (C) Bench marks (D) Contours

x-x-x

(6)
Space for Rough Work

Page 103

MSc(HS)(Geology) (GEOL)

1. Identify the mineral with high specific gravity and grey streak.
(A) Barite (B) Bauxite (C) Quartz (D) Galena

2. Graphic texture is common in which rock
(A) Basalt (B) Gabbro (C) Dunite (D) Granite

3. Which of the following mineral deposit is formed exclusively by residual processes?
(A) Nickel laterites (B) Copper (C) Lead (D) Zinc

4. Migmatites are common in
(A) Low grade metamorphism (B) High grade metamorphism
(C) Ocean floor metamorphism (D) Shock metamorphism

5. The mineral coesite is expected to be stable in
(A) Low grade metamorphic rocks (B) Ocean floor metamorphism
(C) High pressure metamorphic rocks (D) High temperature metamorphic rocks

6. Pyrolusite is an ore of
(A) Iron (B) Aluminum (C) Copper (D) Manganese

7. The most abundant oxide in the Earth’s crust is
(A) Al2O3 (B) SiO2 (C) CaO (D) Na2O

8. Eutectic crystallization can give rise to
(A) Graphic texture (B) Spinifex texture
(C) Porphyritic texture (D) Corona texture

9. Spinifex texture is commonly found in
(A) Granites (B) Rhyolites (C) Diorites (D) Komatiites

10. Trilobites became extinct at
(A) Permo-Triassic boundary (B) Cretaceous-Tertiary boundary
(C) Precambrian-Cambrian boundary (D) Archaean-Proterozoic boundary

11. The Meghalayanstage began
(A) 5200 years ago from now (B) 4200 years ago from now
(C) 6200 years ago from now (D) 3200 years ago from now

12. The hardest silicate mineral in the Mohs scale of hardness is
(A) Topaz (B) Diamond (C) Corundum (D) Apatite

13. Arenite is known to have
(A) Less than 15% matrix (B) More than 25% matrix
(C) More than 50% matrix (D) More than 75% matrix

14. Sand size falls in the range
(A) 0.0625 mm and 2 mm (B) 2mm to 5 mm
(C) 10mm-15mm (D) 1cm-2cm

Page 104

15. The term Anatexis is used for
(A) Partial melting of crustal rocks (B) Crystallisation of magmas
(C) Partial melting of mantle rocks (D) Magma mixing

16. The boundary between high pressure and ultrahigh pressure metamorphism is demarcated by
(A) Graphite-diamond transition (B) Quartz-coesite transition
(C) Breakdown of plagioclase (D) Quartz-beta Quartz transition

17. Which of the following is not diagnostic of ultrahigh temperature metamorphism of
pelites
(A) Osumillite+biotite+muscovite (B) Osumillite+ sapphirine + quartz
(C) Osumillite + orthopyroxene + sillimanite(D) Osumillite + garnet + cordierite

18. A mafic rock metamorphosed under amphibolite facies condition is expected to have
the mineral assemblage:
(A) Chlorite + Actinolite + Albite
(B) Lawsonite + Glaucophane + Epidote
(C) Orthopyroxene + Clinopyroxene + Plagioclase
(D) Hornblende + Plagioclase

19. Herringbone cross-stratification indicates
(A) Glacio-fluvial environment (B) Tidal environment
(C) Desert environment (D) Lake environment

20. Eclogite facies for mafic rocks have the following assemblage
(A) chlorite-epidote-albite (B) garnet-cpx-hornblende-plagioclase
(C) garnet-cpx-biotite (D) garnet-cpx-opx-plagioclase

21. Which of the following physical properties characterize Hematite?
(A) Bladed form (B) Cherry red streak
(C) Pink colour (D) Low specific gravity

22. Fjords result from
(A) Glacial erosion (B) Glacial deposition
(C) Fluvial erosion (D) Fluvial deposition

23. Conglomerates are characteristic of
(A) Alluvial fans (B) Tidal flats
(C) Aeolian dunes (D) River flood plains

24. Shale is characterized by
(A) Schistosity (B) Gneissoity
(C) Fissility (D) Granulose texture

Page 105

25. Barite deposits from India are known from
(A) Mangampet, Andhra Pradesh (B) Balaghat, Madhya Pradesh
(C) Jaduguda, Jharkhand (D) Panna, Madhya Pradesh

26. Oxygen in the Earth’s atmosphere is mainly from:
(A) Algae (B) Extraterrestrial bodies
(C) Moon (D) Weathered rocks

27. Dinosaur fossils have been recovered from
(A) Patcham Formation (B) Panna Formation
(C) Bhander Group (D) Jhiri Formation

28. Spinel crystallises in
(A) Hexagonal system (B) Cubic system
(C) Triclinic system (D) Monoclinic system

29. The deepest marine benthic habitat is
(A) Abyssal (B) Neritic (C) Bathyal (D) Hadal

30. Trilobite eye lenses were made up of
(A) Gypsum (B) Barite (C) Calcite (D) Fluorite

31. Dinosaurs became extinct during end of
(A) Jurassic (B) Permian (C) Triassic (D) Cretaceous

32. Lignite in India is found in
(A) Neyvelli, Tamil Nadu (B) Jharia, Jharkhand
(C) Jaipur, Rajasthan (D) Garampani, Meghalya

33. The amplitude of ground motion during an earthquake of magnitude 3 in Richter scale
is how many times more than that of a magnitude 2?
(A) 10 (B) 100 (C) 1000 (D) 10,000

34. Aulacogen is a
(A) Hot spot (B) Failed arm of a continental rift
(C) Volcanic cone (D) Hot spring

35. Which one of the following optical properties is observed under plane polarized light
(A) Extinction (B) Interference colour
(C) Interference figure (D) Pleochroism

36. Syngenetic Ni-Cu sulphide ore in basic rocks is formed by
(A) Lateral Secretion (B) Volcanic exhalation
(C) Liquid immiscibility (D) Residual processes

37. Lateral secretion process can be used to explain formation of
(A) Goethite deposits (B) Ni laterites
(C) Bauxite deposits (D) Gold deposits

(3)

Page 106

38. Around 90 percent of mass extinction event occurred at the end of
(A) Proterozoic (B) Carboniferous (C) Permian (D) Jurassic

39. A 4km long dyke exposed on a horizontal surface when plotted on a map of 1:50000
scale, will have a length of:
(A) 4 cm (B) 8 cm (C) 16 cm (D) 32 cm

40. The characteristic texture formed during contact metamorphism is
(A) Hornfelsic (B) Slaty (C) Schistose (D) Gneissose

41. Most primitive meteroites are
(A) Achondrites (B) Chondrites (C) Kamactite (D) Taenite

42. Sanidinite facies forms as a result of
(A) Regional metamorphism (B) Ocean floor metamorphism
(C) Contact metamorphism (D) Hydrothermal metamorphism

43. Greater viscosity of magma indicates:
(A) Low silica content (B) Higher silica content
(C) High volatile content (D) High temperature

44. Iceland is part of
(A) Mid Atlantic Ridge (B) Circum-Pacific belt
(C) Alps mountains (D) Andes mountains

45. Deccan volcanism resulted from
(A) Alpine orogeny (B) Hot spot activity
(C) Himalayan orogeny (D) Aravalli orogeny

46. The Conrad discontinuity lies between
(A) Crust and mantle (B) Upper and lower crust
(C) Outer core and lower mantle (D) Inner core and outer core

47. S-waves (seismic) cannot pass through
(A) Upper crust (B) Lower crust (C) Lower mantle (D) Outer core

48. Barren Island volcano is located in
(A) Sikkim (B) Orissa
(C) Andaman and Nicobar (D) Lakshwadeep

49. Wadati-Benioff Zone is known for
(A) Shallow earthquakes (B) Landslides
(C) Deep earthquakes (D) Cyclones

50. Which of the following building stones have the highest crushing strength
(A) Limestone (B) Slate (C) Granite (D) Sandstone

(4)

Page 107

51. Epithermal deposits form in the temperature range
(A) 800-900oC (B) 500-700oC (C) 450-350oC (D) 200-50oC

52. The Average crustal abundance (%) of chromium is 0.01 and Average minimum
exploitable grade (%) is 30. The concentration factor for chromium is:
(A) 3 (B) 300 (C) 0.3 (D) 3000

53. Identify the base metal amongst the following:
(A) Gold (B) Platinum (C) Iron (D) Tin

54. Porphyry deposits are characteristic of
(A) Convergent plate margins (B) Divergent plate margins
(C) Transform fault (D) Intracontinental rifts

55. The oldest dated zircon in India is from
(A) Orissa (B) Rajasthan (C) Madhya Pradesh (D) Karnataka

56. Which of the following rocks will have the highest porosity
(A) Shale (B) Limestone (C) Dolostone (D) Sandstone

57. Which of the following will have the highest permeability
(A) Shale (B) Gravel (C) Clay (D) Sand

58. Which one of the following rocks will form a good aquitard
(A) Clay (B) Fractured limestone (C) Gravel (D) Sand

59. Kimberlites are known to originate in
(A) Mantle (B) Coal seams
(C) Oceanic crust (D) Continental crust

60. Cutan is a
(A) Volcano (B) Cyclone (C) Soil structure (D) Type of soil

61. Witwatersrand is famous for
(A) Diamond deposits (B) coal deposits
(C) Gold deposits (D) Copper deposits

62. Sudbury is well known for
(A) Barite deposits (B) Nickel deposits
(C) Lead-zinc deposits (D) Asbestos

63. Identify the syngenetic deposit
(A) Chromite deposits of layered complexes (B) Lode gold deposits
(C) Nickel laterites (D) Epithermal gold deposits

64. Horst and graben are formed by
(A) Reverse faulting and rifting (B) Normal faulting and rifting
(C) Transform faulting (D) Folding and rifting

(5)

Page 108

65. Oysters, clams, mussels, and cockles are
(A) Brachiopods (B) Pelecypods (C) Vertebrates (D) Arthropoda

66. The average density of oceanic crust is:
(A) 2.7 grams per cubic cm (B) 3 grams per cubic cm
(C) 4 grams per cubic cm (D) 5 grams per cubic cm

67. Greisen rock comprises of
(A) quartz + mica (B) plagioclase + pyroxene
(C) sillimanite + biotite (D) Olivine + pyroxene

68. Low velocity zone is situated in
(A) upper crust (B) lower mantle (C) upper mantle (D) inner core

69. Skarn rock will have the following minerals
(A) diopside + wollastonite + andradite (B) barite + fluorite + qaurtz
(C) sillimanite + cordierite + kyanite (D) hornblende + quartz + plagioclae

70. Beach sand deposition takes place when
(A) Swash is stronger than backwash (B) Swash is weaker than backwash
(C) Swash and backwash don’t matter (D) Swash and backwash are equally strong

71. Charnockitesis a rock of
(A) amphibolite facies (B) greenschist facies
(C) granulite facies (D) blueschist facies

72. Which binary system best explains the basalt
(A) albite-anorthite system (B) diopside-anorthite system
(C) alkali-feldspar system (D) forsterite-fayalite system

73. Ring of fire is well known for
(A) Cyclones (B) Flashfloods (C) Tsunamis (D) Landslides

74. Jaduguda mines in India are known for
(A) Iron deposits (B) Uranium deposits
(C) Manganese deposits (D) Bauxite deposits

75. Hornblende crystallises in
(A) Cubic system (B) Tetragonal system
(C) Triclinic system (D) Monoclinic system

x-x-x

(6)

Page 109

MSc(2Yr)(Human Genomics) (HG)

1. Which of the following does not help in distinguishing eukaryotes from prokaryotes
(A) Membrane bound organelles (B) Double stranded circular DNA
(C) Unicellular structure (D) Cell size

2. The first biological assay that implicated DNA as the primary genetic material used
(A) Staphylococcus aureus (B) Diplococcus pneumoniae
(C) Bacteriophage T2 (D) Escherichia coli

3. Which of the following is not the example of RNA virus
(A) SARS-CoV-2 (B) Influenza A virus
(C) Zika Virus (D) Adenovirus

4. Among the following which combinations does not specify any amino acid
(A) UAA, UAG, AUG (B) UAA, UAC, UCA
(C) UGA, UCA, UAG (D) UAA, UAG, UGA

5. Which combination of bases depicts equal percentage of purine and pyrimidine
(A) Adenine & Guanine (B) Cytosine & Thymine
(C) Guanine & Thymine (D) Uracil and Cytosine

6. In a linear sequence of nucleic acids the nucleotides at the extreme ends of a DNA or
RNA strand will have
(A) Same functional groups
(B) Different functional groups
(C) One amino group & one carboxy group
(D) One phosphate group & one deoxy group

7. Which one represents a false statement about transcription
(A) Sense DNA strand and primary RNA transcript are complementary to each other
(B) Template strand and primary RNA transcript are complementary to each other
(C) Primary RNA transcript is same as sense DNA strand
(D) The nucleotide sequence of primary RNA transcript is complementary to antisense
strand

8. Viruses that can infect a broad range of human cell types are said to have
(A) Low infectivity (B) Broad tropism
(C) Only DNA as the genetic material (D) Only RNA as the genetic material

9. Which of the following represents a viral infection in humans
(A) Alopecia (B) Tourette Syndrome
(C) Aphasia (D) Hunt syndrome
10. As per the color codes of waste segregation, blue color bins are to be used for
(A) Biodegradable waste (B) Medical waste
(C) Plastic waste (D) Non-recyclable waste

11. Circulatory system is an essential part of
(A) Direct cell to cell signalling (B) Autocrine signalling
(C) Paracrine signalling (D) Endocrine signalling

Page 110

12. Cellulose possess greater mechanical strength due to the presence of
(A) α (14) bonds (B) α (16) bonds
(C) β (14) bonds (D) β (16) bonds

13. In the CRISPR-CAS technology, CRISPR stands for
(A) Clustered regularly interspaced short palindromic repeats
(B) Central region interacting with short polymorphic repeats
(C) Copy repeat interspersed with short palindromic region
(D) Clustered region interacting specific palindromic repeat

14. Endemic diseases usually
(A) Affects larger number of individuals through out
(B) Affects local population of a smaller geographical region
(C) Affects multiple organs of a specie
(D) Crosses international boundaries

15. Which of the following amino acids would most likely be found in a membrane
spanning α-helix?
(A) Lysine (B) Glutamine (C) Alanine (D) Arginine

16. Which of the following statement incorrectly explains autoimmune diseases?
(A) Organ transplant is the cause
(B) Women develop much more often than men
(C) Manifestation can occur at any age
(D) Immune system fails to recognise self and non-self

17. Proteins can be easily visualized in gels by
(A) Using Ethidium bromide (B) Staining with appropriate dye
(C) Using electron microscopy (D) Measuring molecular weight

18. In isoelectric focussing, proteins can be separated on the basis of
(A) Molecular size only
(B) Relative content of positively and negatively charged residues
(C) Relative content of positively charged residues only
(D) Relative content of negatively charged residues only

19. A nonsense mutation results into
(A) Abnormal elongation of peptide (B) The phenomena of anticipation
(C) Premature termination of peptide (D) Substitution of residues in the peptide

20. Proteins are separated in an SDS-PAGE on the basis of their
(A) Charge to mass ratio (B) Molecular weight
(C) Positively charged side chains (D) Negatively charged side chains
21. DNA can be easily visualized in a native PAGE using
(A) Coomassie blue (B) Bromophenol blue
(C) Ethidium Bromide (D) Xylene cyanol

(2)

Page 111

22. In an allergic reaction, the chemical which is released in the body is
(A) Allergen (B) Histamine
(C) Antibody (D) Interferons

23. Enzyme which possesses both 5’- 3’ and 3’-5’exonuclease activity is
(A) DNA polymerase I (B) DNA polymerase III
(C) RNA polymerase I (D) RNA polymerase III

24. Recent human genetic studies reveal
(A) Clear distinction between monogenic & complex diseases
(B) Overlaps between monogenic & complex diseases
(C) Higher frequency of rare genetic diseases
(D) Reduced population growth rate

25. In statistics, normal distribution is represented by
(A) Hump curve (B) Slide curve
(C) Sigmoidal curve (D) Bell curve

26. To analyse if genetics plays a role in a particular phenotype, which of the following
studies are useful?
1. Family studies
2. Twin concordance studies
3. Adoption studies
4. Association Studies
(A) 1-2-4 (B) 1-2-3 (C) 2-3-4 (D) 1-2-3-4

27. Which of the following is NOT correct
(A) Bronze is an alloy of copper & tin
(B) Amalgam is an alloy of copper with another metal
(C) Steel is an alloy of iron & Nickel/chromium
(D) Brass is an alloy of copper & zinc

28. Which of the following statement correctly and completely explains Chromosome
theory of inheritance
(A) Behaviour of chromosome during mitotic division explains Mendel’s laws
(B) Chromosome is the basic unit of inheritance
(C) Genes are found at specific locations on chromosomes and behaviour of
chromosomes during mitosis explains Mendel’s laws of inheritance
(D) Genes are found at specific locations on chromosomes and behaviour of
chromosomes during meiosis explains Mendel’s laws of inheritance

29. If two genes are found to assort independently, it indicates
(A) Higher recombination rate between two
(B) Lower recombination rate between two
(C) Lower genetic map distance
(D) Less Crossing over

(3)

Page 112

30. A cross between homozygous dominant & heterozygous produces
(A) 1:2:1 phenotypic ratio (B) 3:1 genotypic ratio
(C) 1:1 phenotypic ratio (D) 1:1 genotypic ratio

31. Which of the following describes Lyon hypothesis correctly
(A) Inactivated X chromosomes present themselves as Barr bodies in humans
(B) Paternal X chromosome gets inactivated in early development stages in humans
(C) One of the two female X chromosomes get randomly inactivated during early
embryonic stage in humans
(D) Only one X chromosome gets inactivated to form barr body

32. The major difference between XX/XY and ZZ/ZW systems is
(A) In one sperm determines the sex and, in another, ovum determines the sex
(B) In one sperm is mutated and in another ovum is mutated
(C) One has more frequency of disease causation than other
(D) One represents animal system and another represents bird system

33. Which of the following is a intracellular second messengers?
(A) Glycine (B) Glutamate (C) IP3 (D) Acetylcholine
34. If a particular variation does not contribute to the fitness of the organism in any ways,
it is referred to as
(A) Silent variation (B) Null Variation
(C) Rare variation (D) Neutral variation
35. Which of the following is true about Tm
(A) The higher the content of G-C base pairs, higher is the Tm
(B) The higher the content of A-T base pairs, higher is the Tm
(C) Lower the content of G-C base pairs, higher is the Tm
(D) It is also named as renaturation temperature

36. Which of the following is not correct as per Hardy Weinberg Equilibrium
(A) Genotypic frequencies are same as allelic frequency for an X-linked locus in human
males
(B) Genotypic frequencies of an autosomal locus and an X-linked locus are calculated in
same manner in human females
(C) Genotypic frequency corelates with allelic frequency in a non-random mating
population
(D) Genotypic frequencies are corelated with allelic frequencies in a random mating
population
37. Which of the following proteins does not function in cell-cell interaction?
(A) Integrin (B) Cadherin (C) N-CAM (D) Cytochrome c
38. If phenotype of a heterozygote is completely different from the phenotypes of both
types of homozygotes, it is
(A) Dominance (B) Semi dominance
(C) Codominance (D) Allelic series
39. Which of the following occurs in meiosis but not in mitosis
(A) Replication of DNA prior to start of cell division
(B) Pairing of homologous chromosomes at metaphase plate
(C) Separation of sister chromatids at anaphase
(D) Attachment of spindle fibres to kinetochore

Page 113

40. Which of the following is an example of epimers?
(A) Mannose & Galactose (B) Mannose & Glucose
(C) Glucose & Galactose (D) Glucose & Ribose

41. The most abundant immunoglobulin is
(A) IgA (B) IgE (C) IgG (D) IgM

42. Where do T-lymphocytes develop fully competent but not activated T-cells
(A) Thymus gland (B) Thyroid gland
(C) Lymph nodes (D) Bone marrow

43. Which of the following presents antigenic peptide to T-cells in order to initiate an
adaptive immune response?
(A) Dendritic cell (B) Plasma cell
(C) Neutrophil (D) Epithelial cell

44. In computers, RAM stands for
(A) Random Access Memory (B) Rapid Available Memory
(C) Random available Memory (D) Rapid Access Memory

45. A computer cannot boot if it does not have
(A) Compiler (B) Operating system
(C) Loader (D) Assembler

46. Which of the molecular technique is best to identify recurrent translocations as in
leukemias
(A) Southern Hybridization
(B) Fluorescence in situ Hybridization
(C) Chromosomal microarray analysis
(D) Genome wide association analysis

47. Which one of the following sequencing features does not match with NGS
(A) NGS requires amplification of the starting DNA
(B) NGS works well with unamplified starting DNA
(C) NGS generally has less intrinsic error rates in base calling
(D) Significantly cheaper running cost per base

48. Why CT mutations in a CG dinucleotide are common in human DNA?
(A) Because C & T both are pyrimidines
(B) Because 5-methylcytosine deaminates to thymine and thymine being natural DNA
base, escapes base mismatch repair system
(C) Because deamination of cytosine produces Uracil, gets recognised by Uracil DNA
glycolase and is repaired by incorporating thymine in place of Uracil
(D) Because C & T, both can bind equally well with Guanine

49. At the abasic site, the residual sugar-phosphate is removed by endonuclease-
phosphodiestrase enzymes and the gap is filled by DNA polymerase & ligase activity,
such a repair system is named as
(A) Base mismatch repair (B) Nucleotide excision repair

Page 114

(C) Single strand break repair (D) Base excision repair

50. Humans have multiple copies of alpha amylase gene whereas human’s closest animal
relative, chimpanzee has only single copy of the same gene, this represents
(A) Adaptation as per altered environment where diet is rich in starch
(B) Evolution to make organism more complex
(C) Higher rate of mutation due to higher birth rate in human population
(D) Reduced genome stability within complex organisms

51. Adeno-associated virus vectors are often been used in preference to adenovirus vectors
because
(A) Adenoviruses are non-integrating and require booster dose
(B) Adeno-associated virus vectors are less immunogenic
(C) Adenovirus vectors have lower cloning capacity
(D) Adeno-associated virus vectors are mostly integrating and do not require booster dose

52. Histone acetylation results into relaxed chromatin conformation because
(A) Acetylation makes histones bulkier and therefore they loose contact with DNA
(B) Acetylated histone proteins have reduced affinity for negatively charged DNA
(C) Number of different enzymes are required for histone modification and they disrupt
the association with neighbouring nucleosome
(D) Acetylated histones recruit HP1 for chromatin remodelling

53. The variability in the drug response for a particular disease majorly occurs due to
(A) Dose variation (B) Genetic variation
(C) Hypersensitivity (D) Drug variability

54. Transduction-based gene therapy trials (GTTs) are preferred over transfection-based
ones because
(A) Transduction-based GTTs are safer than transfection-based GTTs
(B) Transfection-based GTTs have good efficiency but extraordinary transgene
expression
(C) Transduction-based GTTs have higher transgene expression
(D) Huge viral diversity is present for exploration

55. If the manifestation of a genetic disease displays parent of origin effect, it is known as
(A) Anticipation (B) Variable expression
(C) Imprinting (D) Penetrance

56. Exon skipping therapy is one of the genetic modification methods used to reduce the
pathogenicity of a mutation and its working principle is
(A) Skips the exon that carries the mutation
(B) Skips multiple exons to retain appropriate translational reading frame
(C) Skips all the exons to produce shorter product which can be degraded by NMD
(D) Skips all those exons which carry mutation
57. Restriction endonucleases recognize specific short sequence elements in a DNA
molecule. This property of these enzymes is therefore quite useful in the following type
of genetic study
(A) ELISA (B) CGH (C) GWAS (D) Genetic Mapping

Page 115

58. Haploinsufficiency, X-inactivation and Imprinting have one thing in common and that
is
(A) Higher potential for disease causation
(B) Mono-allelic expression
(C) Bi-allelic expression
(D) Altered by environmental effects

59. What does “https” in a web address mean?
(A) Hypertext transfer protocols
(B) Hyperlink for text transfer protocol with security
(C) Hypertext transfer protocol secure
(D) Hyperlink track transfer protocol safety

60. Plagiarism refers to an act of
(A) Reproducing same results as already shown by others through different mechanism
(B) Taking the experimental idea of another person and working on it
(C) Theft with respect to any property
(D) Analysing the someone else’s data

61. If a particular biochemical test “A” has probability 0.9 of being positive if steroids have
been used. Another test “B” has probability 0.8 if steroids have been used. What is the
probability that neither test is positive if steroids have been used?
(A) [0.3] (B) [0.02] (C) [0.72] (D) [-0.7]

62. The hypothesis which best explains why certain tumours can occur in hereditary or
sporadic form is
(A) Epigenetic hypothesis (B) Single-hit hypothesis
(C) Two-hit hypothesis (D) Multiple-hit hypothesis

63. Type I error is the error of
(A) No importance & hence rejected
(B) Instrumentation & not considered significant
(C) Mathematical calculation & is considered significant
(D) Statistical testing & is considered significant
64. Following of the statements are true with respect to Epigenetics
1. First explained by Waddington
2. Explains the interface between environment and molecular level
3. Transmits from one generation to another meiotically
4. Provides best explanation for rare genetic diseases
(A) 1-2 (B) 1-3 (C) 2-3 (D) 1-2-3
65. One of the following is an essential part of designing of an experiment and that is
(A) Literature survey
(B) Permission of supervisor
(C) Selection of positive and negative controls
(D) Multiple repetition

66. Which of the followingallows to find genes and genetic variations that affect health and
disease
(A) Physical Map (B) Linkage Map
(C) Heat Map (D) Hap Map

Page 116

67. The best technique to locate specific gene(s) in chromosomes, is
(A) Karyotyping (B) Sothern Hybridization
(C) Comparative genome hybridization (D) In situ hybridization

68. Chromosomal microarray analysis (CMA) is best to study
(A) Copy number variations of chromosomes
(B) Microdeletions & microduplications
(C) All types of copy number variations
(D) Microtranslocation

69. Multiple systems exist for labelling nucleic acids, which one of the following is not an
appropriate label for nucleic acid
(A) FITC (B) Digoxiginin (C) Biotin (D) Ethidium bromide

70. Quantitative Fluorescence PCR is a rapid method to analyse
(A) Microdeletions (B) Aneuploidy
(C) Structural variations (D) Substitutions

71. Exome sequencing is more useful for
(A) Identification of disease related variations
(B) Analysing 3D structures
(C) Discovery of complex diseases
(D) Identification of new genes

72. Which of the following techniques has the least risk involved
1. In vivo gene therapy
2. Ex vivo gene therapy
3. Preimplantation genetic diagnosis
4. Fetoscopy
(A) 1-2-4 (B) 2-3-4 (C) 1-4 (D) 2-3

73. Phenomenon where a chemical compound tends to exist in two or more interconvertible
structures due to relocation of hydrogen atoms is referred to as
(A) Resonance (B) Tautomerism (C) Metamerism (D) Epimerism
74. Human genome project primarily included sequence analysis for
1. Euchromatin region
2. Heterochromatin region
3. Mitochondrial DNA
4. Repetitive Sequences
(A) 1-2-3-4 (B) 1-2-3 (C) 1-2 (D) 1-2-4

75. IGVdb stands for
(A) Integrated Genetic variety database
(B) Indian Genome variation database
(C) International Genetic Variation database
(D) Inherent Genetic variation database

x-x-x

Page 117

(L.L.M.)
1. Consider the following statements pertaining to Article 309 of the Constitution that is
regulating the service conditions of employees:
(A) Rules made by the President will be applicable irrespective of any Act passed by
the Parliament
(B) Rules made by the Governor will be applicable irrespective of any Act passed by
State Legislature
(C) Both A and B
(D) Rules made by President or Governor are subject to any Act passed by Parliament
or State Legislature

2. Consider the following statements regarding Administrative Tribunals?
1. They are quasi-judicial bodies
2. They resolve disputes related to service conditions
3. Provision regarding administrative Tribunal are incorporated in Constitution
4. They are created both by Parliament and State Legislature

Choose the correct answer
(A) Both 1 and 2 (B) 1 , 2 and 3
(C) 1, 2 , 3 and 4 (D) None of the above

3. Which of the following principles of AV Dicey pertaining to Rule of Law is not
applicable in India?
(A) Supremacy of Law (B) Equality before the Law
(C) Predominance of legal spirit (D) None of these

4. The theory of Separation of Powers is well founded in:
(A) Federal form of government (B) Presidential form of government
(C) Parliamentary form of government (D) All the above

5. The famous “Wednesbury Test” under administrative law is related to which of the
following Doctrine?
(A) Audi Alteram Partem (B) Natural Justice
(C) Judicial review (D) Separation of Powers

6. Which of the following fundamental rights is not available to foreign nationals ?
(A) Article 19 (B) Article 20 (C) Both A and B (D) None of these

7. Chairperson of National Green Tribunal is appointed by ?
(A) Chief Justice of India
(B) Central Government
(C) Parliament
(D) Senior most Judge of Supreme Court is automatically appointed

8. 104th Constitutional Amendment pertains to:
(A) Constitutional Status to National commission for Backward Classes
(B) Reservation for Economically Weaker Sections
(C) Restore the power of State Govt. to identify OBC’s
(D) Remove the reserve seats for Anglo-Indian community

Page 118

9. Match the following :
a) Ihering i) Solidarity
b) Herbert Spencer ii) A social Utilitarian
c) Comte iii) Organic theory of society
d) Duguit iv) Scientific Positivism
Code : a) b) c) d)

(A) ii iii iv i

(B) ii iv iii i

(C) iii ii iv i

(D) i ii iii iv

10. Which of the following features of Indian Constitution borrowed from USA?
(A) Judicial Review
(B) Procedure Established by Law
(C) Advisory Jurisdiction of Supreme Court
(D) None of the Above

11. Choose the correct statement with respect to right of self determination?
(A) It refers to the right of an individual to determine his own destiny
(B) It is incorporated in Article 1 of UN Charter
(C) Both A and B
(D) In India there are no restriction on right of self determination

12. Consider the following statements with respect to Preamble ?
(A) Word integrity was added through 42nd amendment
(B) It is non Justiciable
(C) Both A and B
(D) It acts as a source of power for Legislature

13. With respect to pardoning powers of Governor consider the following statements?
(A) Governor can commute the death sentence
(B) Governor can pardon the death sentence
(C) Governor has pardoning powers with respect to Union Laws
(D) Pardoning powers of Governors are restricted by Criminal Procedure Code

14. Ramsar Convention deals with conservation of?
(A) Conservation of Birds (B) Conservation of Wetlands
(C) Conservation of Tiger (D) Conservation of Agriculture lands

15. Vishakha v State of Rajasthan justified it’s decision based on multiple sources. They
are:
i) CEDAW
ii) Beijing Statement of Principles of the Independence of the Judiciary
iii) Legitimate Expectation Principle
Which among the above statements is/are true?
(A) Only (i) (B) (i) and (ii) (C) (ii) and (iii) (D) All of these

Page 119

16. Theory of Recognition under international law is:
(A) Traditional Theory (B) Declaratory/Evidentiary Theory
(C) Monistic Theory (D) Dualistic Theory
17. As per Model law on Extradition, Conditions for extradition are:
(A) The fugitive must be an Extraditable Person.
(B) The fugitive must have committed Extraditable Crime
(C) Rule of Double Criminality
(D) All of the above

18. Environment Protection Act , 1986 came into force on :
(A) 9th January 1986 (B) 10th April 1986
(C) 19th November 1986 (D) 1st January 1987

19. As per Water Act, 1974 the Prohibition on use of stream or well for disposal of polluting
matter carries penal consequences of :
(A) Min. 1 year imprisonment and max. six years
(B) Min. one year and six months imprisonment and max. six years
(C) (A) and Fine
(D) (B) and Fine

20. As per Wildlife Protection Act, 1972, vermin means any wild animal specified in :
(A) Schedule II (B) Schedule III (C) Schedule IV (D) None of these

21. Arjun Panditrao Khotkar vs Kailash Kushanrao Gorantyal is a landmark Judgement
on:
(A) Electronic Evidence (B) Tape recorded Evidence
(C) Dying Declaration (D) Conclusive proof of marriage

22. Who can be the adverse party with reference to section 137 of Indian Evidence Act ?
(A) Plaintiff (B) Defendant
(C) Proforma Defendant (D) Both A and B

23. Match the following
a) Exploitation of a trafficked person 1. S. 366 B
b) Importation of a girl from a foreign country 2. S. 366 A
c) Kidnapping for ransom 3. S. 364 A
d) Procuration of a minor girl 4. S. 370 A
Code : a) b) c) d)
(A) 1 4 2 3
(B) 2 3 1 4
(C) 3 2 4 1
(D) 4 1 3 2

24. Match the correct ones :
a) R v Tanday 1. S. 81 IPC
b) S. Varadarajan v State of Madras 2. S. 76 IPC
c) R v Tolson 3. S. 304B IPC
d) Harjit Singh v State of Punjab 4. S. 363 IPC
e) R v Dudley and Stephens 5. S. 86 IPC
(3)

Page 120

Code : a) b) c) d) e)
(A) 1 5 4 2 3
(B) 3 2 1 4 5
(C) 5 4 2 3 1
(D) 2 3 5 1 4

25. Doctrine of Res Ispa Loquitor is embedded in which section of Indian Evidence Act?
(A) Section 106 (B) Section 6 (C) Section 92 (D) Section 102

26. Consider the following statements with respect to Leading Questions:
(A) They cannot be asked in Examination in Chief if objected
(B) They can be asked in Cross Examination even if objected
(C) Both A and B
(D) Only B

27. With respect to section 113A of Indian Evidence Act Presumption as to abetment of
suicide by a married women consider the following statements:
1. Suicide is after the 7 years of marriage
2. She was subjected to cruelty
3. By Husband or his relatives
4. Court shall Presume that suicide had been abetted by her husband or by his relative
Choose the correct option
(A) 1, 2, 3 and 4 are correct (B) 2, 3 and 4 are correct
(C) 2 and 3 are correct (D) 1, 2 and 3 are correct

28. Consider the following statements with respect to recording of confessions and
statements by Judicial Magistrate under Chapter 12 of Criminal Procedure Code:
1. The Statement cannot be recorded by Judicial Magistrate if he does not have
Jurisdiction
2. Statement is recorded under oath
3. If person refuses to make a confession Magistrate will authorise the detention of
such person in Police custody
4. Confession is not recorded under Oath
Choose the Correct option:
(A) 1 and 2 are correct (B) 1, 2 and 4 are correct
(C) 2 and 4 are correct (D) 2, 3 and 4 are correct

29. Who among the following can prosecute for offences against marriage under Chapter
20 of IPC?
(A) State
(B) Person aggrieved of offence
(C) Any person can prosecute since it is a criminal offence
(D) Relatives of such Person

(4)

Page 121

30. With reference to Powers of Court to examine accused under Section 313 of Code of
Criminal Procedure choose the correct statement?
(A) Court can examine the accused at any stage only after warning the accused
(B) If he gives false answers he will not render himself liable to punishment
(C) Such examination will be on oath
(D) Court is not bound to examine accused after witness for prosecution has been
examined

31. Choose the wrong statement with reference to statements given to police:
(A) It need not be signed by the person making it
(B) It can be used for corroboration
(C) Such statement can be used for purposed of Section 27 of Indian Evidence Act
(D) A material omission may also amount to contradiction

32. Criminal Identification Act 2022 relates to:
(A) Biometrics of Accused (B) Test identification parade
(C) Records of dead body (D) All of these

33. Under section 125 of Code of Criminal procedure wife is not entitled to maintenance:
(A) If she is living in adultery
(B) Living separately by mutual consent
(C) Refused to live with her husband without any sufficient reason
(D) All of the above

34. A finds a valuable ring, not knowing to whom it belongs. A sells it immediately without
attempting to discover the owner. A is:
(A) Guilty (B) Not Guilty (C) Guilty of Theft (D) Guilty of Extortion

35. Who said, “Men who are guilty of crimes when condemned by the king become pure
and go to heaven in the same way as good and virtuous men go”?
(A) Austin (B) Bentham (C) Manu (D) Socrates
36. Match the correct ones :
a) Punishment for belonging to a gang of dacoits 1. S. 399 IPC
b) Assembling for purpose of committing dacoity 2. S. 400 IPC
c) Five or more persons conjointly committing or 3. S. 402 IPC
attempting to commit a robbery
d) Preparation to commit dacoity 4. S. 391 IPC
Code: a) b) c) d)
(A) 4 1 3 2
(B) 1 4 2 3
(C) 2 3 4 1
(D) 3 2 1 4
37. What is minimum punishment provided in Indian Penal Code?
(A) One month (B) Two months (C) 24 hours (D) 7 days

(5)

Page 122

38. In IPC an offence of cheating can happen with respect to:
(A) Property (B) Person (C) Both A and B (D) None of these

39. Age of Consent in Indian Penal Code is:
(A) 7 years (B) 12 years (C) 16 years (D) 18 years

40. Choose the correct statement with respect to Abetment of Conspiracy and Conspiracy
to commit an offence under section 120A:
(A) In Conspiracy to commit an offence an overt act is not necessary
(B) In abetment to conspiracy overt act is not necessary
(C) Both A and B
(D) None of the Above

41. With respect to Pigeon Hole theory choose the correct answer:
(A) All injuries done by one person to another are torts unless there is some justification
recognized by law
(B) There is a definite number of torts outside which liability in tort does not exist
(C) It is given by Winfield
(D) None of the above

42. The famous case of Donoghue vs Stevenson is based on which of the following tort:
(A) Strict Liability (B) Negligence
(C) Volenti Non Fit Injuria (D) Malicious Prosecution

43. Choose the wrong answer with respect to Doctrine of Sovereign Immunity:
(A) State or the sovereign can commit no legal wrong and is immune from civil suits
and criminal prosecution
(B) State of Rajasthan vs Vidyawati is based on this doctrine
(C) It applies to Government contract
(D) It does not apply to Public Law remedies for the enforcement of Fundamental

Rights

44. The maxim ‘Novus Actus Interveniens’ is related to:
(A) Remoteness of Consequences (B) Possible Consequences
(C) Direct Consequences (D) None of these

45. Which of the following sections of Specific Relief Act deals with the Declaratory
Decree?
(A) Section 33 (B) Section 35 (C) Section 31 (D) Section 34

46. Works committee, safety management committee and canteen committee are examples
of:
(A) Workers education schemes (B) Workers cooperatives
(C) Workers Participation (D) Workers suggestions

47. In case of Misleading advertisement penalty can be imposed upon:
(A) Manufacturer
(B) Service Provider
(C) Endorser and Publisher of such Misleading Advertisement

Page 123

(D) All of the Above

48. The recent case of Vineeta Sharma vs Rakesh Sharma deals with the following sections
of Hindu Succession Act?
(A) Section 6 (B) Section 15 (C) Section 16 (D) Section 8

49. Consider the following statements with respect to Judicial Separation and Divorce:
1. In a petition for divorce court can pass decree of judicial separation even if not
claimed by parties
2. Divorce petition cannot be entertained prior to one year since the date of marriage
3. Wife has special four grounds of divorce in addition to grounds mentioned in
section 13(1)
4. Saroj Rani vs Sudarshan Kumar is a landmark case on cruelty
Choose the correct option
(A) 1 and 4 are correct (B) 1,2,3 are correct
(C) 2 and 3 are correct (D) 1,2,3,4 are correct

50. Under Muslim Law Mother’s right to have custody of minor child is known as:
(A) Hizanat (B) Hazina (C) Khula (D) Ahula

51. Who are the natural guardians under Section 6 of Hindu Minority and Guardianship
Act ?
(A) Testamentary Guardian (B) Father
(C) De Jure guardian (D) All of these

52. Doctrine of Lis Pendens is incorporated in which of the sections of Transfer of Property
Act?
(A) Section 51 (B) Section 52 (C) Section 55 (D) Section 62

53. Which of the following describes the Doctrine of Subrogation under section 92 of
transfer of property Act?
(A) Any person apart from the mortgagor who has an interest in the mortgaged property
or in the equity of redemption, is entitled to be subrogated in place of mortgagee
(B) Any person including the mortgagor who has an interest in the mortgaged property
or in the equity of redemption, is entitled to be subrogated in place of mortgagee
(C) Both A and B
(D) None of the Above

54. In which of the following mortgages, the mortgagor is required to deliver possession of
the mortgaged property to the mortgagee?
(A) English mortgage (B) Mortgage by conditional sale
(C) Usufructuary mortgage (D) Anomalous mortgage
55. Choose the wrong statement with respect to Decree ?
(A) Decree can be both Preliminary and final
(B) Appeal can be filed even on Preliminary Decree
(C) If time of appeal of preliminary decree has expired then it cannot be appealed from
in an appeal against final decree
(D) Return of Plaint has a status of deemed decree

(7)

Page 124

56. With the respect to Mesne Profits choose the wrong statement?
(A) Profits which the person in wrongful possession of such property actually received
(B) Profits which the person in wrongful possession of such property might have
received
(C) Does not include profits due to improvement made by person in wrongful
possession
(D) None of the above is wrong

57. Choose the wrong Statement with respect to Second Appeal under Section 100 of Code
of Civil Procedure:
(A) It can lie to Session Court
(B) It can be filed only on substantial question of Law
(C) In case of recover of money below 25 thousand rupees no second appeal can be
filed
(D) Court can also hear on any other substantial question of law not formulated by it

58. Ravinder Grewal vs Manjit Kaur is related to which of the following concepts of
Limitation Law?
(A) Condonation of Delay
(B) Effect of Acknowledgement
(C) Acquisition of Easement by Prescription
(D) Adverse Possession

59. Which of the following Legal Disabilities are covered under Section 6 of Limitation
Act?
(A) Minor (B) Idiot (C) Physical disability (D) Both A and B

60. Consider the following statements with respect to Acknowledgement of Liability under
Section 18 of Limitation Act:
1. Acknowledgement can be before the expiration of prescribed period
2. Acknowledgement can be after the expiration of prescribed period
3. It can be written or oral
4. It furnishes a new cause of action
Choose the correct answer
(A) Only 1 is correct (B) 1 and 3 are correct
(C) 1 and 4 are correct (D) 1,2,3,4 are correct

61. Absolute and unqualified acceptance under Section 7(1) of the Indian Contract Act
means:
(A) It should not be conditional (B) It should not be partial; and
(C) It should not be provisional (D) All above

62. “A contract which ceases to be enforceable by law becomes void when it ceases to be
enforceable” is dealt with which section:
(A) Section 2(g) (B) Section 2(j) (C) Section 2(i) (D) Section 2(h)

63. What is Nature of a contract under Indian Law where fraud is committed by one party
but the consent of others is not caused by fraud:
(A) Valid (B) Void (C) Voidable (D) Invalid

Page 125

64. What is nature of an Agreement to which the consent of the promisor is freely given
but the consideration is inadequate:
(A) Valid (B) Void (C) Voidable (D) Invalid

65. In which case it was held by the Apex Court that a wagering agreement is void and
unenforceable but it is not forbidden by law:
(A) Gherulal Parakh v Mahadeodass (B) Badridas Kothari v Meghraj Kothari
(C) Gulam Mustaffakhan v Padamsi (D) Satyabrata Ghosh v Mugneeram

66. The consideration must be:
(A) Need not be adequate (B) Adequate
(C) Substantially adequate (D) None of these

67. Khan Gul vs Lakha Singh is a case on :
(A) Minors contract (B) Section 33 of Specific Relief Act
(C) Both A and B (D) Offer must be communicated

68. As per Section 12 of the Sale of Goods Act 1930 a stipulation may be:
(A) Condition (B) Warranty (C) Both A and B (D) None of these

69. Which of the following(s) is/are exception(s) to General Rule relating to transfer of title
i.e., Nemo dat quod non habet (nobody can give what he has not got)
(A) Sale under the implied authority of the owner, or transfer of title by estoppel
(B) Sale by a mercantile agent.
(C) Sale by one of the joint owners
(D) All above

70. Which of the following are methods for Termination of the right of stoppage in Transit
under the The Sale Of Goods Act, 1930:
(A) When the buyer takes delivery
(B) When the carrier or the other bailee acknowledges to the buyer
(C) When the carrier wrongfully refuses to deliver the goods to the buyer
(D) All of the above

71. As per the Company Act 2013, the minimum number of members which are required
while for registering a public company is:
(A) 2 (B) 6 (C) 7 (D) 5

72. Which Section of the Company Act 2013 deals with Content of Memorandum of
Association :
(A) Section 12 (B) Section 6 (C) Section 4 (D) Section 15

73. A company can change its articles by passing:
(A) Ordinary resolution (B) Normal resolution
(C) Special Resolution (D) None of the above

Page 126

74. With respect to four labour codes passed by Parliament recently consider the following
statements?
1. Code on Wages 2019 applies to workers in organized sector only
2. Code on occupation safety 2020 seeks to regulate the health and safety conditions
of workers in establishments with 10 or more workers, and in all mines and
docks
3. The Code on Social Security, 2020 consolidates law related to social security
and maternity benefits
4. The Code on Industrial Relations, 2020 seeks to consolidate three labour laws
namely, The Industrial Disputes Act, 1947: The Trade Unions Act, 1926 and
The Industrial Employment (Standing Orders) Act, 1946
Choose the correct option
(A) 1 and 3 are correct (B) 3 and 4 are correct
(C) 2,3 and 4 are correct (D) 1,2,3,4 are correct

75. An instrument in writing containing an unconditional order, signed by the maker,
directing a certain person to pay a certain sum of money only to a certain person, or to
the order of, or the bearer of the instrument is:
(A) Promissory Note (B) Bill of Exchange
(C) Cheque (D) None of these

76. Types of crossing of the cheque under the NI Act can be:
(A) General Crossing (B) Special/Restrictive Crossing
(C) Both (A) & (B) (D) None of these

77. Types of dissolution of the partner firm are:
(A) Dissolution by agreement
(B) Compulsory dissolution
(C) Dissolution on the happening of certain contingencies
(D) All of the Above

78. Where no provision is made by contract between the partners for the duration of their
partnership, or for the determination of their partnership, the partnership is:
(A) Partnership at will (B) Partnership for a fixed term
(C) Both (A) & (B) (D) None of these

79. Under which Section of LLP Act 2008 definition of LLP is given as partnership formed
and registered under the LLP Act:
(A) Section 2(m) (B) Section 2(n) (C) Section 2(o) (D) Section 2(p)

80. Types of Anti-competitive agreements mentioned under Indian Competition Act 2002
are:
(A) Horizontal (B) Vertical (C) Both (A) &(B) (D) None of these

81. What is the normal time limit for disposal of the RTI request from the date of its

receipt?

(A) 15 days (B) 20 days (C) 30 days (D) 45 days

Page 127

82. Under Section 7(9) of RTI Act, 2005, information shall ordinarily be provided in the
form in which it is sought unless it would:
(A) Disproportionately divert the resources of the public authority
(B) Would be detrimental to the safety or preservation of the record in question
(C) Both(A) and (B)
(D) None of these

83. Which section(s) of RTI Act, 2005 mention(s) “exemption from disclosure of
information”?
(A) Section 5 (B) Section 6 (C) Section 7 (D) Section 8

84. Under Section 6(3) of RTI Act, 2005 the CPIO of one public authority has to transfer
the application to another public authority within how many days of its receipt?
(A) three days (B) five days (C) two days (D) six days

85. In which year the United Nation's Principles on Freedom of Information, were adopted:
(A) 2000 (B) 2001 (C) 2002 (D) 2003

86. A second appeal against the decision under section 19(3) shall lie within _____ days
from the date on which the decision should have been made or was received, with the
Central Information Commission or the State Information Commission:
(A) 30 (B) 60 (C) 90 (D) 120

87. Who has power to revoke and suspend the licence of the Certifying authority under the
Information Technology Act, 2000 as amended in 2008 which :
(A) The Controller of the Certifying authority
(B) The Controller of the companies
(C) Central Government
(D) State government

88. Compensation for failure to protect sensitive personal data is mentioned in the
following section of the Information Technology Act 2000 as amened in 2008:
(A) Section 43 (B) Section 43A (C) Section 44 (D) Section 44A

89. Which section of the Information Technology Act 2000 as amended in 2008 deals with
the validity of contracts formed through e-form:
(A) Section 9 (B) Section 9A (C) Section 10 (D) Section 10A

90. Which section of the Information Technology Act 2000 as amened in 2008 punishes
the Theft of identity?
(A) Section 66B (B) Section 66C (C) Section 66D (D) Section 66E

91. Maximum punishment for Publishing or transmitting material depicting children in the
sexually explicit act, etc., in e-form upon first conviction is:
(A) Imprisonment up to 5 Years and fine up to 10 lakh rupees
(B) Imprisonment up to 5 Years and fine up to 15 lakh rupees
(C) Imprisonment up to 7 Years and fine up to 10 lakh rupees
(D) Imprisonment up to 7 Years and fine up to 15 lakh rupees

(11)

Page 128

92. Provisions of which Act provide that cyber offence punishable with imprisonment of
three years and above must be cognizable and the offence punishable with
imprisonment of three years must be bailable:
(A) The Information Technology Act 2000
(B) The Information Technology Act 2000 as amended in 2008
(C) IPC, 1872
(D) Cr PC, 1973

93. As per Indian Copyright Law, Fair use does not mean:
(A) Use for research (B) Use for review
(C) Use for non-commercial purposes (D) Use for commercial purposes

94. Berne Convention of 1886 was for :
(A) Protection of Literary and Artistic Works
(B) For Performances and Phonograms
(C) For Trade Marks
(D) Patent

95. Patent Cooperation Treaty (P.C.T), 1970 was signed at:
(A) Washington (B) Davos (C) Singapore (D) Russia

96. Under which Section Invention under the Indian Patent Act, 1970 means a new product
or process involving an inventive step and capable of industrial application.
(A) Section 2(1)(i) (B) Section 2(1)(j) (C) Section 2(1)(k) (D) Section 2(1)(l)

97. The Trademark Act came into force:
(A) 1957 (B) 1970 (C) 2000 (D) 1999

98. Choose the correct statement with respect to Trademark Act 1999:
(A) A person who is owner of unregistered Trade Mark cannot sue for damages if
infringement happens
(B) A person who has registered trademark has the exclusive right to use against
another person who is owner of same trademark but is unregistered
(C) Trademark devoid of any distinctive character can be registered
(D) None of the Above

99. Which Section of Design Act, 2000 deals with
(A) Section 3 (B) Section 4 (C) Section 5 (D) Section 6

100. The Basmati Controversy was an eye opener and after that Indian enacted
(A) Patents Act (B) Geographical Indication Act
(C) Trademark Act (D) None of the Above

x-x-x

Page 129

M.Tech.(Material Science & Technology) M. Tech (MST)

1. In the Michelson interferometer, the compensating plate is used for
(A) inducing symmetry in the optical elements.
(B) compensating the extra path traversed by reflected waves during splitting of beam.
(C) getting circular shape of interference fringes.
(D) replacing bright central fringe with dark one.

2. The role of Helium atoms in the He-Ne laser is to
(A) help in excitation and population inversion of Neon atoms
(B) help in maintaining optical resonance
(C) result in the emission of red colour light
(D) absorb
3. The colours observed on the surface spilled on the roads are due to
(A) Thin film interference.
(B) Newton ring formation.
(C) Dispersion of light by the oil film.
(D) Total internal reflection of light.

4. A ray of light strikes a glass plate at an angle of 60o. If the reflected and refracted light are
perpendicular to each other, the refractive index of the glass is
(A) 1.3 (B) 2.1 (C) 1.9 (D) 1.7
5. In the Young’s double slit experiment performed with white light, the colour of the central fringe
will be
(A) white (B) black (C) red (D) violet
6. The pumping source for ruby laser is
(A) Electrical discharge (B) Xenon flash lamp
(C) Chemical luminescence (D) Plasma formation

7. Which of the following is not a characteristic of a under-damped oscillating systems :
(A) frequency of oscillations is lower than that for free oscillator.
(B) amplitude of oscillations decreases with each oscillation.
(C) energy of the oscillating system remains is conserved throughout the process of
oscillation.
(D) dissipative forces are smaller than the restoring forces.
8. The forced series LCR electrical oscillator is not characterised by which of the following
properties
(A) At resonance, the inductive and capacitive reactance counterbalance each other
(B) The current is maximum at resonance
(C) The power absorption from source is minimum at resonance
(D) Oscillation frequency solely depends upon the inductance and capacitance at resonance
9. When electromagnetic wave propagates through a dielectric medium, then
(A) Electric and magnetic fields oscillate in phase and with same frequency.
(B) Electric and magnetic fields oscillate in phase but not with same frequency.
(C) Magnetic field oscillates with a phase lag relative to electric field.
(D) Electric field oscillates with a phase lag relative to magnetic field.
10. The relative permittivity of the medium is 3.24. The refractive index of this medium will be:
(A) 2.2 (B) 1.8 (C) 1.6 (D) 2.0

11. The Poynting vector associated with an electromagnetic wave gives the information about:
(A) power flux and direction of propagation of EM wave.
(B) frequency of EM wave.

Page 130

(C) rate of oscillations of electric and magnetic field intensities.
(D) dispersive power of the medium through which EM wave is propagating.

12. A mass (m = 1g) executes simple harmonic motion with a time period of 0.2 seconds on attaching
to a vertical spring. What is the stretching of the spring on attaching this mass?
(A) 0.5 cm (B) 0.025 cm (C) 0.25 cm (D) 0.75 cm

13. The de-Broglie wavelength of an electron accelerated from rest on application of potential of 400
V is:
(A) 0.165 Ǻ (B) 0.512 Ǻ (C) 0.613 Ǻ (D) 0.251 Ǻ

14. The wave function of a certain particle is  = 𝐴 𝑒  for 0 < x < L. The value of
normalization constant A is
(A) √ (B) √ (C) (D)

15. A pendulum of length L having supporting mass M swings back and forth with period T. If the
mass is doubled, what is the new period?

(A) T (B) T/2 (C) 2T (D) T2

16. In a photocell, if the threshold wavelength for a metal surface is 580 nm, the work function of
the metal is
(A) 3.62 eV (B) 2.14 eV (C) 1.14 eV (D) 2.70 eV

17. Wein’s displacement law is associated with
(A) Black body radiation spectrum (B) Photoelectric effect
(C) Compton effect (D) Polarization

18. The wavelength of scattered X-rays (with wavelength 1.4 Å) when scattered from a block of
carbon at 180° is
(A) 0.024 Å (B) 0.048 Å (C) 1.45 Å (D) 1.40 Å

19. The probability current of a particle in 1st excited state of 1-D rigid box of length L is given by
(A) ħk/m (B) ħk (C) 0 (D) ħk/2

20. The zero point energy for a neutron confined in nucleus, by treating it as if it an infinite square well
of width equal to nuclear diameter of 10-14 m is
(A) 2.2 MeV (B) 4.1 MeV (C) 3.1 MeV (D) 7.2 MeV

(2)

Page 131

21. Which of the following statements is true for the given reaction taking place at temperature T?
qp and qv are the heat of reaction at constant pressure and volume respectively.

AgNO3(s)+ HCl(g) → AgCl(s) + HNO3(l)
(A) qP = qV+ RT (B) qP = qV- RT
(C) qP = qV (D) qP = qV -2RT

22. The criterion of spontaniety for a process taking place at constant volume and constant entropy of
the system is
(A) ΔG ≤ 0 (B) ΔH ≤ 0 (C) ΔU ≤ 0 (D) ΔG ≥ 0

23. How does deuterium substitution of hydrogen effect the vibrational spectra of HCl?
(A) The vibrational frequency doubles.
(B) The vibrational frequency decreases by a factor of 2.
(C) The vibrational frequency increases by a factor of √2.
(D) The vibrational frequency decreases by a factor of √2.

24. Number of translational, rotational and vibrational degrees of freedom in CO2 are, respectively,
(A) 3, 2, 4 (B) 3, 4, 2 (C) 3, 3, 3 (D) 4, 3, 2

25. Polydispersity index (PDI) of a polydisperse polymer is
(A) 0 (B) 1 (C) < 1 (D) > 1

26. What is the overall rate of polymerization at the ceiling temperature?
(A) Can’t be determined (B) Zero
(C) Exceptionally low (D) Exceptionally high

27. Which of the following statements about a plot of rate (V) vs. Substrate concentration [S] for an
enzyme that follows Michaelis-Menten kinetics is false?
(A) As [S] increases, the initial velocity of reaction, V, also increases.
(B) Km is the [S] at which V = ½ Vmax.
(C) At very high [S], the velocity curve becomes a horizontal line that intersects the y-axis
at Km.
(E) At very high [S], the reaction shows zeroth order kinetics with respect to [S].

Page 132

28. The stability of an ionic compound is because of its
(A) Lattice energy (B) Electron affinity(C) Ionization energy(D) Electronegativity

29. The hybridisation of carbon in CO2 is

(A) sp (B) Sp² (C) Sp³ (D) None

30. The correct order of their non-metallic character is
(A) B> C> Si>N> F (B) Si > C> B>N> F
(C) F>N> C> B> Si (D) F>N> C> Si > B
31. How many EDTA (ethylenediaminetetraacetic acid) molecules are required to make an
octahedral complex with a Ca2+ ion?
(A) Six

(B) Three

(C) One

(D) Two

32. Percentage of free space in a body centred cubic unit cell is

(A) 32%

(B) 34%

(C) 28%

(D) 20%

33. Which one of the following is an example for homogenous catalysis?

(A) Hydrogenation of oil

(B) Manufacture of ammonia by Haber's process
(C) Manufacture of sulphuric acid by Contact process
(D) Hydrolysis of sucrose in presence of dilute hydrochloric acid

34. Which of the following has the maximum number of unpaired ‘d’ electrons?
(A) Zn2+ (B) Fe2+ (C) Ni3+ (D) Cu+

35. One dm3 solution containing 10–5 moles each of Cl– ions and CrO4–2 ions is treated with 10–4 mole
of silver nitrate. Which one of the following observations is made?
[KSPAg2CrO4 = 4 × 10–12], [KSPAgCl = 1 × 10–10]

(A) Silver chromate gets precipitated first
(B) Precipitation does not occur
(C) Both silver chromate and silver chloride start precipitating simultaneously
(D) Silver chloride gets precipitated first

Page 133

36. The pair of compounds having metals in their highest oxidation state is
(A) MnO2, FeCl3 (B) [MnO4]–, CrO2Cl2
3–
(C) [Fe(CN)6] , [Co(CN)3] (D) [NiCl4]2–, [CoCl4]–

37. The value of the ‘spin only’ magnetic moment for one of the following configurations is 2.84
BM. The correct one is
(A) d4 (in strong ligand filed)
(B) d4 (in weak ligand field)
(C) d3 (in weak as well as in strong fields)
(D) d5 (in strong ligand field)

38. Two isomers having non-super imposable mirror images are known as
(A) Diastereomers (B) Enantiomers(C) Meso compounds (D) None of the above
39. Monomer(s) involved in the synthesis of Nylon-66 polymer is/are
(A) Caprolactam (B) Adipic acid
(C) Hexamethylene diamine (D) Adipic acid and hexamethylene diamine

40. Out of following, what is the correct formula of Wilkinson’s catalyst
(A) [Rh (PPh3)4] (B) [Rh Cl3(PPh3)] (C) [Rh Cl (PPh3)3] (D) [Rh Cl2 (PPh3)2]

41. How many stereoisomers are possible in the case of Tartaric acid?
(A) 1 (B) 2 (C) 3 (D) 4

42. Which of the following alkenes will absorb ultraviolet light at longer wavelength?
(A) 1,3-butadiene (B) 1,4-pentadiene
(C) 1,4-Hexadiene (D) Ethene

43. Among following molecules, HCl, O2, CO2, SO2, H2O, N2, identify those which are infrared (IR)
active molecules.
(A) CO2 and SO2 (B) HCl, CO2, SO2 and H2O
(C) O2 and N2 (D) All are IR active
44. Which of the following is not an allotrope of carbon
(A) Diamond (B) Graphite (C) Dendrimer (D) Carbon nanotube

45. Which of the following cubic cell has minimum packing fraction
(A) Simple Cubic Cell (B) Body Centre Cubic Cell
(C) Face Centre Cubic Cell (D) Hexagonal Cubic Cell
46. In the polycrystalline structures, the grain boundaries are not characterised by property that
(A) Atomic packing is loose
(B) Prone to diffusion and chemical activity
(C) Form cleavage surfaces in the crystals
(D) The mechanical strength is maximum

Page 134

47. The number of four-fold rotation axes in a cubic unit cell are
(A) 7 (B) 9 (C) 3 (D) 5

48. Which of the following information about crystal is not yielded by X-ray diffraction studies:
(A) Dimensions of unit cell of the crystal
(B) Shape of the unit cell of the crystal
(C) Symmetries observed by the crystal
(D) Atoms or molecules or group of atoms occupying lattice positions

49. Silver has FCC structure. If inter-atomic separation between atoms 0.288nm then lattice constant
is
(A) 0.204nm (B) 0.408nm (C) 0.144nm (D) 10nm
50. Which of these is not a ferroelectric material
(A) Rochelle salt (B) Potassium Diphosphate
(C) SrTiO3 (D) Quartz

51. Which of the following are temperature independent
(A) ferromagnetism (B) paramagnetism (C) ferrimagnetism (D) diamagnetism

52. Which is not true about effective mass of electron in a crystal:
(A) it is positive within the allowed energy regions
(B) it is zero at the topmost level of band
(C) it is negative in the forbidden zone
(D) always remains positive

53. Which of the following phenomena indicate the onset of superconductivity
(A) Very high electric resistance and high thermal conductivity
(B) Nearly zero electric resistance and perfect diamagnetic nature
(C) Very low specific heat and high bend gap energy
(D) Very high specific heat and low electric resistance

54. Electric resistance of a metal owes its origin to
(A) lattice vibration of ions
(B) scattering of conduction electrons
(C) trapping of electrons in the vacant site of crystal
(D) recombination of free electrons with ions on regular sites in kernel

55. At very high frequency of alteration of electric field applied on a dielectric medium, the
insulating nature is observed only if
(A) electronic polarizability is non-vanishing (B) ionic polarizability vanishes
(C) all the three polarizabilities vanish (D) dipolar polarizability vanishes

56. Two consecutive planes having Millers indices (034) and lattice constants a=b=c=10nm are
separated by distance of
(A) 2.8nm (B) 3.2nm (C) 3nm (D) 2nm

57. Which of the following is not an ionic defect
(A) Frankel defect (B) Schottky defect
(C) Color Centre (D) Screw dislocation

Page 135

58. The tensile strength of metals is much less than theoretically prediction because
(A) Most of the metals have dislocations induced in them
(B) Most metals are extractable in pure form
(C) Point defects reduce the actual strength
(D) Point defects enhance mechanical strength

59. The spacing between the principal planes of a crystal is 0.2 nm . It is found that the first order
Bragg reflection of a beam of monochromatic x-rays occurs at an angle of 30o, then the
wavelength of x-rays is:
(A) 0.05nm (B) 0.1nm (C) 0.2nm (D) 0.4nm
60. If the Fermi energy of silver at 0K is 5eV, the mean energy of electron in silver at 0K is
(A) 5 eV (B) 7.5 eV (C) 12 eV (D) 3 eV
61. The general solution of the ordinary differential equation (𝐷 + 9)𝑦 = sin 4𝑥 (where 𝐷≡
) is
(A) 𝑦 = 𝑐 𝑒 + 𝑒 + cos 4𝑥
(B) 𝑦 = 𝑐 cos 3𝑥 + 𝑐 sin 3𝑥 − sin 4𝑥
(C) 𝑦 = cos 3𝑥 + sin 3𝑥 − sin 4𝑥
(D) 𝑦 = cos 3𝑥 + sin 3𝑥 + sin 4𝑥
62. The general solution of the differential equation + = 𝑒 /𝑥 is given by
(A) 𝑒 = (log 𝑥 + 𝑐)
(B) 𝑒 = 𝑙𝑜𝑔 𝑥
(C) 𝑒 = (log 𝑥 + 𝑐)
(D) 𝑒 = 𝑥(log 𝑥 + 𝑐)
−𝑘 − 𝜋 < 𝑥 < 0
63. For the periodic function 𝑓(𝑥) = with period= 2 𝜋m the value of 𝑎
𝑘 0<𝑥<𝜋
2 𝜋 in the Fourier series expression will be
(A) k
(B) 2k
(C) 0
(D) –k
64. The Half-Range sine series of a function f(x) defined on the interval [0,L] is given by

(A) 𝑓(𝑥) = ∑ 𝑏 sin , 𝑏 = ∫ 𝑓(𝑥) sin 𝑑𝑥
(B) 𝑓(𝑥) = ∑ 𝑏 sin , 𝑏 = ∫ 𝑓(𝑥) cos 𝑑𝑥
(C) 𝑓(𝑥) = ∑ 𝑏 sin , 𝑏 = ∫ 𝑓(𝑥) sin 𝑑𝑥
(D) 𝑓(𝑥) = ∑ 𝑏 sin , 𝑏 = ∫ 𝑓(𝑥) sin 𝑑𝑥

65. Using the concept of Fourier sine integral for the function 𝑓(𝑥) = 𝑒 , x>0 evaluate the value
( )
of the integral ∫ 𝑑𝑤.

(A) 𝑒

(B) 𝑒

(C) 𝑒

Page 136

(D) ∞

66. If 𝑢(𝑡) is a unit step function, then find the Laplace transform of 𝑢(𝑡 − 𝑎).

(A) 𝑒 /𝑠
(B) 𝑒 /𝑠
(C) 𝑒 /𝑠
(D) 𝑒 /𝑠

67. The value of the Laplace transform of 𝑓(𝑡) = 𝑒 is

(A) 𝑒 /(𝑠 + 3)
(B) 𝑒 /(𝑠 − 3)
(C) 𝑒 /𝑠
(D) 𝑒 /(𝑠 + 3)
( )
68. The series ∑ is

(A) Absolutely convergent (B) Conditionally convergent
(C) Convergent (D) Divergent

69. The series ∑ 1+ is

(A) Oscillating
(B) Convergent
(C) Divergent
(D) Conditionally convergent

70. The value of lim is
→
(A) 1 (B) -1 (C) -2 (D) 2

71. Find the volume of the solid that results when the region enclosed by the curves 𝑦 = 𝑥
and 𝑥 = 𝑦 is revolved about y-axis.
(A) (B) 𝜋 + (C) 𝜋 − (D) 𝜋 −
72. The function 𝑓(𝑥, 𝑦) = 𝑥 𝑦 𝑔 is a homogeneous function of degree ______.
(A) 3 (B) 2 (C) 4 (D) 1

73. If 𝑓(𝑥, 𝑦) = 𝑥 + 𝑦 + 6𝑥 + 12, the minimum value of f(x,y) is ________.
(A) -3 (B) 4 (C) 3 (D) 5

74. The equation of the cylindrical surface 𝑥 + 𝑦 = 9 becomes __________when converted to
cylindrical polar coordinates.
(A) 𝑟 = 9 (B) 𝑟 = 3 (C) 𝑟 = ±3 (D) 𝑟 = 3

75. Find the length of the one turn of the helix 𝑟(𝑡)⃗ = 𝑐𝑜𝑠𝑡 𝚤 + 𝑠𝑖𝑛𝑡 𝚥̂ + 𝑡 𝑘.
(A) 𝜋 (B) √2 𝜋 (C) 3 𝜋 (D) 2𝜋

x-x-x

Page 137

M. Tech (Polymer)
1. Which particular flue gas indicates incomplete combustion in furnaces
A. CO content
B. Dew point
C. CO₂ content
D. O₂ content

2. Which molecular arrangement in polymers is shown here

A. Branched
B. Linear
C. Cross linked
D. Network

3. Glass transition temperature is not influenced by the following factor:
A. Internal mobility of chains
B. Melting point
C. Free volume
D. Attractive forces between molecules

4. The Zeolite material is useful for:
A. Oil manufacture
B. Glass manufacture
C. Water treatment
D. Fire manufacture

5. The role of a plasticizer in processing is:
A. changing physical properties
B. lowering melting point
C. both A & B
D. disrupt flow

6. Following can be categorised as natural polymers:
A. Shellac
B. PMMA
C. PVC
D. PP

7. The ratio of weight-average molecular weight to number average molecular weight is
known as:

Page 138

A. z-average
B. viscosity average
C. poly dispersity index
D. multi dimensional index

8. If weight-average molecular weight is equal to number average molecular weight then:
A. polymer has linear chains
B. polymer has equal sized molecules
C. polymer has no molecules
D. polymer hasn’t formed out of the monomers

9. The osmotic pressure method is suitable for the number average molecular weight of
given ranges:
A. 100-200
B. 6000-10000
C. 50000-1000000
D. 3000-5000

10. Poly-dispersity index generally lies in the following ranges:
A. 1-20
B. 0-1
C. 80-100
D. 110-200

11. Which of the following are condensation products:
A. PET
B. PE
C. PS
D. PTFE

12. The parameters; temperatures of 140-170°C, oxide of Chromium as catalyst and
pressure of 500 psi pertains to the HDPE manufacturing process named as:
A. Ziegler
B. Indiana
C. Philips
D. Jones

13. PVC is not manufactured by the following processes:
A. emulsion
B. suspension
C. solution
D. condensation

14. The reaction between the following produces Novolac resin:
A. Urea and formaldehyde
B. Phenol and formaldehyde
C. polyester and urethane
D. isocyanate and polyol

15. Addition of Calcium oxide to water produces:

Page 139

A. exothermic heat
B. hissing sound
C. slaked lime
D. A,B,C

16. Gibbs-Duhem equation relates composition in liquid phase and the following at
constant temperature & pressure :
A. fugacity
B. partial pressure
C. activity coefficient
D. A,B,C

17. Mixing and compounding is a process involving following forces:
A. Chemical
B. Photolytic
C. Laminar
D. Catalytic

18. The glass transition temperature for PP is usually around this temperature:
A. -20°C
B. 100°C
C. 200°C
D. -100°C

19. Polymer melts flow with the characteristics of this type:
A. Dilatant
B. Thixotropic
C. Pseudoplastic
D. Newtonian

20. In rheology of polymers the term ‘n’ is referred to as:
A. shear stress
B. flow behaviour index
C. zero shear viscosity
D. number of molecules

21. The lower is the rate of cooling in polymers:
A. lower is degree of crystallisation
B. no change in degree of crystallisation
C. greater is degree of crystallisation
D. amorphous portion increases

22. ‘Clearance’ in extruder is best defined by:
A. pressure in shaft
B. diameter of shaft
C. gap between shaft and screw threads
D. radius of shaft

23. A twin screw extruder mechanism is based on:

Page 140

A. both B & C
B. co-rotation
C. counter rotation
D. no rotation

24. In case of steady flow compression polytropic process (PV n = constant), the work done
on air is the lowest, when
A. N=y=1.4
B. N=0
C. N=1
D. N-1.66

25. Maxwell and Voigt models explain the properties of polymers for:
A. flow
B. degradation
C. mechanical strength
D. optical strength

26. Polymer usually have a tensile failure best defined by:
A. brittle fracture
B. ductile fracture
C. snap
D. cracking

27. Material used for making moulds in polymer products is:
A. steel
B. wood
C. carbon
D. magnesium

28. Stereo isomerism in organic compounds can be best identified by:
A. thermal testing like TGA
B. optical testing like Gloss
C. chemical testing like FTIR
D. tensile testing of UTM

29. IUPAC is the convention followed in organic compounds for:
A. rating
B. ranking
C. testing
D. naming

30. Consider the reaction, C+O2 ⇌ CO2; Δ H= - 94 kcal. What will be the Δ H for the
reaction CO2→ C+O2 ?
A. - 6 kcal
B. 94 kcal
C. 104 kcal
D. - 114 kcal

31. A small sized bottle can be manufactured with the following techniques:

Page 141

A. Extrusion
B. Injection moulding
C. Blow moulding
D. Calendaring
32. Packaging in polymers is done with help of :
A. thermoforming
B. compression moulding
C. extrusion
D. injection moulding

33. Sheets of polycarbonates can be maintained in thickness by controlling this parameter:
A. nip between rolls
B. radius of rolls
C. both A and B
D. colour of polycarbonate

34. Metallic finish in car interiors can be given by :
A. spray coating paints
B. sheeting plastics
C. dip coating
D. drip coating

35. Number of components (C), phase (P) and degrees of freedom (F) are related by the:
A. Rotterdams phase rule
B. Fribbs phase rule
C. Cribbs phase rule
D. Gibbs phase rule
36. The famous fibre Nylon is named after the :
A. discoverers
B. cities
C. chemical source
D. plant

37. Corrosion in polymers is mainly evaluated by the following:
A. discolouration
B. swelling
C. both A & B
D. formation of iron oxide layer

38. Izod and charpy tests for polymers is relevant to calculate the:
A. Impact resistance
B. Compressive strength
C. Flexural strength
D. Optical strength

39. The S-N curve in plastics is relevant to the following:
A. Fatigue failure
B. Tensile testing
C. Both A & B
D. Chemical strength

Page 142

40. Prepeg technology is used to manufacture composites from:
A. Thermoplastics
B. Thermosetting plastics
C. Recycle plastics
D. Alcohol
41. “Dry ice”, often used at concerts, is really solid carbon dioxide. The solid carbon
dioxide sublimates and forms gas that then floats above the ice. What do we see when
we look at the “fog” produced by dry ice machines?
A. We are looking at carbon dioxide gas
B. We are looking at water gas, formed by the carbon dioxide
C. We are looking at small droplets of liquid water, condensed by the carbon
dioxide gas
D. We are looking at carbon powder

42. Materials made from a single type of atom that cannot be broken down any further are
called
A. substances
B. elements
C. molecules
D. compounds

43. Rotary lime kiln is an example of
A. open system
B. isolated system
C. non thermodynamic system
D. closed system

44. ASTM A prefix standards have been developed to universalise testing in :
A. Polymer coatings
B. Plastics
C. Metals
D. Non ferrous
45. The flattening of a tyre of a stationary van in the garage is an example of:
A. Creep
B. Stress relaxation
C. Both A & B
D. Thermal property

46. Spectroscopic techniques like FTIR help us to investigate the properties of polymers:
A. Optical properties
B. Thermal properties
C. Mechanical properties
D. Chemical properties

Page 143

47. Components used in the under-the-hood in automobiles are best evaluated with the
following technique:
A. Viscometer
B. Rheometer
C. HDT
D. UTM

48. PC-ABS is used in the cell phone battery covers to make it impact resistant and maintain
the long term uniformity in shape; PC-ABS can be classified as:
A. Composite
B. Blend
C. Alloy
D. Metal
49. Viscoelasticity in polymers is a unique property combination represented by Maxwell
and Voigt models through a combination of:
A. Spring and pump
B. Dashpot and pump
C. Spring and dashpot
D. Lever and Pump

50. A continuous product like the sheathings of metallic wires is easily managed with the
processing technique of polymers:
A. Injection moulding
B. Compression moulding
C. Thermoforming moulding
D. Extrusion moulding

51. When orthophosphoric acid is over-heated (> 900°C), following is produced
A. Metaphosphoric acid
B. Pyrophosphoric acid
C. Petaphosphoric
D. Zetaphosphoric
52. Conversion of yellow phosphorous to red phosphorous is done by heating it in
covered retorts at 250-400°C in
A. presence of air
B. absence of air
C. excess of air
D. purified air
53. Haber’s process for production of ammonia uses the following as catalyst:
A. Silica gel
B. vanadium oxide
C. reduced iron oxide
D. nickel
54. _____ formerly used for absolute standards of length measurement and is now used for
surveying tapes and in watches and various other temperature-sensitive devices. It
expands very little when heated.
A. Kevlar
B. Constantan
C. Alumel
D. Invar

Page 144

55. The number of moles of solute present in 1 kg of a solvent is called
A. formality
B. lolality
C. molality
D. molarity

56. The metal used to recover copper from a solution of copper sulphate is
A. Cd
B. Be
C. Fe
D. Pd

57. Paramagnetism is the property of
A. paired protons
B. unpaired protons
C. unpaired electrons
D. paired electrons

58. In which of the following substances the C atoms are quaternary in nature
A. graphite
B. Teflon
C. naphthalene
D. diamond

59. For a multicomponent system the term chemical potential is equivalent to
A. Partial molar free energy
B. Molar free energy
C. Molar free energy change
D. Molal concentration

60. Gibbs free energy per mole for a pure substance is equal to the
A. latent heat of vaporization
B. molal boiling point
C. heat capacity
D. chemical potential

61. Absorption/evolution of heat during conversion of a substance from one allotropic form
to another is termed as the heat of
A. sublimation
B. fusion
C. transition
D. vaporization

62. Work done may be calculated by the expression ∫ pdA for
A. Non flow reversible
B. Adiabatic
C. Both A & B
D. Open system

Page 145

63. The Carnot coefficient of performance (CoP) of a domestic air conditioner compared to a
household refrigerator is
A. more
B. less
C. equal
D. depends on climate

64. Clayperon equation pertains to
A. Rate of change of vapour pressure with temperature
B. Effect of an inert gas on vapour pressure
C. Calculation of ΔF for spontaneous phase change
D. Temperature dependence of heat of phase transition

65. In a shell and tube heat exchanger (given D= inside diameter of the shell), the height of
25 percent cut baffles is equal to
A. 0.15D
B. 0.25D
C. 0.55D
D. 0.75D

66. At Pr >1, conduction in an ordinary fluid flowing through a heated pipe is limited to the
A. buffer zone
B. turbulent core
C. viscous sub layer
D. buffer layer

67. Steam is to be condensed in a shell and tube heat exchanger, 5 m long with shell diameter
of 1m. Cooling water is used for removing the heat. Heat transfer co-efficient for the
cooling water whether on a shell side or tube side is the same. Best arrangement is
A. Vertical heat exchanger with steam on tube side
B. Vertical heat exchanger with steam on shell side
C. Horizontal heat exchanger with steam on shell side
D. Horizontal heat exchanger with steam on tube side

68. Three material A,B,C of equal thickness and thermal conductivity 20, 40, 60 kcal.hr.m.°C
respectively are joined together. The temperature outside of A and C are 30°C and 100°C
respectively, the interface between B and C will be at a temperature of
A. 40 °C
B. 90 °C
C. 70 °C
D. 80 °C

69. The film co-efficient between condensing vapour and metal wall increases with
A. Increasing temperature of the vapour
B. Decreasing temperature of the vapour
C. increasing viscosity of the film of condensate
D. Increasing temperature drop

Page 146

70. The ratio of Murphree plate efficiency to point efficiency is 1 in a -------- flow model
A. plug
B. perfectly mixed
C. both A & B
D. neither A nor B

71. Ponchan-Savarit method analyses the fractional equipment based on
A. Enthalpy balance only
B. Material balance only
C. Both enthalpy and material balances
D. The assumption of constant molal overflow

72. Potential flow is also known as
A. irrotational flow and frictionless flow
B. ideal fluid
C. both A and B
D. no flow
73. With increase in temperature, viscosity of liquid
A. increases
B. decreases
C. remains constant
D. turns solid

74. The opening of 200mesh screen (Tayler standard screen) is established at
A. 0.0074mm
B. 0.0074cm
C. 0.074µm
D. 0.074nm

75. If the moisture content of the solid on dry basis is X, then the same on wet basis is
A. X/1-X
B. 1+X/X
C. X/X+1
D. 1-X/X

x-x-x

Page 147

M.Com.(Business Economics) (M.B.E)
1. Which among the following is the highest credit risk rating that can be awarded to any
company by CRISIL?
(A) AAA (B) AAA+ (C) AA+ (D) A++

2. The main objectives of Minimum Support Prices is / are
1. Check fall in price beyond a limit
2. Protect interest of the consumers
3. Make procurement from the wholesalers easy
Choose the correct option:
(A) Only 1 (B) Only 1 & 2 (C) Only 2 & 3 (D) 1, 2 & 3

3. Which among the following is a Progressive Tax?
(A) Customs duty (B) Development Surcharge
(C) Income tax (D) Sales tax

4. Which among the following effects will be seen on “deposit rates” if RBI tightens its
policy?
(A) The deposit rates will increase (B) The deposit rates will decrease
(C) The deposit rates will remain unaltered (D) Either Increase or decrease

5. Which among the following is a correct impact of Dear Money?
(A) Borrowings become cheap
(B) Borrowings become expensive
(C) Borrowings become either cheap or expensive
(D) There is no impact of Dear Money on Borrowings

6. Which among the following represents the Financial Year of the International Monetary
Fund?
(A) January 1 to December 31 (B) February 1 to January 31
(C) April 1 to March 31 (D) May 1 to April 30

7. Who among the following was the architect of second five year plan?
(A) Jawahar Lal Nehru (B) C D Deshmukh
(C) P C Mahalanobis (D) Subimal Datt

8. During which five year plan was The Khadi and Village Industries Commission
established?
(A) First Five year Plan (B) Second Five year Plan
(C) Third Five year Plan (D) Fourth Five Year Plan

9. Consider the following:
1. Allotting of the shares of net proceeds of taxes
2. Laying down principles governing grants in aid
Looking into the financial relations between the central government and the state
Governments, the above mentioned functions are carried out by which among the
following?
(A) Cabinet Committee on Economic Affairs
(B) National Development Council
(C) Finance Commission

Page 148

(D) NITI Aayog
10. How many states of India are covered under the National Horticulture Mission?
(A) 14 (B) 16 (C) 18 (D) 20

11. The Reserve Bank of India follows the principle of reciprocity and single mode of
presence with respect to the __________:
(A) Private Banks (B) Foreign Banks
(C) Regional Rural Banks (D) Urban Cooperative Banks

12. In which system of economy is the “participation of the workers in the collective
bargaining” is one of the features?
(A) Socialist economy (B) Mixed economy
(C) Market Economy (D) Traditional Economy

13. What percentage of Indian populations does not have banking facilities?
(A) 14% (B) 16% (C) 31% (D) 21%

14. Which five-year plan was launched on the eve of 50th Year of Indian Independence?
(A) 10th (B) 8th (C) 9th (D) 11th

15. Who among the following is not a part of the Governing Council of NITI Aayog?
(A) All Chief Ministers of the states
(B) Chief Ministers of Delhi and Puducherry
(C) Governors of States
(D) Lieutenant Governor of Andaman & Nicobar Island

16. How many micronutrients are provided by fertilizers?
(A) 8 (B) 9 (C) 6 (D) 7

17. Which food crop production recorded maximum increase in India after Independence?
(A) Rice (B) Wheat (C) Maize (D) Pulses

18. Which is the top pulses producing country of the world?
(A) Myanmar (B) Canada (C) India (D) Nigeria

19. Which among the following has GI tag?
1. Darjeeling black tea
2. Darjeeling green tea
3. Darjeeling white tea
Choose the correct option from the choices given below:
(A) 1 only (B) 2 only (C) 3 only (D) All of these

20. When was the National Artificial Insemination Programme launched?
(A) 2010 (B) 2018 (C) 2019 (D) 2012

21. Which ministry introduced the Mega Food park scheme?
(A) Ministry of Food processing and Industries
(B) Ministry of Finance
(C) Ministry of commerce
(D) Ministry of MSME

Page 149

22. Which among the following is not a potential state under Mission fingerling?
(A) Andhra Pradesh (B) Haryana (C) Madhya Pradesh (D) Odisha

23. Which country is the largest seafood export destination for India?
(A) USA (B) China (C) Japan (D) Germany

24. Which is the largest importer of Indian honey?
(A) USA (B) Germany (C) China (D) Italy

25. During which 5-year plan was the blue revolution launched in India?
(A) 8th FYP (B) 9th FYP (C) 7th FYP (D) 6th FYP

26. Who coined the term evergreen revolution?
(A) M.S. Swaminathan (B) Manmohan Singh
(C) Verghese Kurien (D) Sam Pitroda

27. What is India’s rank in the production of chemicals in the world?
(A) 4 (B) 12 (C) 8 (D) 7

28. When was National Organic Chemicals Industries Limited (NOCIL) set up?
(A) 1951 (B) 1961 (C) 1955 (D) 1957

29. Which is the most exported fertilizer from India?
(A) Urea (B) Potash (C) Nitrogen fertilizer (D) None of these

30. What is the value of electronic hardware production in 2019?
(A) Rs. 4.58 trillion (B) Rs. 5.48 trillion (C) Rs. 6.32 trillion (D) Rs. 2.58 trillion

31. What does low price elasticity of demand for a commodity show?
(A) Necessity of good (B) It is luxury good
(C) It doesn’t have importance (D) It is inferior good

32. What is perfectly inelastic demand?
(A) Demand doesn’t change with price (B) Demand change with price
(C) Change in demand is equal to price (D) Demand changes infinitely

33. Which among the following is an example of substitute goods?
(A) Milk and Coffee (B) Pen and Paper
(C) Ink and Pen (D) Tea and coffee

34. Which among the following is best described as opportunity cost?
(A) Difference between the return on chosen option and the return on best forgone
option
(B) Difference between two chosen options
(C) Difference between the return this year and the previous year
(D) None of the above

35. What is a free good?
(A) Opportunity cost = Maximum (B) Opportunity cost = Negative
(C) Opportunity cost = 0 (D) A good which is freely available to all

Page 150

36. When does monopoly by a business in the market exist?
(A) Many number of buyers and sellers are there
(B) Homogeneous products exist in market
(C) Unique product with only one seller exist in market
(D) Firms are the price takers

37. What defines a market place in an economy?
(A) Place where profits are made (B) Place where goods are made
(C) Place where people meet (D) Place where buyers meet sellers

38. Who among the following receives subsidies from the government?
(A) Sellers (B) Buyers (C) Manufacturers (D) All of these

39. Which of the following is a fixed cost for a firm?
(A) Land (B) Labour (C) Both A and B (D) None

40. Which of the following is most important for economic efficiency?
(A) Increase in economic activity in an economy
(B) Use of resources to maximize the production of goods and services
(C) Distribution of economic resources in fair and equitable manner
(D) Maximum usage of resources for maximum production of goods

41. What is subtracted from personal income to get personal disposable income?
(A) Indirect taxes (B) Direct taxes
(C) Subsidies (D) None of these

42. In terms of micro-economics, comparative advantage is based on which of the
following?
(A) Dollar price (B) Labor cost (C) Opportunity cost (D) Capital cost

43. In which of the following conditions, the domestic price a product will be equal to the
world price in a country?
(A) Trade restrictions are imposed on the product in that country
(B) The country chooses to import, but not export, the product
(C) The country chooses to export, but not import, the product
(D) The country allows free trade

44. Which of the following is not a micro-economic variable?
(A) Demand of a commodity (B) Supply of a commodity
(C) Price rise of a commodity (D) Employment generated in a year in a country

45. Which if the following is subject matter of microeconomic study?
(A) Study of Cotton Textile Industry (B) General Price level of commodities
(C) Problem of unemployment D) Aggregate demand of the commodities

46. Which term is used to describe the want satisfying power of a commodity or a service?
(A) Demand (B) Want (C) Utility (D) Consumption

Page 151

47. Which of the following factors does not affect the demand for a commodity?
(A) Price of commodity (B) Income of individual consumer
(C) Want of the consumer (D) Price of related good

48. When the price of a substitute of a commodity X falls, then the demand for X will?
(A) Increase (B) Decrease
(C) Increase, then decrease (D) Decrease, then increase

49. Which among the following is complementary good?
(A) Petrol and Car (B) I-phone and Android Phone
(C) Milk and Sweet (D) Shoes and Sandals

50. Which among the following is a factor of production?
(A) Land (B) Rent (C) Profits (D) Interest

51. Which among the following is not a part of factor of production?
(A) Land (B) Labour (C) Capital (D) Wages

52. Which type of Economy is Indian Economy?
(A) Mixed (B) Market (C) Capitalist (D) Socialist

53. Which of the following are correct for Real GDP?
(A) Current year production valued at current prices
(B) Current year production valued at base year
(C) Current year production valued at last year prices
(D) Current year production valued at forecasted prices

54. What is the aggregate of the gross balances of primary income of all resident
institutional units knows as?
(A) Gross domestic Product (B) Gross national product
(C) Gross National income (D) Net national product

55. Which of the following are part of National income?
(A) Value of all goods and services produced in a financial year
(B) An reused good sold in that financial year
(C) Service rendered by housewife
(D) None of the above

56. Which of the following is a part of Gross National Product (GNP)?
(A) Imports (B) Exports
(C) Money earned by resident abroad (D) All of the above

57. What causes the depreciation of a good?
(A) Reduction in market value of a good (B) Physical wear and tear
(C) Fall in value of good (D) None of these

58. What does decreasing contribution of agriculture to GDP signifies?
(A) Country is becoming poor (B) Country is becoming less developed
(C) Country is becoming more developed (D) None of these

Page 152

59. The new GDP series calculates GDP based on which price?
(A) Market price (B) Factor cost
(C) Nominal costs (D) None of these

60. Which of the following is included in market price?
(A) Indirect taxes (B) Direct taxes
(C) Subsidies (D) None of these

61. Which of the following is not added in the calculation of national income of India?
(A) The value of goods and services (B) The sold value of the old fridge
(C) Services rendered by the housewives (D) Both B & C

62. Which of the following ministries is responsible for calculating GDP in India?
(A) Ministry of Finance
(B) Ministry of Commerce and Industry
(C) Ministry of Central Statistical and Program Implementation
(D) Ministry of consumer Affairs

63. Which of the following is the movement along the supply curve?
(A) Curve Supply (B) Contraction of supply
(C) Expansion of supply (D) Expansion and contraction of supply

64. Which of the following curves represents the demand of all consumers in the market
taken together at different levels of the price of the good?
(A) Monotonic (B) Indifferent (C) Market demand (D) Diminishing

65. On the basis of distribution, resources can be classified into which of the following?
(A) Potential resources (B) Ubiquitous resources
(C) Actual resources (D) Abiotic resources

66. Which among the following is an example of micro-economic variable?
(A) National Income (B) Consumer’s Equilibrium
(C) Aggregate Supply (D) Employment

67. Which of the following is an alternative way of representing the production function?
(A) Average Product (B) The Long Run
(C) Isoquant (D) The Short Run

68. Which of the following says that the marginal product of a factor input initially rises
with its employment level but after reaching a certain level of employment, it starts
falling?
(A) Law of diminishing marginal product (B) Law of variable proportions
(C) The Short Run (D) The Long Run

69. Which of the following is called GDP Deflator?
(A) Ratio of nominal to real GNP (B) Ratio of nominal to real CPI
(C) Ratio of real to nominal GNP (D) Ratio of nominal to real GDP

Page 153

70. “Gresham’s Law” in Economics relates which of the following?
(A) Supply and demand (B) Circulation of currency
(C) Consumption and supply (D) Distribution of goods and services

71. Which among the following is a suitable term for the state of economy in which
economic activity is slowing down but wages and prices continue to rise?
(A) Inflation (B) Deflation (C) Skweflation (D) Stagflation

72. Which among the following is the branch of economics that deals with the performance,
structure, and behavior of the economy of the entire community, either a nation, a
region, or the entire world?
(A) Heterodox approaches (B) Micro Economics
(C) Macro Economics (D) All of these

73. Which among the following bodies estimates the national income of India?
(A) Office of the Economic Advisor (B) Ministry of Statistics
(C) Central Statistical Office (D) Ministry of Finance

74. Which among the following imposes a greater burden (relative to resources) on the poor
than on the rich?
(A) Progressive tax (B) Regressive Tax
(C) Lump Sum tax (D) Proportional tax

75. In context with the macroeconomics, Philips Curve is a relationship between the rates
of _________?
(A) Unemployment & Exim trade (B) Unemployment and Inflation
(C) Unemployment and Demand (D) Unemployment and Poverty

x-x-x

Page 154

(M.Com.-Honours)
1. Who suggested product, pricing, place, promotion all these in a company represents
“Market Mix”?
(A) Neil Borden (B) Neilsen (C) Philip Kotler (D) Stephen Morse

2. The goal of a pure market economy is to meet the desire of?
(A) Consumers (B) Companies (C) Workers (D) The government

3. What is the Gross National Product?
(A) The total value of Good and services manufactured in the country
(B) The total value of all the transactions in the country
(C) Reduction in the total value of goods and services produced in the country
(D) The total worth of goods and services generated in the country and net factor income
from abroad

4. Entered in the Purchases Journal are
(A) Discounts received (B) Purchases invoices
(C) Payments to suppliers (D)Trade discounts

5. X Ltd. has current ratio of 2– 1 and quick ratio of 1•5– 1. If its current liabilities are Rs.
80,000, then the value of stock would be _______.
(A) Rs. 1,60,000 (B) Rs. 1,20,000 (C) Rs. 40,000 (D) Rs. 80,000

6. Disinvestment Commission was set-up in _______.
(A) 1995 (B) 1996 (C) 1997 (D) 1998

7. Which one of the following reports deals with ‘Corporate governance’?
(A) Sabhanayagam Report (B) Kumaramangalam Birla Report
(C) Narasimhan Report (D) L.C. Gupta Report

8. Auction Rated Debentures (ARDs) are a hybrid of–
(A) Shares and Debentures
(B) Shares and Commercial Papers
(C) Commercial Papers and Debentures
(D) Zero Interest Bonds and Deep Discount Bonds

9. Which is the oldest form of organisation?
(A) Line (B) Line and staff (C) Functional (D) Matrix

10. Which is not a insurable risk?
(A) Accident Risk (B) Loss of Crops Risk
(C) The Risk of Trading in New Market (D) The Risk of Sinking of a Ship

11. The Life Insurance in India was nationalized in the year–
(A) 1870 (B) 1956 (C) 1960 (D) 1966

12. When sale is Rs. 4,80,000, gross loss is 25% on cost, purchase is Rs. 3,50,000 and
closing stock is Rs. 60,000, the stock in the beginning would be _________.
(A) Rs. 70,000 (B) Rs. 94,000 (C) Rs. 1,34,000 (D) Rs. 3,50,000

Page 155

13. The profit of a company (whose capital is divided into 25‚000 shares of Rs. 10 each)
for the last three years are: Rs. 50‚000; Rs. 60‚000 and Rs. 40‚000. The fair return on
investment is taken at 10% p.a. The value of company’s share will be _______.
(A) Rs. 10 (B) Rs. 20 (C) Rs. 30 (D) Rs. 40

14. Under which one of the following is the term ‘Dominant Undertaking’ defined ?
(A) MRTP Act (B) FEMA (C) Companies Act (D) SEBI

15. In ‘Direction’ who is given importance?
(A) To machines (B) To paper work (C) To man (D) To production

16. Financial year of a company shall not exceed–
(A) Calendar year
(B) 15 months
(C) 18 months with special permission of Registrar of companies
(D) 15 months with special permission of Registrar of Companies

17. An auditor is required to determine the ____ of his audit procedures according to the
requirements of Standards of Auditing.
(A) Conduct (B) Nature, timing and extent
(C) Limitation (D) Planning

18. In a contract costing most of the items of cost are _______.
(A) Indirect (B) Direct (C) Normal (D) Fixed

19. _______ is an important point to be determined in industries where batchcosting is
employed
(A) EBQ (B) EOQ (C) Re – order quantity (D) Batch

20. When the competition stage of a contract is less than ¼ , the totalexpenditure on the
contract is transferred to _______ account
(A) Work in progress (B) P/L a/c
(C) Estimated profit (D) Notional profit

21. Laspeyre's index = 110, Paasche's index = 108, then Fisher's Ideal index is equal to:
(A) 110 (B) 108 (C) 100 (D) 109

22. In the regression equation Y = 75.65 + 0.50X, the intercept is
(A) 75.65 (B) 0.5 (C) 1 (D) Intereminable

23. The coefficient of determination must be
(A) Between -1 and+1 (B) Between -1 and 0
(C) Between 0 and 1 (D) Equal to SSE/(n-2)
24. The only language which the computer understands is _______.
(A) Assembly Language (B) Binary Language
(C) BASIC (D) C Language

25. A trader has made a sale of Rs.75,500 out of which cash sales amounted to Rs.25,500.
He showed trade receivables on 31-3-2014 at Rs. 25,500. Which concept is followed
by him?

Page 156

(A) Going concern (B) Cost
(C) Accrual (D) Money measurement

26. A firm has reported a profit of Rs.1,47,000 for the year ended 31-3-2014 after taking
into consideration the following items.(i) The cost of an asset Rs.23,000 has been taken
as an expense_new_line_(ii) The firm anticipated a profit of Rs.12,000 on the sale of
an old furniture_new_line_(iii) Salary of Rs.7,000 outstanding for the year has not been
taken into account._new_line_(iv) An asset of Rs.85,000 was purchased for Rs.75,000
and was recorded in the books at Rs.85,000._new_line_What is the correct amount of
profit to be reported in the books?
(A) Rs.1,47,000 (B) Rs. 1,51,000 (C) Rs.1,63,000 (D) Rs.1,41,000

27. Which of the following is wrong?
(A) All real and personal accounts are transferred to balance sheet
(B) Nominal accounts are transferred to P & L account
(C) Each account is opened separately in ledger
(D) Rent is a personal account, outstanding rent is nominal account

28. Which accounting concept specifies the practice of crediting closing stock to the trading
account?
(A) Cost (B) Realization (C) Going concern (D) Matching

29. If one of the cars purchased by a car dealer is used for business purpose, instead of
resale, then it should be recorded by _______.
(A) Dr Drawing A/c & Cr Purchases A/c
(B) Dr Office Expenses A/c & Cr Motor Car A/c
(C) Dr Motor Car A/c & Cr Purchases A/c
(D) Dr Motor Car & Cr Sales A/c

30. Where raw material is to pass certain stages before it is converted into finished goods,
the method of costing used is _______.
(A) Contract (B) Process (C) Unit (D) Batch

31. Cost of producing an additional unit of output is _______.
(A) Historical Cost (B) Marginal Cost (C) Fixed Cost (D) Total Cost

32. _______ has been compared to a “State within A State”
(A) State (B) Cooperation (C) Capitalism (D) Socialism

33. In _______ the state is supreme, while in _______ the individual freedom occupies the
front position
(A) Co-Operation, Capitalism (B) Capitalism, Co-Operation
(C) Socialism, Capitalism (D) Socialism, Co-Operation

34. _______ is the act of building budgets
(A) Budgeting (B) Estimating (C) Forecasting (D) ZBB

35. The job costing each job is a _______ to which all costs are assigned
(A) Profit unit (B) Cost unit (C) Expenses (D) Variable

Page 157

36. What is the time limit for scrutiny assessment under section 143(3)?
(A) Within 21 months (B) Within 22 months
(C) Within 23 months (D) Within 24 months

37. As per IAS 1, Presentation of financial statement, ______ no of items would constitute
complete set of financial statements.
(A) Atleast 5 (B) Atleast 6 (C) 5 (D) 6

38. Whether financial reviews by management, environment reports and value added
financial statements are outside the scope of international financial reporting standards
(IFRSs)?
(A) Yes (B) No
(C) Not Mentioned In IFRSs (D) Still In Consideration

39. Which of the following is not a component of a Statement of Financial Position?
(A) Non-Current Assets (B) Retained Earnings
(C) Cost of Goods Sold (D) Deferred Tax

40. Under Ind AS 1 how often should financial statements be prepared?
(A) At Least Annually (B) No More Than Annually
(C) As Often As The Company Requires (D) Monthly

41. Management accounting can be viewed as __________.
(A) Marketing-oriented Accounting (B) Management-oriented Accounting
(C) Accounting-oriented Management (D) Manager-oriented Accounting

42. ________ is the language of Business which used to communicate financial
information.
(A) Accounting (B) Marketing (C) Profit (D) Pricing

43. The main objective of management accounting is _________
(A) To maintain the accounting records
(B) To know the amount due from customers and suppliers
(C) To ascertain analyse and interpret the results of business operations
(D) To record all the business transactions

44. The purpose of management accounting is to help ______ make decisions
(A) Managers (B) Investors (C) Marketers (D) Banks

45. Goodwill is one of the _______
(A) Current assets (B) Tangible assets
(C) Intangible assets (D) Liquid assets

46. Salary is one of the ________
(A) Direct expenses (B) Non-cash expenses
(C) Capital expenses (D) Revenue expenses
47. ______ mainly deals with the accounting & reporting of information to management
regarding the detail information.
(A) Cost accounting (B) Financial accounting
(C) Management accounting (D) Traditional accounting

Page 158

48. ______ is responsible for financial operations of the organization.
(A) CEO (B) CMO (C) CFO (D) CA

49. _______ is the study of managerial aspects of financial accounting
(A) Cost accounting (B) Financial accounting
(C) Management accounting (D) Business accounting

50. Financial accountancy is governed by _______.
(A) Local standards only
(B) International standards
(C) Local as well as international accounting standards
(D) Company’s internal top management only

51. _________ are the basis of the business’s financial accounting.
(A) Accounting records (B) Bookkeeping
(C) Sales Volume (D) Both A & B

52. Financial accounting reports lay greater emphasis on the _______.
(A) Objectivity of data (B) Flexibility of data
(C) Relevancy of data (D) Subjectivity of data

53. The annual reports are to be prepared and published for circulation among the external
end users such as ______.
(A) Company, competitors, contributors and colleagues
(B) Customers, creators, collaborators and contractors
(C) Government, competitors, owners and top management
(D) Shareholders, investors, bankers, debenture holders and creditors

54. The term management accounting was first coined in
(A) 1950 (B) 1945 (C) 1955 (D) 1960
55. The concept of management accounting was coined by?
(A) R.N Anthony (B) J. Batty
(C) James H. Bliss (D) American Accounting Association
56. Decisions regarding usage of material, kind and changes in plant processing are a part
of
(A) Help management (B) Future management
(C) Cost management (D) Past management

57. GST is a consumption of goods and service tax based on.
(A) Development (B) Dividend (C) Duration (D) Destination

58. The market value of the shares is decided by
(A) The investment markets (B) The government
(C) Shareholders (D) The respective companies

59. CAPM stands for _________.
(A) Capital asset pricing model (B) Capital amount printing model
(C) Capital amount pricing model (D) Capital asset printing model

Page 159

60. From the below-mentioned items which are financial assets?
(A) Machines (B) Bonds
(C) Stocks (D) Both B & C

61. Contribution margin is also known as
(A) Gross profit (B) Net profit
(C) Earning before tax (D) Marginal income

62. Period cost means
(A) Variable cost (B) Fixed costs
(C) Prime cost (D) Factory cost

63. The term standard cost refers to the:
(A) Average unit cost of product produced in the previous period
(B) Budgeted unit cost of product produced in a particular period
(C) Average unit cost of product produced
(D) By other companies

64. A document that records the standard cost of a single unit of product is known as:
(A) Bill of materials (B) Bill of product
(C) Standard (D) Cost card

65. Which of the following statements regarding graphs of fixed and variable costs is true?
(A) Variable costs can be represented by a straight line where costs are the same for
each data point
(B) Fixed costs can be represented by a straight line starting at the origin and continuing
through each data point
(C) Fix
(D) Costs are zero when production is equal to zero
66. A 'direct' cost is a cost that is classified by:
(A) Behaviour (B) Traceability
(C) Controllability (D) Relevance

67. Bad debt amount should be credited to
(A) Debtors account (B) Bad debts account
(C) Sales account (D) Creditors account

68. Rent paid to landlord should be credited to
(A) Landlords account (B) Rent account
(C) Cash account (D) Expense account
69. Which of the following is NOT normally considered to be an asset?
(A) Retained earnings (B) Cash
(C) Buildings (D) Accounts receivable
70. A revenue that is collected before it has been earned is called
(A) Accrued revenue (B) Unrecorded revenue
(C) Deferred revenue (D) Unearned

71. Assets should be valued at the price paid to acquire them” is based on?
(A) Accrual concept (B) Cost concept
(C) Money measurement concept (D) Realization concept

Page 160

72. A change in an individual’s behaviour prompted by information and experience refers
to which one of the following concepts?
(A) Learning (B) Role selection
(C) Perception (D) Motivation

73. MOST stands for ________.
(A) Machinery, Office, Staff, and Technology
(B) Mission, Objectives, Strategies, and Tactics
(C) Maximum Output Strategy Tools
(D) Manager, Operator, Seller, and Trader

74. Functional managers are responsible _______.
(A) For a single area of activity
(B) To the upper level of management and staff
(C) For complex organizational sub-units
(D) For obtaining copyrights and patents for newly developed processes and equipment

75. The problem-solving process begins with
(A) Clarification of the situation (B) Establishment of alternatives
(C) Identification of the difficulty (D) Isolation of the cause

76. The book “The Psychology of management” was published by
(A) William Gilbreth (B) Hendry Fayol
(C) F.W. Taylor (D) Robert Owen

77. Management satisfies ______ characteristics of a profession.
(A) Few (B) Many (C) All (D) Zero

78. Which is NOT an informational role of a manager?
(A) Monitor’s role (B) Disturbance’s role
(C) Disseminator’s role (D) Spokesman’s role

79. How are principles of management formed?
(A) By experiences of customers (B) By propagation of social scientists
(C) In a laboratory (D) By experiences of managers

80. Which of the following describes the principle of harmony, not discord?
(A) The management should properly investigate any task
(B) The management should engage in scientific enquiry
(C) The management should focus on observation and analysis
(D) The management should share the gains or profits of a company with their workers
81. The reciprocal nature of power was articulated by
(A) Barnard (B) Follett (C) Fayol (D) Taylor

82. TQM refers to
(A) Total quarterly management (B) Total qualifying management
(C) Total quality measurement (D) Total quality management

Page 161

83. A study of the culture and practices in different societies is called
(A) Anthropology (B) Personality (C) Perception (D) Attitudes

84. If total number of elements with some specific characteristics is 18 from a population
of 40 and sample is drawn without replacement with size of 4 then mean of hyper
geometric probability distribution is
(A) 1.8 (B) 2.8 (C) 3.8 (D) 4.8

85. Teletypewriter terminal is an example of
(A) Input (B) Output (C) Input and Output (D) Storage

x-x-x

Page 162

M.Sc.(Industrial Chemistry)
1) Which process of water treatment is done to avoid floating debris, branches,
trees, or other large particles suspended in water?
(A) Primary sedimentation (B) Secondary sedimentation
(C) Screening (D) Aeration
2) The purest form of iron is:
(A) cast iron (B) pig iron
(C) Steel (D) wrought iron
3) If the concentration of dissolved oxygen in water is below X ppm, the growth of
fish gets inhibited. X is:
(A) 10 (B) 12 (C) 6 (D) 8
4) DDT is :
(A) Nitrogen containing insecticide (B) Biodegradable pollutant
(C) An antibiotic (D) Non-Biodegradable pollutant
5) At the triple point of water Component (C), Phase (P) and Degree of Freedom
(F) are respectively
(A) 1, 3, 0 (B) 3, 3, 1 (C) 1, 2, 0 (D) 3, 3, 2
6) Which is the best-suited method for the separation of para and ortho-
nitrophenols from 1:1 mixture?
(A) Crystallization (B) steam distillation
(C) chromatography (D) sublimation
7) The crystal system of a compound with unit cell dimensions a=0.387, b=0.387,
c= 0.504 nm and α=β=γ = 90º is.
(A) Cubic (B) Orthorhombic
(C) rhombohedral (D) Tetragonal
8) Which of the following device is used to prevent the clogging of sewer pipes?
(A) Drop manhole (B) Storm regulators
(C) Flushing tank (D) Lamp hole
9) At 500 K, KC for the reaction:
H2 (g) + D2 (g) ⇌ 2HD (g) is 3.6
What is the value of KC for
2HD (g) ⇌ H2 (g) + D2 (g)
(A) remains unchanged (B) - 3.6
(C) 0 (D) 0.27
10) Which of the following given pair of units of a and b (van der Waals constant)
is correct in Van der Waals equations.
(A) atm L2 mol-2 and L mol-1 (B) atm L mol-2 and L
2 -1 -2
(C) atm L mol and L (D) atm L-2 mol2 and L mol-2

Page 163

11) Match the process given in column Ι with its description in column ΙΙ
Column Ι Column ΙΙ
1. Isobaric process p. process in which driving force is very
different than opposing force
2. Isothermal process q. process in which no heat enters or leaves the
system
3. Adiabatic process r. process in which temperature of the
system remain constant
4. Irreversible process s. A process in which pressure of the system is
kept constant
Correct match is:
(A) 1- p, 2-q, 3-r, 4- s (B) 1-r, 2-s, 3-q, 4-p
(C) 1-s, 2-r, 3-q, 4-p (D) 1- s, 2-p 3-r, 4-q
12) Galena is an ore of :
(A) Pb (B) Zn (C) Sn (D) Mn
13) Which of the following forms cationic micelles above certain concentration?
(A) Sodium dodecyl sulphate
(B) Urea
(C) Cetyl trimethyl ammonium bromide
(D) Sodium acetate
14) On heating a liquid, its viscosity :
(A) Increases (B) decreases
(C) remains same (D) is reduced to zero
15) Rust is a mixture of :
(A) FeO and Fe(OH)2 (B) FeO and Fe(OH)3
(C) Fe2O3 and Fe(OH)3 (D) Fe3O4 and Fe(OH)3
16) Match the following:
(X) Inversion Temperature (i) a/Rb
(Y) Boyle’s Temperature (ii) 8a/27Rb
(Z) Critical Temperature (iii) 2a/Rb
Correct match of the following is:
(A) X-i, Y-ii, Z-iii (B) X-iii, Y-ii, Z-i
(C) X-iii, Y-i, Z-ii (D) X-i, Y-iii, Z-ii
17) Calculate the pH value of 0.01M NaOH.
(A) 14 (B) 12 (C) 9 (D) 1 × 10-2

18) Match the type of colloidal systems given in column I and column II
Column I Column II
I. Solid in liquid (a) Foam

Page 164

II. Liquid in solid (b) Sol
III. Liquid in liquid (c) Gel
IV. Gas in liquid (d) Emulsion
(A) I-(b), II-(c), III-(d), IV-(a) (B) I-(c), II-(b), III-(a), IV-(d)
(C) I-(b), II-(c), III-(a), IV-(d) (D) I-(d), II-(b), III-(a), IV-(c)
19) The expression for Hamiltonian operator is:
(A) h2 (B) h2m 2
 2  v  v
8m 2
8 2
(C) h2 (D) h2
 2  v  2  v2
8m 2
8m 2
20) Which of the following has highest pH?
(A) 0.01 M NaOH (B) 0.1 M NaOH
(C) 0.1 M HCl (D) 0.1 M CH3COOH
21) Micelles form only
(A) below the critical micelle concentration (CMC) and below the krafft
temperature (KT)
(B) above the CMC and below the KT
(C) above the CMC and above the KT
(D) below the CMC and above the KT
22) The figure below describes a carnot engine work. Which path show adiabatic
compression.

(A) 3 to 4 (B) 2 to 3 (C) 1 to 2 (D) 4 to 1
23) Correct order of wavelength in electromagnetic spectrum is--
(A) microwave < radio waves < X-rays < UV-rays
(B) X-rays > UV-rays > radio waves > microwave
(C) microwave > X-rays > UV-rays > radio waves
(D) X-rays < UV-rays < microwaves < radio waves

Page 165

24) According to Phase rule, correct relationship between, degree of freedom (F),
Component (C) and Phase (P) is:
(A) F=C+P–2 (B) C+P=1+F
(C) F-P=C+1 (D) F+P=C+2
25) In a galvanic cell, which one of the following statements is not correct:
(A) Anode is negatively charged
(B) Cathode is positively charged
(C) Reduction takes place at anode
(D) Reduction takes place at cathode
26) An azo dye is formed by interaction of an aromatic diazonium chloride with
(A) A phenol (B) An aliphatic primary amine
(C) Benzene (D) Nitrous acid
27) The only vitamin with metal atom in it is
(A) Vitamin A (B) Vitamin K
(C) Vitamin B12 (D) Vitamin E
28) Which of the following is a vat dye and often used in dyeing jeans
(A) Indigo (B) Alizarin
(C) Picric acid (D) Crystal violet
29) Which compounds act as a inhibitor for knocking in combustion of petrol?
(A) (C2H5)4Pb (B) Ni(CO)4
(C) C6H6 (D) (C3H6)2Pb
30) Hydrogen bomb is based on the principle of
(A) nuclear fission (B) nuclear fusion
(C) natural radioactivity (D) artificial radioactivity
31) Oxygen and ozone are….
(A) Isotopes (B) Allotropes
(C) Isobars (D) Isomers
32) Which of the following is a colored gas ?
(A) NO2 (B) N2O5 (C) N2O4 (D) N2O

33) Match List I with List II and select the correct answer using the code given below
the lists:
List I List II
(a) Zn|Zn2+(0.01M)||Zn2+(0.1M)|Zn (p) primary cell
(b) 1 Coulomb (q) Secondary cell
(c) Dry Cell (r) 6.24×1018 electrons
(d) Lead storage cell (s) Concentration cell
(A) (a)-(s), (b)-(r), (c)-(p), (d)-(q) (B) (a)-(p), (b)-(q), (c)-(r), (d)-(s)

Page 166

(C) (a)-(q), (b)-(r), (c)-(s), (d)-(p) (D) (a)-(a), (b)-(p), (c)-(q), (d)-(r)
34) What is monomeric repeating unit of nylon-6,6…..
(A) [NH-(CH2)5-CO] (B) [NH-(CH2)6-NH-CO-(CH2)6-
CO]
(C) [NH-(CH2)4-NH-CO-(CH2)4- (D) [NH-(CH2)6-NH-CO-(CH2)4-
CO] CO]
35) The correct order of increasing basic nature for the bases NH3, CH3NH2,
(CH3)2NH
(A) NH3 < CH3NH2 < (CH3)2NH (B) (CH3)2NH< NH3 < CH3NH2
(C) (CH3)2NH< CH3NH2 < NH3 (D) NH3 < (CH3)2NH < CH3NH2
36) According to Lowry and Bronsted concept, the strength of an acid depends
upon
(A) the tendency to gain protons (B) the tendency to lose protons
(C) the tendency to accept electrons (D) the tendency to donate electrons
37) Intersystem crossing is a radiation less transition:
(A) between states of same multiplicity
(B) between states of different energy
(C) between states of same energy
(D) between states of different multiplicity
38) The monomer of polystyrene is………..
(A) C2H5-CH=CH2 (B) C6H5-CH=CH2
(C) C6H5-CH2=CHCHO (D) CH2=CHCHO
39) Galvanic cell involves
(A) conversion of thermal energy (Heating) into electrical energy
(B) conversion of electrical energy into chemical energy
(C) conversion of chemical energy into electrical energy
(D) conversion of chemical energy into thermal energy
40) Methyl orange is an indicator in acid-alkali titration. It gives …
(A) Yellow colour in acid medium and red colour in alkaline medium
(B) Yellow colour in acid medium and colourless in alkaline medium
(C) Colourless in alkaline medium and Yellow colour in acid medium
(D) Yellow colour in alkaline medium and red colour in acid medium
41) Which of the following is Hoffmann mustard oil reaction?
(A) Reaction of aromatic amine with iodoform
(B) Reaction of primary amine with CHCl3
(C) Reaction of primary amine with CS2 and HgCl2
(D) Reaction of secondary amine with nitrous acid
42) Biuret test in not given by……………
(A) Urea (B) Proteins

Page 167

(C) Carbohydrates (D) Polypeptides
43) Extraction of zinc from zinc blende is achieved by
(A) electrolytic reduction
(B) roasting followed by reduction in presence of carbon
(C) roasting followed by reduction with another metal
(D) only roasting
44) Which of the following gas was responsible for bhopal gas tragedy:
(A) methyl isocyanate (B) Methane
(C) Methyl Chloride (D) Iso-Propyl Acetate
45) Which of the following metal is kept in wax?
(A) Sodium (B) Lithium
(C) Silver (D) Magnesium
46) Which of the following will be strongly acidic?
(A) When pOH=4.5 (B) When pH=14
(C) When pOH=7 (D) When pH=0
47) Mendius reaction converts an alkyl cyanide to
(A) a primary amine (B) an aldehyde
(C) a ketone (D) an oxime
48) Heating of sulfide ore to a high temperature in presence of air. This process is
called
as…..
(A) refining (B) calcination
(C) roasting (D) Smelting
49) Which of the following metals reacts with steam to form a metal oxide and
hydrogen?
(A) Copper (B) Lead
(C) Silver (D) Aluminium
50) The ratio of mass of hydrogen to the mass of oxygen in water always
(A) 1:8 (B) 8:1
(C) 1:2 (D) 2:1
51) -COOH group can be converted to -NH2 group by
(A) Claisen condensation (B) Schmidt reaction
(C) Perkins reaction (D) Cannizzaro reaction
52) Ozone in the stratosphere is depleted by
(A) CF2Cl2 (B) C7F16
(C) C6H6Cl6 (D) C6F6
53) Which of the following compounds does not have a carboxyl group?
(A) Benzoic acid (B) Palmitic acid
(C) Oleic acid (D) Picric acid

Page 168

54) What is the chemical formula of plaster of Paris and gypsum?
(A) CaSO4·1/2H2O and (B) CaSO4·2H2O and CaSO4·1/2H2O
CaSO4·2H2O
(C) CaSO4·H2O and Ca(OH)2·2H2O (D) Ca(OH)2·H2O and CaSO4·2H2O
55) The correct order of thermal stability of hydrogen halides (HX) is :
(A) HI > HBr > HCl > HF (B) HCl < HF < HBr < HI
(C) HF > HCl > HBr > HI (D) HI > HCl < HF > HBr
56) Formic acid and acetic acid can be distinguished by:
(A) litmus solution (B) caustic soda
(C) NaHCO3 (D) ammoniacal AgNO3
57) Cassiterite is an ore of :
(A) Pb (B) Zn
(C) Sn (D) Mn
58) Which of the following is called as pearl ash?
(A) Na2CO3 (B) K2CO3
(C) NaHCO3 (D) CaCO3
59) The correct acidic order of the following is

(A) I > II > III (B) III > I > II
(C) II > III > I (D) I > III > II
60) When 1 liter water cooled from 4ºC to 0ºC, its volume…….
(A) first decrease and then increase (B) increase
(C) remain same (D) decrease
61) Freon-12 is commonly used as
(A) an insecticide (B) fire extinguisher
(C) a solvent (D) a refrigerant
62) Sorption is the term used when_______
(A) Adsorption takes place
(B) Absorption takes place
(C) Both Adsorption and Absorption takes place

Page 169

(D) Desorption takes place
63) The continuous zig-zag movement of colloidal particles in a dispersion medium
is called as:
(A) Dispersion (B) Tyndall effect
(C) Oscillation (D) Brownian movement
64) Match the column Ι and column ΙΙ :
Column Ι Column ΙI
1. Charles’ law p. 𝑉 ∝ 𝑛 (p and T constant)
2. Boyle’s law q. 𝑉 ∝ 𝑇 (P and n constant)
3. Avogadro law r. pi=xiptotal (At constant V and T)
4. Dalton’s law s. PV is constant
Correct match is
(A) 1-p, 2-q, 3-r, 4-s (B) 1-q, 2-s, 3-p, 4-r
(C) 1-s, 2-q, 3-r, 4-p (D) 1-p, 2-r, 3-q, 4-s
65) Primary, secondary and tertiary amine can be distinguished by use of
(A) Baeyer reagent (B) Fehling solution
(C) Tollen’s reagent (D) Hinsberg reagent
66) Which of the following information is given by FTIR technique?
(A) Absorption of functional groups
(B) Particle size
(C) Confirmation of formation of nanoparticles
(D) Crystal structure

67) A radioactive nucleus of mass M emits a photon of frequency n and the nucleus
recoils. The recoil energy will be__________
(A) Mc²- hn (B) h²v²/ 2Mc²
(C) Zero (D) hn/2Mc2
68) A gas will approach ideal behavior at:
(A) low temperature and low (B) low temperature and high pressure
pressure
(C) high temperature and low (D) high temperature and high pressure
pressure
69) Photoelectric emission occurs only when the incident light has more than a certain
minimum _________
(A) Power (B) Wavelength
(C) Intensity (D) Frequency

Page 170

70) In Freundlich Adsorption isotherm, the value of 1/n is.
(A) 1 in case of physical adsorption (B) 1 in case of chemisorption
(C) between 0 and 1 in all cases (D) between 2 and 4 in all cases
71) The geometry of XeOF2 is
(A) Pyramidal (B) T-shaped
(C) Octahedral (D) Tetrahedral
72) What is the monomer unit of natural rubber?
(A) Isoprene (B) Ethene
(C) Neoprene (D) Tetrafluoro ethene
73) A substance which can act both as antiseptic and disinfectant:
(A) Aspirin (B) phenol
(C) Analgin (D) sodium pentothal
74) Match the catalyst given in Column I with the processes given in Column II
Column Ι Column ΙI
X. TiCl4 + Al(CH3)3 i. Contact process
Y. V2O5 ii. Vegetable oil to ghee
Z. Ni in the presence of hydrogen iii. Ziegler Natta catalyst
(A) X-iii, Y-i, Z-ii (B) X-iii, Y-ii, Z-i
(C) X-ii, Y-i, Z-iii (D) X-i, Y-iii, Z-ii
75) Ethylenediamine tetraacetic acid is an example of :
(A) monodentate ligand (B) hexadentate ligand
(C) tridentate ligand (D) pentadentate ligand
*-*-*-

Page 171

M.E.(Electronics& Communication Engg.)/M.Tech. Microelectronics/M.E. in ECE(Artificial
Intelligence)
1. The depletion width of a Si p-n junction at a reverse bias of 10 V is 2 μm. When the reverse bias is
increased to 20 V, the depletion width will be:
(A) 4.0 μm (B) 3.2 μm
(C) 2.8 μm (D) 2.4 μm

2. The Schottky barrier lowering is caused by
(A) the strong force (B) the image force
(C) the gravitation force (D) the inter-atomic force

3. For signal x(n)=6 cos , the signal power is:
(A) 36 Watts (B) 18 Watts
(C) 72 Watts (D) 54 Watts

4. A function sampled at Nyquist rate fs=2fo. The function can be recovered from its samples only if
it is a/an:
(A) Sine wave of frequency fo
(B) Triangular wave of fundamental frequency fo
(C) Periodic square wave of fundamental frequency fo
(D) Unit step function

5. N-channel FETs are preferred to p-channel FETs because
(A) Holes have higher velocity
(B) Electrons have higher mobility than holes
(C) Electrons have higher diffusivity than holes
(D) Electrons have higher effective mass than holes

6. An AM wave is given by
SAM(t)=10 (1+0.4 cos 103t +0.3 cos 104 t) cos 106t. The modulation index is:
(A) 0.4 (B) 0.5
(C) 0.3 (D) 0.9

7. 10 signals, each band-limited to 5 KHz are to be transmitted over a single channel by frequency
division multiplexing. If AM-SSB modulation guard band of 1 KHz is used, then the bandwidth of
the multiplexed signal will be:
(A) 79 KHz (B) 60 KHz
(C) 59 KHz (D) 61 KHz

8. Pinch-off is the situation when
(A) the drain current is zero
(B) no more free carriers are available for conduction
(C) the drain current starts reducing
(D) electrons and holes are completely recombined

9. A signal X(t) = 100 cos (24 𝜋 x 103) t is ideally sampled with sampling period of 50 𝜇 sec and then
passed through an ideal low pass filter with cut off frequency of 15 KHz. Which of the following
frequencies is/are present at the filter output?
(A) 12 KHz only (B) 8 KHz only
(C) 12 KHz and 9 KHz (D) 12 KHz and 8 KHz

Page 172

10. A solar cell operates in:
(A) photo conductive mode (B) photo resistive mode
(C) photo transmitive mode (D) photo voltaic mode

11. In a twin wire transmission line in air the adjacent voltage maxima are at 12.5 cm and 27.5 cm.
The operating frequency is:
(A) 300 MHz (B) 1 GHz
(C) 2 GHz (D) 6.28 GHz

12. The depth of the penetration of a wave in a lossy dielectric increases with increasing:
(A) Conductivity (B) Permeability
(C) Wavelength (D) Permittivity

13. Poynting vector signifies:
(A) Current density vector producing electrostatic field
(B) Power density vector producing electromagnetic field
(C) Current density vector producing electromagnetic field
(D) Power density vector producing electrostatic field

14. The magnitude of open circuit and short circuit input impedances of a transmission line are 100 Ω
and 25 Ω respectively. The characteristic impedance of the line is:
(A) 25 Ω (B) 50 Ω (C) 75 Ω (D) 100 Ω

15. The transmission line is distortion less if:
(B) RL=GC (C) LG=RC (D) RG=LC

16. The technique OTDR (Optical time domain reflectometry) is used for the measurement of :
(A) Bandwidth (B) Core diameter
(C) Attenuation (D) Cladding diameter

17. A CE transistor amplifier is preferred because of
(A) high-input impedance (B) low-output impedance
(C) low-current gain (D) high-voltage gain

18. Maximum direct energy band gap is in :
(A) GaAs (B) InAs (C) InSb (D) GaSb

19. Which of the following circuit has the best bias stabilization?
(A) Fixed bias (B) Self-bias
(C) Collector feedback bias (D) Voltage divider bias

20. The permeability and permittivity of a medium are:
(A) Independent to each other (B) Related by the velocity of EM waves
(C) Related to the Boltzman constant (D) Related to Fermi dirac distribution

21. The Bragg’s equation for X-ray diffraction from crystal planes is given by:

(B) 𝑛𝜆 = 2𝑑 sin 𝜃

(D) λ =sin 𝜃 + 1
(2)

Page 173

22. The type of multiple access used in 2nd Generation GSM technology is……………..
(A) FDMA/TDMA (B) CDMA
(C) OFDMA (D) FM

23. Bluetooth uses ______method in the physical layer to avoid interference from other devices or
other networks.
(A) DSSS (B) FHSS (C) FDMA (D) OFDM

24. Ic is the dc collector current of a BJT = 2 mA at room temperature where kT/q=25 mV.
Given hfe=100, the value of hieis given by:
(A) 125 Ω (B) 25 Ω (C) 1250 Ω (D) 2500 Ω

25. Phase-locked loop (PLL) circuitry is used for
(A) Carrier wave recovery only (B) Phase recovery only
(C) Carrier wave & Phase recovery (D) Demodulation

26. Which one of the following is not a vectored interrupt?
(A) TRAP (B) INTR (C) RST 7.5 (D) RST3

27. The following program starts at location 0100 H
LXI SP, 00FF
LXI H, 0107 H
MVI A, 20 H
SUB M
The content of the accumulator when the program counter reaches 0109 H is
(A) 20 H (B) 02 H (C) 00 H (D) FF H

28. An important impairment to digital signals in a communication system is the irregularities in timing
caused by imperfections in clock extraction and waveform regeneration. This effect is known as
__________________.
(A) Jitter (B) Aliasing (C) Fading (D) Attenuation

29. Which of the following modulations is digital in nature?
(A) PPM (B) PAM (C) FM (D) DM

30. An analog signal is sampled at 36 kHz and quantized into 256 levels. The time duration of a bit of
binary coded signal is
(A) 5.78 μs (B) 3.47 μs (C) 6.43 ms (D) 7.86 ms

31. The input resistance of a Cathode Ray Oscilloscope is of the order of
(A) tens of ohm (B) megaohm
(C) kilo ohm (D) fraction of an ohm

32. A 4 bit ripple counter and a 4 bit synchronous counter are made by flip-flops having a propagation
delay of 10ns each. If the worst case delay in the ripple counter and the synchronous counter be
R and S respectively, then
(A) R=10 ns , S=40 ns (B) R=40 ns , S=10 ns
(C) R=10 ns , S=30 ns (D) R=30 ns , S=10 ns

(3)

Page 174

33. The output of Mealy system is 1 if there has been a pattern of 11000, otherwise 0. The minimum
state for this system is
(A) 5 (B) 4 (C) 6 (D) 7

34. Four memory chips of 16X4 size have their address buses connected together. This system will be
of size
(A) 64X4 (B) 32X8 (C) 16X16 (D) 256X1

35. The address bus width of a memory of size 1024X8 bits is
(A) 10 bits (B) 13 bits (C) 8 bits (D) 18 bits

36. In three layer power diode, the middle layer is employed ________.
(A) to increase voltage rating (B) to increase current rating
(C) to increase both (voltage & current) (D) None of these

37. A device that converts thermal energy into electrical energy is called a :
(A) thermocouple (B) solar cell
(C) piezoelectric device (D) generator

38. Determine the initial value of x(t). The Laplace transform X(s)=1/(s2+5s-2)
(A) 1 (B) -2 (C) 5 (D) 0

39. Convert 11001012 into octal base system.
(A) 1458 (B) 3408 (C) 2578 (D) 1508

40. The minimum no. of NOR gates required to implement A(A+B’)(A+B’+C) is equal to
(A) Not required (B) 3 (C) 4 (D) 7

41. In a transmission line terminated with a load equal to the characteristics impedance, the reflection
coefficient is
(A) Infinity (B) +1 (C) -1 (D) Zero

42. The power spectral density of white noise
(A) is dependent on frequency (B) varies with inverse of frequency
(C) varies with square of frequency (D) is constant with frequency

43. The intrinsic impedance of free space is
(A) 1 ohm (B) 13.3 ohm (C) 377 ohm (D) 3X106 ohm

44. The Ebers – Moll model of a BJT is valid
(A) Only in active mode (B) Only in active and saturation modes
(C) Only in active and Cut – off modes (D) In active, saturation and cut – off modes

45. Which of the following is true for a pnp transistor in saturation region?
(A) CB junction is reversed bias and the EB junction is forward bias
(B) CB junction is forward bias and the EB junction is forward bias
(C) CB junction is forward bias and the EB junction is reverse bias
(D) CB junction is reversed bias and the EB junction is reverse bias

(4)

Page 175

46. Zener diodes are also known as
(A) Voltage regulators (B) Forward bias diode
(C) Breakdown diode (D) Low gain amplifier

47. When does the transistor act like an open switch?
(A) Cut off region (B) Inverted region
(C) Saturated region (D) Active region

48. Where should be the bias point set in order to make transistor work as an amplifier?
(A) Cut off and saturation region (B) Inverted region
(C) Saturated region (D) Active region

49. Two sinusoidal signals of equal amplitude and frequency are applied to X and Y plate of CRO
respectively. The observed Lissajous pattern is a straight line. The phase shift between signals is
(A) zero (B) 90o
o
(C) either zero or 180 (D) either 90o or 270

50. In dc tachogenerators which are used for measurement of speed of shaft, frequent calibration is
necessary because
(A) contacts wear off
(B) strength of permanent magnet decreases with age
(C) armature current produces heating effect
(D) there is back emf

51. A series RC Circuit is suddenly connected to a dc voltage of V volts. The current in the series circuit,
just after the switch is closed, is equal to
(A) Zero (B) V/RC (C) VC/R (D) V/R

52. Matched filter is used for
(A) Coherent detection (B) Non Coherent detection
(C) Coherent & non Coherent detection both (D) Amplification

53. A pure ALOHA network transmits 200-bit packets on a shared channel of 200 kbps. What is the
requirement to make this frame collision-free?
(A) 2 msec (B) 4 msec (C) 1 msec (D) 0.5 msec

54. A slotted ALOHA network transmits 200-bit packets using a shared channel with a 200-kbps
bandwidth. Find the throughput if the system (all stations together) produces 1000 frames per
second.
(A) 92 packets (B) 368 packets (C) 276 packets (D) 151 packets

55. The reverse bias current in a p-n diode is due to
(A) Minority carriers (B) Majority carriers
(C) Electrons only (D) Holes only

56. A BJT is a
(A) Current –Controlled device (B) Voltage - Controlled device
(C) Power- Controlled device (D) Field- Controlled device

(5)

Page 176

57. Field Effect Transistor (FET) is an unipolar device because:
(A) VDS of one polarity is used
(B) VGS of one polarity is used
(C) ID constitutes either electrons or holes
(D) All the charge carriers flow towards a single pole

58. Output impedance of an ideal op-amp is:
(A) Infinite (B) Very high (C) Low (D) Zero

59. A diaphragm has a natural frequency of 30 kHz. If both its diameter & thickness are halved, the
natural frequency will become
(A) 15 kHz (B) 240 kHz (C) 60 kHz (D) 120 kHz

60. An 8 bit converter is used for a dc range of 0-10 V. Find the weight of LSB
(A) 39 mV (B) 78 mV (C) 39.2 mV (D) None of these

61. A successive approximation A/D converter has a resolution of 20 mV. What will be its digital
output for an analog input of 2.17 V?
(A) 01101100 (B) 01101101 (C) 01101011 (D) Insufficient data

62. In a digital frequency meter, the Schmitt trigger is used for
(A) conversion of sinusoidal waveforms into rectangular pulses
(B) scaling of sinusoidal waveforms
(C) providing time base
(D) none of these

63. The angle of a series R-L-C circuit is leading if
(A) XL=0 (B) XC=0 (C) XL> XC (D) XC> XL

64. The open-loop control system is one in which
(A) The output is dependent on the control input
(B) The output is independent of the control input
(C) Only system parameters have an effect on the control output
(D) None of these

65. Which component cannot be fabricated into ICs?
(A) Diode (B) Resistor (C) Inductor (D) Transistor

66. Upon what principle does a relaxation oscillator operate?
(A) Resistor in cascade
(B) The rectification process of a diode
(C) The charging and discharging of capacitor
(D) Switching transistors

67. Which of the following IC processes analog signals?
(A) Digital IC (B) Discrete IC (C) Linear IC (D) Monolithic IC

(6)

Page 177

68. Monolithic ICs are
(A) Forms of discrete circuits
(B) Combination of thin-film and thick-film circuits
(C) Also called hybrid ICs
(D) fabricated on a single chip

69. Where the result of an arithmetic and logical operation are stored?
(A) In Accumulator (B) In Cache Memory
(C) In ROM (D) In Instruction Registry

70. What Mnemonic represents?
(A) Strings (B) Physical Address
(C) Operation Address (D) Operation codes

71. Fan-in and Fan-out are the characteristics of ___________
(A) Registers (B) Logic families
(C) Sequential Circuits (D) Combinational Circuits

72. Which among following is Volatile?
(A) ROM (B) EPROM (C) DROM (D) RAM

73. Which of the following technology distributes the coverage of the cell and extends the cell
boundary to hard-to-reach places?
(A) Sectoring (B) Cell splitting
(C) Micro cell zone concept (D) Scattering

74. Which of the following is not a linear modulation technique?
(A) π/4 QPSK (B) OQPSK (C) BPSK (D) FSK

75. How many users or voice channels are supported for each 200 KHz channel in GSM?
(A) Eight (B) Two (C) Sixty Four (D) Twelve

x-x-x

(7)
Space for Rough Work

Page 178

MBA for Executives (MBAfEX)
1. Arrange the following in correct chronological order of their years of establishment?
(RBI, SBI, IFCI, ICICI, NABARD, UTI)
(A) RBI, SBI, IFCI, ICICI, NABARD, UTI (B) RBI, IFCI, ICICI, SBI, NABARD,
UTI
(C) RBI, IFCI, NABARD, ICICI, SBI, UTI (D) RBI, IFCI, ICICI, SBI, UTI, NABARD

2. A Bank included in the second schedule of RBI is called as _________?
(A) Scheduled Bank (B) Commercial Bank
(C) National Bank (D) Regional Rural Bank

3. Which of the following actions of Central Bank can increase deposit component of the
money supply?
(A) Increasing reserve requirements / decreasing the volume of reserves
(B) Lowering reserve requirements / increasing volume of reserves
(C) Lowering reserve requirements / decreasing the volume of reserves
(D) Increasing reserve requirements / increasing volume of reserves

4. Which among the following is used for a situation of “Too much money chasing too
few goods?”
(A) Demand Pull Inflation (B) Cost pull inflation
(C) Stagflation (D) Hyperinflation

5. Which among the following authority appoints a Deputy Governor in Reserve Bank of
India?
(A) Governor of RBI (B) Central Board of Directors
(C) Central Government (D) Committee of the Central Board

6. To get the Credit History of a company, which among the following should be
approached?
(A) ECGC (B) CIBIL (C) SEBI (D) RBI

7. Which among the following shows a correct descending order of liquidity in M1, M2
and M3?
(A) M1 > M2 > M3 (B) M2 > M1 >M3
(C) M3 > M2 > M1 (D) M1 > M3 > M2

8. Which is the top diamond producing country in the world?
(A) USA (B) Congo (C) China (D) Russia

9. Which of the following is the leading state in India in ship breaking industry?
(A) Gujarat (B) West Bengal (C) Andhra Pradesh (D) Jharkhand

10. Which of the following does not come under social infrastructure?
(A) Healthcare (B) Education (C) Housing (D) Roads

Page 179

11. Energy Efficiency Services Limited is under the ministry of?
(A) Ministry of Coal
(B) Ministry of Petroleum and Natural Gas
(C) Ministry of New and Renewable Energy
(D) Ministry of Power

12. In which year, India faced its first stock market scam?
(A) 1991 (B) 1978 (C) 1987 (D) 1992

13. What is the percentage of GDP that India invests in health infrastructure?
(A) 3% (B) 5% (C) 7% (D) 6.5%

14. Which National Highway connects Delhi to Kolkata?
(A) NH44 (B) NH9 (C) NH2 (D) NH5

15. In which year Indian Railways was nationalized?
(A) 1957 (B) 1951 (C) 1947 (D) 1941

16. In which year was the construction of Indira Gandhi canal started?
(A) 1955 (B) 1952 (C) 1958 (D) 1961

17. Which among the following is not a benefit of neem coated urea?
(A) Slow down the process of nitrogen release
(B) Enhance the yield
(C) Increase urea requirement
(D) Reduce fertilizer cost

18. What is the share of carp to Indian fisheries?
(A) 50% (B) 30% (C) 75% (D) None of these

19. Which country is the major export destination for Indian Black tiger shrimp?
(A) China (B) Japan (C) Germany (D) USA

20. Which among the following is an urban agricultural practice?
(A) Mixed agriculture (B) Tactical Gardens
(C) Rooftop Gardens (D) Aquaponics

21. What is India’s cement production at the time of independence?
(A) 2.7 million tones (B) 1.5 million tonnes
(C) 5.4 million tones (D) 6.4 million tonnes

22. In a market in which investors buy securities directly from the company issuing them,
then it is termed as
(A) Public Offer market (B) Initial public market
(C) Primary Market (D) Secondary Market

23. Where was the 1st Cotton Mill established in India?
(A) Bombay (B) Madras (C) Calcutta (D) Hyderabad

Page 180

24. Which of the following is also regarded as disguised unemployment?
(A) Under employment (B) Frictional unemployment
(C) Seasonal unemployment (D) Cyclical unemployment

25. What restricts the spending of a person in a market?
(A) Marginal Utility (B) Purchasing power
(C) Demand curve (D) None of these
26. Real National income increases in which of the following circumstances?
(A) When Prices of goods increases
(B) When saving of people increases
(C) When Inflation increases prices and taxes
(D) When the production of goods and services increases

27. What are first generation bio fuels?
(A) Biofuels made of vegetable oils (B) Biofuels made of feed stocks
(C) Biofuels made of algae (D) None of these

28. Which among the following is not a reason for the decline of Cotton Industry in India
during the British rule?
(A) Availability of raw material (B) Lack of market
(C) Lack of modern machines (D) Lack of Labor

29. Which one of the following is the highest produced silk type in India?
(A) Eri (B) Mulberry (C) Raw silk (D) Muga

30. What is the contribution of the unorganized market in India’s retail market?
(A) 30% (B) 88% (C) 48% (D) 61%

31. Many a times we read about “Circuit Breakers” in share markets. They are temporary
measures which halt the trading on which of the following occasion?
(A) On special days
(B) When a new share is traded for the first time
(C) When the prices of particular stock’s rises or falls by a specified amount in specified
time
(D) When trading of a particular stock rises beyond a specified volume

32. Which among the following authority decides upon any issues regarding the revision
of fee collected as Development Fee from Airports in India?
(A) Airport Authority of India
(B) Airports Economic Regulatory Authority
(C) Ministry of Civil Aviation
(D) Secretary, Ministry of Civil Aviation

33. Which among the following actions will be avoided by a bank while choosing the tools
to control risk?
(A) Going for Diversification
(B) Going for Insurance & Hedging
(C) Avoiding fixation of exposure ceiling
(D) Transferring the risk to another party

Page 181

34. Which among the following is a correct impact of Dear Money?
(A) Borrowings become cheap
(B) Borrowings become expensive
(C) Borrowings become either cheap or expensive
(D) There is no impact of Dear Money on Borrowings

35. Express Remit is the brand name of a remittance facility by which of the following
banks?
(A) State Bank of India (B) Punjab National Bank
(C) Bank of Baroda (D) ICICI Bank

36. In context with the Balance of Payments, the Merchandise exports, which refer to sale
of goods abroad, belong to which among the following?
(A) Credit Entry in the Current Account (B) Debit Entry in the Current account
(C) Credit entry in the Capital Account (D) Debit entry in the Capital Account

37. Which among the following cannot be called an ant inflationary measure?
(A) Raising the Bank Rates
(B) Raising the Reserve Ratio Requirements
(C) Purchase of securities in the Open Markets
(D) Rationing of the Credit

38. Which among the following fertilizers is least likely to affect the Soil pH?
(A) Urea (B) Rock Phosphate
(C) Ammonia (D) Muriate of potash

39. Which among the following is not correctly matched?
(A) Mouling National Park – Arunachal Pradesh
(B) Saddle Peak National Park – Andaman & Nicobar Islands
(C) Fossil National Park – Madhya Pradesh
(D) Rani Jhansi Marine National Park – Lakshadweep

40. In which of the following cases, the ecological pyramid is never inverted?
(A) Pyramid of energy (B) Pyramid of biomass
(C) Pyramid of numbers (D) Pyramid of species richness

41. Dumping of Iron to the upper ocean can significantly induce the Carbon sequestration
in Oceans. This is because introduction of iron to the upper ocean__:
(A) Will increase CO2 solubility in Ocean water
(B) Will stimulate phytoplankton bloom
(C) Will suppress the growth of phytoplankton
(D) Will stimulate the growth of fishes and zooplankton

42. Which of the following is an example of in situ conservation of biodiversity?
(A) Captive breeding (B) Seed bank
(C) National park (D) Pollen bank

43. Insect: Disease:: War : ?
(A) Army (B) Defeat (C) Arsenal (D) Destruction

Page 182

44. Book: Cover:: Painting : ?
(A) Example (B) Wall (C) Colour (D) Frame

45. Float: Sink:: Boat : ?
(A) Ship (B) War (C) Submarine (D) Missile

46. Water: Dam:: Trade: ?
(A) Commerce (B) Economy (C) Goods (D) Trade Policy

47. Interest: Money lender:: Salary : ?
(A) Employees (B) Zamindar (C) Workers (D) Prisoners

48. Find the odd number/letters from the given alternatives.
(A) Swimming (B) Sailing (C) Diving (D) Driving

49. Find the odd number / letters / word from the given alternative.
(A) Discernment (B) Perception (C) Penetration (D) Insinuation

50. Find the odd number / letters / word from the given alternative.
(A) 5720 (B) 6710 (C) 2640 (D) 4270

51. Find the odd number/letters from the given alternatives.
(A) 626 (B) 841 (C) 962 (D) 1090

52. Find the odd number/letters from the given alternatives.
(A) PQXZ (B) CQBN (C) ABDF (D) PRMN

53. The total of the ages of Amar, Akbar and Anthony is 80 years. What was the total of
their ages three years ago?
(A) 71 years (B) 72 years (C) 74 years (D) 77 years

54. Two bus tickets from city A to B and three tickets from city A to C cost Rs. 77 but three
tickets from city A to B and two tickets from city A to C cost Rs. 73. What are the fares
for cities B and C from A?
(A) Rs. 4, Rs. 23 (B) Rs. 13, Rs. 17 (C) Rs. 15, Rs. 14 (D) Rs. 17, Rs. 13

55. A number of friends decided to go on a picnic and planned to spend Rs. 96 on eatables.
Four of them, however, did not turn up. As a consequence, the remaining ones had to
contribute Rs. 4 each extra. The number of those who attended the picnic was
(A) 8 (B) 12 (C) 16 (D) 24

56. A, B, C, D and E play a game of cards. A says to B, "If you give me three cards, you
will have as many as E has and if I give you three cards, you will have as many as D
has." A and B together have 10 cards more than what D and E together have. If B has
two cards more than what C has and the total number of cards be 133, how many cards
does B have?
(A) 22 (B) 23 (C) 25 (D) 35

57. What will come at the place of question mark?
1, 9, 25, 49,?, 121.

Page 183

(A) 100 (B) 91 (C) 64 (D) 81

58. What will come at the place of question mark?
4, 7, 12, 19, 28, ?
(A) 49 (B) 36 (C) 30 (D) 39

59. What will come at the place of question mark?
6, 11, 21, 36, 56, ?
(A) 91 (B) 51 (C) 81 (D) 42

60. What will come at the place of question mark?
8, 28, 116, 584, ?
(A) 1752 (B) 3504 (C) 3508 (D) 3502

61. A and B are brothers. C and D are sisters. A's son is D's brother. How is B related to C?
(A) Father (B) Brother (C) Uncle (D) Grandfather

62. A is son of C while C and Q are the sisters to one another. Z is the mother of Q. If P is
the son of Z, Which one of the following statements is correct?
(A) Q is the grandfather of A (B) P is the maternal uncle of A
(C) P is the cousin of A (D) Z is the brother of C

63. Pointing at a photo, Dinesh said, "His father is only son of my mother." The photo
belongs to- :
(A) Dinesh (B) Dinesh's brother (C) Dinesh's father (D) Dinesh's son

64. Looking at a portrait of a man, Sanjay said, "His mother is the wife of my father's son.
Brothers and sisters I have none." At whose portrait was Sanjay Looking?
(A) His son (B) His nephew (C) His cousin (D) His uncle

65. A man said to a lady, "The son of your only brother is the brother of my wife." What is
the lady to the man?
(A) Mother (B) Sister
(C) Sister of father-in-law (D) Grandfather

Direction Question number 66-70: To each of the following question four probable
answers have been given. Select the most appropriate alternative as the answer.
66. While traveling in a train, you found that some college students pulling the alarm chain
simply to get down at their desired point, you would -
(A) With the help of other passengers check them from doing so
(B) Let them pull the chain but check them from detraining
(C) Inform the guard of the train as soon as it stops
(D) Keep quiet and do nothing

67. While going on a scooter, you find someone has been hurt by your vehicle, you would
-
(A) Try to run away from the spot immediately
(B) Stop your vehicle and say 'I am sorry'
(C) Take him to doctor and arrange for his medical aid
(D) Pay compensation for the injury and in this way try to dispose off the matter

Page 184

68. Your maid has invited you to her daughter's wedding. You would -
(A) Completely ignore her
(B) Attend the wedding
(C) Buy a gift for her daughter and help in wedding
(D) Congratulate her and make up some excuse for not being able to attend
69. You are alone in the house and your sister-in-law is suddenly experiencing labour pains.
You would -
(A) Get upset and do not know what is the right step
(B) Go out of the house to call your family doctor
(C) Walk her to the nearest hospital
(D) Call an ambulance for emergency

70. While travelling in your car, certain persons stop you on the way asking you to take an
injured child to the hospital. You would -
(A) Ask them to leave your way and then drive away
(B) Ask them to first call the police
(C) Immediately take the child to hospital
(D) Get out of the car and ask some other person to help to take the child to hospital

Directions Question Number 71-75: In each of the following questions four possible
answers are given. Find out the most suitable answer.
71. Which is the best statement to achieve success in life?
(A) The person should be well educated
(B) The person should be rich and prosperous
(C) The person should be sincere and hard working
(D) The person should be honest

72. People wear goggles because:
(A) They protect their eyes from drizzling light
(B) They conceal their eyes
(C) By it they look handsome
(D) They see better by it

73. An educated wife is useful because:
(A) She is more beautiful than others
(B) She is perfect housewife
(C) She can earn by getting job
(D) She is faithful

74. Policeman wears a uniform because:
(A) It is provided by government for free
(B) It scares the criminals
(C) He can be easily recognized
(D) It keeps him smart

75. People use rubber soles in their shoes because:
(A) They are fashionable
(B) Rubber is more porous than leather
(C) They produce less sound
(D) They are durable

Page 185

Direction Question number 76-80: Read the following text carefully and select the
most appropriate alternative as the answer to each of the questions 76-80.
In-situ conservation means the conservation of a species in its natural habitat and the
maintenance and recovery of viable population of species in their original place. It
retains the material in its original location, where it was found, and it conserves the
natural process of evolution, which is not possible in case of ex-situ conservation.
Turkey is apparently the first country to produce a national plan for in-situ conservation
of genetic diversity (Kaya et al., 1997). The genetic diversity of lentils’ wild relatives
is rich in the areas of Turkey and Syria.The distribution of all four wild taxa of genus
Lens overlaps in the region of Aegean and the southwestern region (Ferguson et al.,
1996). Further, an important area to target in-situ conservation includes West Turkey
for L. nigricans; Northwest Syria, Southeast Turkey, South Syria, and Jordan for L.
culinaris ssp. orientalis; coastal border region between Turkey and Syria stretching
along the Syrian coast for L. ervoides; and South Syria for L. culinaris ssp. odemensis
(Ferguson and Robertson, 1996). But, unfortunately, many areas of Turkey and other
Mediterranean countries are threatened with the loss of invaluable genetic diversity
(Solh and Erskine, 1981). However, L. culinaris ssp. odemensis and L. ervoides are the
wild lentil species which are most vulnerable to the loss of alleles (Ferguson et al.,
1996). An exact status of on-farm, in-situ conservation of diverse germplasm is not well
documented (Furman et al., 2009). The seed has been collected from each taxon and
used in further study to determine the diversity within the population, which helps to
establish the potential of in-situ conservation for wild Lens species (Ferguson and
Robertson, 1996).
In situ conservation is complementary to ex situ conservation. It is a dynamic mode of
germplasm conservation as compared to the static nature of ex situ conservation. It
allows the continuous evolution of barley by allowing natural selection to act upon it.
These days in situ conservation has attracted much attention and efforts are being made
to conserve the genetic resources under its native environment. It is important for
conservation of species that are difficult to conserve under ex situ conditions, especially
crop wild relatives (CWR). With the development of new biotechnological methods,
crop wild relatives are becoming increasingly important in crop genetic improvement
programs. It has been estimated that there are 50,000–60,000 CWR species worldwide,
of these 700 are of highest priority, as these species comprise primary and secondary
gene pools of the world’s most important food crops and barley is one of them.

Page 186

In situ conservation often takes place in protected areas or habitats as opposed to ex situ
conservation. The second report on The State of World Plant Genetic Resources for
Food and Agriculture, 2010, has indicated an increase in the number of protected areas.
The Erebuni reserve has been established in Armenia to conserve populations of
Hordeum spontaneum, H. bulbosum, and Hordeum glaucum along with cereal wild
relatives. Research in West Asia has found significant CWR diversity in cultivated
areas especially at the margins of fields and along roadsides. Rare CWR of barley along
with wheat, lentil, pea, and faba bean have been reported in the modern apple orchard
of Jabal Sweida in the Syrian Arab Republic. In order to protect CWR, the Syrian Arab
Republic in 2007 established a protected area at Alujat and has banned grazing of wild
ruminants in the Sweida region. Besides these, the priority locations for conservation
have been identified for Hordeum species in America. Chile is the high-priority location
for Hordeum chilense identified as one of the high priority CWRs. For wild species of
Hordeum, namely, H. vulgare ssp. spontaneum and H. bulbosum, the highest priority
location for conservation has been identified in the Near East.
76. The acronym CWR stands for;
(A) Crop wild region (B) Crop with relatives
(C) Crop wild relatives (D) Clone wild relatives

77. Syrian Arab Republic in 2007 established a protected area at;
(A) Amirat (B) Alujat (C) Horedeum (D) Aagean

78. The genetic diversity of lentils’ wild relatives is rich in the areas of;
(A) Turkey and Syria (B) Turkey and UAE
(C) Turkey and Syria (D) UAE and Syria

79. Crop wild relatives are becoming increasingly important in crop genetic improvement
programs with;
(A) The development of new techniques of cultivation
(B) The development of new biotechnological methods
(C) The diversity in thought process
(D) Government promotion

80. L. culinaris ssp. odemensis and L. ervoides are the wild lentil species which are most
vulnerable to;
(A) The loss of vitality (B) The loss of balboas
(C) The loss of alleles (D) The loss of energy

Page 187

Direction Question number 81-85: Read the following text carefully and select the
most appropriate alternative as the answer to each of the questions 81-85.

The effects of global warming are already bringing harm to human communities and
the natural world. Further temperature rises will have a devastating impact and more
action on greenhouse gas emissions is urgently required. Multiple factors contribute to
climate change, and multiple actions are needed to address it. The number of people on
our planet is one of those factors. Every additional person increases carbon emissions
— the rich far more than the poor — and increases the number of climate change
victims – the poor far more than the rich. Population growth is also important because
it affects the Earth's ability to withstand climate change and absorb emissions, such as
through deforestation as land is converted for agricultural use to feed a growing human
population. We are currently adding more than 80 million people a year to our global
population. The UN projects that without further action to address population growth;
there will be two billion more people by 2050, and three-and-a-half billion more by
2100.
Further warming of our atmosphere is now impossible to avoid. The effects of that
warming will depend on how high and how fast the temperature rises. Global warming
changes weather patterns, causing severe weather events, heat waves, droughts and
floods. Climate change is already shrinking glaciers and ice caps, altering the
availability of fresh water. It contributes to ocean acidification, destroying coral reefs
and other aquatic ecosystems. It makes places uninhabitable for some plants and
animals, leading to extinctions and redistribution of species, threatening food
production with alien pests and diseases. For many people in the world, the impacts of
climate change are already here: extreme weather events like the Australian bush fires
and floods in Kenya devastate lives, while critical impacts on agriculture such as
through soil degradation and unseasonal weather lead to unpredictable and unstable
crop yields - especially dangerous for the poorest. Its potential human cost is
catastrophic. A rise in sea levels threatens hundreds of millions of people in coastal
communities and cities across the globe. Food and water shortages and conflict over
productive land will arise, while progress in global health could be rolled back by
communicable diseases such as malaria reaching places they never existed before.
Hundreds of millions of people are likely to be forced to migrate from their homes by
2050.

Page 188

There are multiple drivers of the climate crisis, amongst which population is only one.
Overwhelmingly, emissions are produced by people in the richest countries, and
industrial development and consumption patterns in the Global North are primarily
responsible for the crisis we are in today. Technological solutions, personal lifestyle
changes, policies to end fossil fuel use and develop alternative energy and potentially
fundamental changes to our economic systems are all vital, especially as the timescale
for preventing catastrophic climate change is so short - now less than a decade,
according to the IPCC. Whatever other changes we make, however, their positive
impacts will be reduced and may even be completely cancelled out by adding emissions
from hundreds of millions of new people as our population increases. According to
2020 research evaluating 44 countries, emissions arising as a result of population
growth wiped out two-thirds of the reduction in emissions arising from greater energy
efficiency between 1990 and 2019. Meanwhile, solutions such as reforestation may be
more difficult to implement with more people needing food and land. Reducing the
number of people being born is not a panacea for climate change, but it cuts future
carbon emissions, effectively, simply and permanently, and it boosts the effectiveness
of other solutions. Most importantly, it can be achieved through positive actions which
empower people and improve lives.
81. Without further action to address population growth; there will be
(A) Two billion more people by 2040 (B) Two billion more people by 2050
(C) Three billion more people by 2050 (D) Three billion more people by 2060

82. The primary factors responsible for global warming crisis are;
(A) Declining water in ocean, industrial development and consumption patterns in the
Global North
(B) Emissions produced by people in the richest countries, industrial development and
consumption patterns in the Global South
(C) Emissions produced by people in the richest countries, industrial development and
consumption patterns in the Global North
(D) Declining water in ocean, industrial development and consumption patterns in the
Global West

83. Who is more responsible for carbon emissions?
(A) Rich people (B) Poor people (C) Trees (D) Rivers

84. Climate change is responsible for
(A) Shrinking glaciers (B) Altering the availability of fresh water
(C) Both A and B (D) Neither A and nor B

Page 189

85. Global warming has
(A) Resulted into climate change (B) Not resulted into climate change
(C) Made life safe and healthy (D) Helped the mankind
x-x-x
(11)
Space for Rough Work

Page 190

(MBA-CIT)
1. Forbes' list of World's highest paid athletes released on May 11 has listed which
sportsperson on the top?
(A) Christiano Ronaldo (B) Novac Djokovic
(C) Lionel Messi (D) Neymer

2. Which of the following provides the overall legal system that deals with the internet,
cyberspace and their respective legal issues?
(A) Information Technology Act, 2000
(B) The internet and Cyber Law of India, 2001
(C) Information and Technology Regulation Act, 2002
(D) Information and Technology Act of India, 2000

3. Prof. P C Mahalanobis Award is given by the Government of India for outstanding
contribution in which field?
(A) Public Service (B) Physics (C) Science (D) Statistics

4. Which apex national body launched the National Data and Analytics Platform-NDAP
on May 13th, 2022 to improve access and use of published Indian Government data?
(A) National informatics centre (B) Digital India
(C) NITI Aayog (D) IT Ministry

5. Pandit Shiv Kumar Sharma legendary musician passed away on May 10th, 2022 in
Mumbai. He was associated with which musical instrument?
(A) Sitar (B) Violin (C) Veena (D) Santoor

6. Which of the following is NOT an organization associated with the UNO?
(A) ILO (B) AIIB (C) IAEA (D) WHO

7. World Metrology Day is observed on May 20th. Metrology is associated with which
field?
(A) Astronomy (B) Study of Heights
(C) Chemical reactions (D) Weights and measurements

8. Manik Saha was sworn in as the Chief Minister of which state on May 15?
(A) Manipur (B) Assam (C) Mizoram (D) Tripura

9. Which of the following is the largest ocean in the World?
(A) Pacific Ocean (B) Indian Ocean (C) Atlantic Ocean (D) Arctic Ocean

10. Which of the following is NOT a method of Credit Control?
(A) Cash Reserve Ratio (B) Open market operations
(C) Credit deposit ratio (D) Bank rate policy

Page 191

11. Krishnan Ramanujam has been appointed as the Chairperson of which National level
industry body?
(A) FICCI (B) ASSOCHAM (C) NASSCOM (D) CII

12. Who became the national champion for the 10th time at the 83rd Senior National and
Inter State Table Tennis Championships held at Shillong?
(A) Sutirtha Mukherjee (B) Anthony Amalraj
(C) G Sathiyan (D) Sharath Kamal

13. Which Article in Indian Constitution prohibits discrimination by the State against any
citizen on grounds 'only' of caste, religion, sex, race and place of birth?
(A) 15 (B) 17 (C) 21 (D) 24

14. Sir David Attenborough has been selected by the UN Environment Programme (UNEP)
for the prestigious Champions of the Earth (Lifetime Achievement Award). He hails
from which Country?
(A) The Netherlands (B) New Zealand
(C) Australia (D) England

15. Latest excavations by the Archaeological Survey of India (ASI) at Rakhigarhi have
shown wide remains of the ancient city of Harappan civilization. It is in which State?
(A) Haryana (B) Rajasthan (C) Gujarat (D) Chhatisgarh

16. 'Param Padam' is
(A) an indigenously built super computer (B) an indigenously built submarine
(C) a nuclear capable warfare ship (D) electronic enabled weapons

17. Which one of the following countries has developed the Tianhe-1A, one of the
world's fastest super computer?
(A) Japan (B) South Korea (C) China (D) Chinese Taipei

18. Which one of the following processing core is commonly used in the embedded
computer to perform the specific functions?
(A) Digital Signal processor (B) Analogue signal processor
(C) Parallel signal processor (D) Perpendicular signal processor

19. "Encryption" in cyber world means
(A) decoding someone's personal data
(B) cyber theft
(C) algorithmic alteration of passwords into scrabbled data to present access
(D) a way to increase E-terrorism

20. Which of the following computing is used in the GARUDA Grid of Indian
Government?
(A) Sequential computing (B) Linear computing
(C) Cross-section computing (D) Parallel computing

Page 192

21. Which one of the following computers is the first digital electronic computer albeit
not programmable in the World?
(A) Tommy-Flowers Computer (B) Atanassoff-Berry Computer
(C) Flowers-Andy Computer (D) Claude-Shannon Computer

22. Who invented the world's first programme-controlled computer?
(A) John Atanassoff (B) Konrad Zuse
(C) Harvard Mark I (D) Sergei Sobolev

23. Who is internationally recognized as a father of the modern digital computer?
(A) George Stibitz (B) Clifford Berry
(C) Nikoley Brusentsov (D) Claude Ramsay

24. Who is the father of computer science?
(A) Alan Turing (B) Adam Osborne (C) John Moore (D) Neal Stephenson

25. Which one of the following output devices is used to produce the prints of pie charts,
bar charts and graphs with annotation?
(A) Serial Printer (B) Chain Printer (C) Line Printer (D) Printer Plotters

26. "Weibo" is a social media platform popularly used in
(A) South Korea (B) China (C) Thailand (D) Japan

27. 'MPG' Extension refers usually to what kind of file?
(A) Word Perfect document (B) Animation/Movie File
(C) Ms-Office document (D) Image File

28. What is the part of a database that holds only one type of information?
(A) Report (B) Field (C) Record (D) File

29. The technology used in the electronic printer is called
(A) Microarray (B) Micromillimetric
(C) Microencapsulation (D) Microtechnology

30. PSW stands for
(A) Process Status Word (B) Processor Status Word
(C) Program Status Word (D) Primitive Status Word

31. "Repo Rates" is the rate at which
(A) the RBI lends to State Governments (B) the International Aid Agencies lend to RBI
(C) the RBI lends to banks (D) the banks lend to RBI

32. Words "Bull" and "Big" are associated with which branch of commercial activity?
(A) Foreign Trade (B) Banking (C) Manufacturing (D) Share market

Page 193

33. The holidays for the banks are declared as per
(A) Reserve Bank Act
(B) Banking Regulation Act
(C) Negotiable instruments Act
(D) Securities and Exchange Board of India Act

34. Which if the following costs is related to Marginal Cost?
(A) Fixed Cost (B) Implicit Cost (C) Prime Cost (D) Variable Cost

35. When does the problem of unfavourable balance of payment arise?
(A) When exports decrease (B) When exports increase
(C) When imports are greater than exports (D) When imports decrease

36. In banking business, when the borrowers avail a term loan, initially they are given a
repayment holiday and this is referred as
(A) Moratorium (B) Subsidy (C) Interest waiver (D) Re-phasing

37. Excise duties are taxes on
(A) Sale of commodities (B) Export of commodities
(C) Production of commodities (D) Import of commodities

38. The Indian income tax is
(A) Direct (B) Progressive (C) Indirect (D) Proportional

39. The rising prices in India can be checked through
I. Budgetary Policy
II. Monetary Policy
III. Increasing Production
IV. Increasing income levels
(A) I and II are correct (B) II and III are correct
(C) I , II and III are correct (D) All are correct

40. Cartage paid on the purchase of a new machine is debited to
(A) Cartage account (B) Profit and Loss account
(C) Machine account (D) Capital account

41. Loss caused by theft of cast by cashier during business hours is a loss of
(A) Revenue nature (B) Capital nature
(C) Deferred revenue nature (D) Not recorded in books

42. Goodwill is recorded in the books when
(A) Super profit is earned by the enterprise
(B) Money or money's worth is paid for acquiring goodwill
(C) Management of the enterprise decides to record goodwill
(D) An enterprise is rewarded by any agency
(4)

Page 194

43. Which of the following assets is usually assumed not to depreciate?
(A) Plant (B) Land (C) Building (D) Furniture

44. Vivek started business with a capital of Rs. 20,000 and purchased goods worth Rs
2,000 on credit. These transactions may be expressed in the form of an accounting
equation such as
(A) Rs. 22,000=Rs. 20,000+2,000 (B) Rs. 20,000=Rs. 22,000-2,000
(C) Rs. 22,000=Rs. 22,000+0 (D) Rs. 22,000=0+ Rs. 22,000

45. LIFO inventory method was used in year I, FIFO in year II and weighted average in
Year III. Which accounting principle is violated?
(A) Cost Principle (B) Consistency (C) Materiality (D) Going Concern

46. Which of the following books should be used to record an adjusting entry for
depreciation?
(A) Cash book (B) Sales book (C) Purchase book (D) Journal

47. Stock in trade does NOT include
(A) Goods in the process of manufacture (B) Raw materials
(C) Items held as fixed assets (D) Finished goods

48. A, B and C are partners in a firm. If D is to be admitted as a new partner
(A) Old partnership has to be dissolved
(B) Old firm has to be dissolved
(C) Both old firm and partnership have to be dissolved
(D) Neither firm nor partnership need to be dissolved

49. P and Q are sharing profits in the ratio of 4:3. R joins and new ratio among P, Q and R
will be 7:4:3. The sacrificing ratio between P and Q shall be
(A) Equal (B) 4:3 (C) 2:2 (D) 1:2

50. Which if the following is NOT an essential characteristics of a company
(A) Company is an artificial person created by Law
(B) Company has a separate legal entity
(C) Company has not a perpetual succession
(D) Company has a common seal

51. The profit on the reissue of forfeited shares is transferred to
(A) Capital Account (B) Capital Reserve account
(C) Profit and Loss Account (D) General Reserve Account

52. Secret reserves are created by means of
(A) Transfer to general reserve (B) Overvaluation of inventories
(C) Providing excessive depreciation (D) Undervaluation of liabilities

Page 195

53. Which is a Current Asset?
(A) Stock (B) Creditors
(C) Proposed Dividend (D) Tax

54. Gross block is a
(A) Capital (B) Fixed Assets (C) Loss (D) Profit

55. Which of the following is NOT an essential element of optimum or ideal capital
structure?
(A) Minimum Risk (B) Minimum Control
(C) Simplicity (D) Flexibility

56. Depreciation and written off intangible assets are included in
(A) Non-cash expenses (B) Operating expenses
(C) Capital expenses (D) Revenue expenses

57. Shelf stock refers to
(A) Perishable goods
(B) Items that are to be packaged and sold
(C) Items that are stored by the firm and sold with little or no modifications
(D) Stock which is to be stored for more than one year

58. " A" group items in the ABC system are
(A) Large number of items with large rupee investment
(B) Very high quality items
(C) Large number of items with small rupee investment
(D) Small number of items with large rupee investment

59. If operating expenses is 75%, then operating profit will be
(A) 25% (B) 100% (C) 50% (D) 175%

60. Turnover ratios are also known as
(A) Profitability ratios (B) Solvency ratios
(C) Financial ratios (D) Efficiency ratios

61. If SYSTEM is coded as SYSMET and NEARER as AENRER, then FRACTION will
be coded as
(A) CARFNOIT (B) NOITFRAC (C) FRACNOIT (D) CARFTION

62. If TEACHER is coded as LMKJNMP, then how will HEART be coded?
(A) NMAPL (B) NMPKL (C) NPKML (D) NMKPL

63. A girl introduced a boy as the son of the daughter of the father of her uncle. The boy is
girl's
(A) Brother (B) Son (C) Uncle (D) Nephew

Page 196

Directions (Questions 64 to 67): Four young men Raj, Prem, Ved and Ashok are friendly
with four girls Sushma, Kusum, Vimala and Poonam. Sushma and Vimla are friends. Ved's
girlfriend does not like Sushma and Vimla. Kusum does not care for Ved. Prem's girlfriend
is friendly with Sushma. Sushma does not like Raj.

64. Who is Raj's girlfriend?
(A) Sushma (B) Kusum (C) Vimla (D) Poonam

65. With whom is Sushma friendly?
(A) Raj (B) Prem (C) Ved (D) Ashok

66. Who is Poonam's boyfriend?
(A) Ashok (B) Ved (C) Prem (D) Raj

67. Who does not like Sushma and Vimla?
(A) Poonam (B) Raj (C) Ashok (D) Ved

Directions (Questions 68 to 70): Seven children a, b, c, d, e, f and g are standing in a line.
g is to the right of d and to the left of b. a is on the right of c. a and d have one child between
them. e and b have two children between them. d and f have two children between them.

68. Who is on the extreme right?
(A) f (B) b (C) e (D) g

69. Who is exactly in the middle?
(A) a (B) c (C) e (D) d

70. Who is on the extreme left?
(A) a (B) b (C) c (D) d

71. A is 40 m South-west of B. C is 40 m South-east of B. Then C is in which direction of
A?
(A) East (B) West (C) North-east (D) South

72. In the following series, which letter is second to the left of the letter immediately to the
left of the letter which is fourth to the right of the letter immediately to the left of the
letter which is second to the left of the letter D?
ABCDEFGH
(A) A (B) B (C) C (D) D
73. Statements: Some dogs are rats. All rats are trees. Some trees are not dogs.
Conclusions: I. Some trees are dogs.
II. All dogs are trees.
III. All rats are dogs.
IV. No tree is a dog.

(A) Only I follows (B) Only I and II follow

Page 197

(C) Only II and III follow (D) All follow

74. Five children take part in a tournament. Each one has to play every other one. How
many games must they play?
(A) 8 (B) 10 (C) 24 (D) 30

75. Reena is twice as old as Sunita. Three years ago, she was three times as old as Sunita.
How old is Reena now?
(A) 6 years (B) 7 years (C) 8 years (D) 12 years

x-x-x

(8)
Space for Rough Work

Page 198

(MCA)

1. In the series 7, 10, 8, 11, 9, 12, ... What number should come next?
(A) 10 (B) 11 (C) 12 (D) 13

2. Following are some words translated from an artificial language.
gordoflur means fan belt
pixngordo means ceiling fan
arthtusl means tile roof

Which word could mean "ceiling tile"?
(A) flurgordo (B) gordotusl (C) pixnarth (D) arthflur

3. Find the statement that must be true according to the given information:
Pooja is twelve years old. For three years, she has been asking her parents for a dog.
Her parents have told her that they believe a dog would not be happy in an apartment,
but they have given her permission to have a bird. Pooja has not yet decided what kind
of bird she would like to have.
(A) Pooja’s parents like birds better than they like dogs.
(B) Pooja and her parents live in an apartment.
(C) Pooja does not like birds.
(D) Pooja and her parents would like to move.

4. I am facing East. Turning to the right I go 20 m, then turning to the left I go 20 m
and turning to the right I go 20 m, then again turning to the right I go 40 m and
then again I go 40 m to the right. In which direction am I from my original
position?
(A) North (B) East (C) South (D) West

5. If ‘X $ Y’ means ‘X is father of Y’; ‘X # Y’ means ‘X is mother of Y’; ‘X × Y’
means ‘X is sister of Y’, then how is D related to N in N # A $ B × D ?
(A) Nephew (B) Grandson
(C) Grandaughter (D) Cannot be determined

6. It was Sunday on Jan 1, 2006. What was the day of the week Jan 1, 2010?
(A) Monday (B) Wednesday (C) Friday (D) Sunday

7. In how many ways can the letters of the word 'LEADER' be arranged?
(A) 72 (B) 720 (C) 180 (D) 360

8. A room is 15 m long and 12 m broad. If the sum of the areas of the floor and the ceiling
is equal to the sum of the areas of four walls, the volume of the room is:
(A) 1200 (B) 600 (C) 900 (D) 1800

9. How many times are the hands of a clock at right angle in a day?
(A) 24 (B) 44 (C) 22 (D) 42

10. The price of 10 bottles is equal to that of 4 glasses. The price of 15 bottles and 2 glasses
together is Rs. 4000. The total price of 12 bottles and 3 glasses is:
(A) 3500 (B) 3900 (C) 4200 (D) 4500

Page 199

11. What is the synonym of ‘Thrift’?
(A) Wickedness (B) Economy (C) Elegant (D) Misery

12. The given sentence has been split into four segments. Identify the segment that has
grammatical error.
Had you / not reached in time, / we will have / lost our lives.
(A) had you (B) not reached in time
(C) we will have (D) lost our lives

13. What is the antonym of ‘Imperil’?
(A) Safeguard (B) Hazard (C) Endanger (D) Jeopardise

14. Choose the correct meaning of the idiom used in the given sentence.
The sight of the accident made me flash creep.
(A) frightened me (B) worried me
(C) confused me (D) drew my attention

15. Choose the correct sentence
(A) My sister had left for America last week
(B) My sister has been left for America last week
(C) My sister left for America last week
(D) My sister has left America last week

16. Select the most suitable alternative to make the sentence meaningful.
Even a _____________ glance will reveal the mystery.
(A) crude (B) cursory (C) critical (D) curious

17. Select the pair which has same relationship as Pain : sedative.
(A) Comfort : Stimulant (B) Trance : Narcotic
(C) Grief : Consolation (D) Ache : Extraction

18. The cloth merchant has purchased two ____________ of cloth.
(A) bails (B) bales (C) bials (D) bailes

19. A person who is indifferent of pleasure or pain is __________.
(A) Parasite (B) Usurer (C) Stoic (D) Pessimist

20. Which of the following modifies or describes noun in a sentence?
(A) Adverb (B) Conjunction (C) Preposition (D) Adjective

21. Let f(x) = , then f(f(x)) is
(A) (B) − (C) (D)
22. The binary operation * defined on N by a * b = a + b + ab for all a, b  N is
(A) Commutative only (B) Associative only
(C) Both commutative and associative (D) Neither commutative nor associative

(2)

Page 200

23. If f is an invertible function defined as f(x) = , then f-1(x) is
(A) 5x + 3 (B) 5x + 4 (C) (D)

24. The function f(x) = log 𝑥 + √𝑥 + 1 is
(A) Even function (B) Odd function
(C) Both even and odd (D) Neither even nor odd

25. What type of relation is ‘less than’ in the set of real numbers?
(A) Only symmetric (B) Only transitive (C) Only reflexive (D) Equivalence

26. The maximum value of z = 3x + 4y subjected to constraints x + y ≤ 4, x ≥ 0 and y ≥ 0
is:
(A) 12 (B) 14 (C) 16 (D) 21

27. The point which does not lie in the half plane 4x + 3y – 12 < 0 is
(A) (2, 1) (B) (1, 2) (C) (-2, 3) (D) (2, 3)

28. In Linear Programming Problem (LPP), the linear inequalities or restrictions on the
variables are called
(A) Inequalities (B) Linear constraints
(C) Constraints (D) Limits

29. The optimal value of the objective function is attained at the points
(A) given by intersection of inequation with y-axis only
(B) given by intersection of inequation with x-axis only
(C) given by corner points of the feasible region
(D) given by non-corner points of the feasible region

30. Objective function of a linear programming problem is
(A) a constraint
(B) function to be optimized
(C) a relation between the variables
(D) a relation between the constraints

31. If P(A  B) is 70% and P(B) = 85%, then P(A|B) is equal to
(A) 14/17 (B) 17/20 (C) 14/20 (D) 17/25

32. Three balls are drawn from a bag containing 2 blue and 5 black balls. If the random
variable x represents the number of blue balls drawn, then x can take values
(A) 0, 1, 2 (B) 0 (C) 0, 1 (D) 0, 1, 2, 3

33. Two dice are thrown. If it is known that the sum of numbers on the dice was less than
6, the probability of getting a sum 3 is
(A) 1/18 (B) 1/9 (C) 1/5 (D) 2/5
(3)

Page 201

34. If two events are independent, then
(A) They must be mutually exclusive
(B) Sum of their probabilities must be equal to 1
(C) Both A and B are correct
(D) Occurrence of one event does not affect the chances of the occurrence of the other
event

35. If A and B are two event such that P(A) ≠ 0 and P(B|A) = 1, then
(A) A  B (B) B  A (C) B =  (D) A = 

1 2 𝑥
36. Find x, if 1 1 1 is singular.
2 1 −1
(A) 1 (B) 2 (C) 3 (D) 4

2 −3
37. If A = , find A-1
3 4

2 3 4 3
(A) (B)
−3 4 −3 2
4 3 4 −3
(C) − (D)
−3 2 3 −2

38. If for non-singular matrix A, A2 = I, find A-1
(A) A (B) I (C) 0 (D) Either A or B

39. If A is a square matrix of order 2 X 2, then |KA| is equal to ________.
(A) K|A| (B) K2|A| (C) K3|A| (D) 2K|A|

2𝑥 + 5 3
40. If = 0, then x is ________.
5𝑥 + 2 9
(A) 13 (B) -13 (C) 12 (D) -12

41. The function f(x) = e|x| is _________.
(A) Continuous and differentiable everywhere
(B) Not continuous at x = 0
(C) Continuous everywhere but not differentiable at x = 0
(D) Differentiable at x = 0

42. If volume of a sphere is increasing at a constant rate, the rate at which its radius is
increasing is _________.
(A) constant
(B) proportional to the radius
(C) inversely proportional to the radius
(D) inversely proportional to the surface area

(4)

Page 202

43. If (𝑓(𝑥)) is g(x), then antiderivative of g(x) is _________.
(A) f(x) (B) f’(x) (C) g’(x) (D) g(x)

44. The area of the region bounded by the circle x2 + y2 = 1 is __________.
(A) 2 sq. units (B)  sq. units (C) 3 sq. units (D) 4 sq. units

45. The radius of a circle is increasing at the rate of 0.4 cm/s. The rate of increasing of its
circumference is:
(A) 0.4  cm/s (B) 0.8 cm/s (C) 0.8  cm/s (D) 0.4 cm/s

46. If R is a relation on set N of natural numbers as R is defined by m R n if m divides n,
then R is ___________.
(A) Reflexive (B) Symmetric (C) Transitive (D) Both A and B

47. Which of the following is correct about determinant?
(A) It is a square matrix
(B) It is a number associated with square matrix
(C) It is a number associated with column matrix
(D) It is a number associated with any type of matrix

48. A dice is thrown and a card is selected at random from a deck of 52 playing cards. The
probability of getting an odd number on the dice and a club card is _________.
(A) ½ (B) ¼ (C) 1/8 (D) 1/12

49. The product of two number are 12 and their LCM is 6. What is the HCF of these
numbers?
(A) 72 (B) 2 (C) 6 (D) 12

50. The (n – 1)th term of an A.P. is given by 7,12,17, 22,… is
(A) 5n + 2 (B) 5n + 3 (C) 5n - 2 (D) 5n – 3

51. In a square of side 10 cm, its diagonal is __________.
(A) 10 cm (B) 12 cm (C) 10 2 cm (D) 12 2 cm

52. The distance between the point P(1, 4) and Q(4, 0) is ________.
(A) 4 (B) 5 (C) 6 (D) 10

53. The algebraic sum of the deviations of a frequency distribution from its mean is always
__________.
(A) Greater than zero (B) Less than zero
(C) Zero (D) Non – zero

54. The mode and mean are given as 7 and 8, respectively. Then the median is________.
(A) 1/13 (B) 1/23 (C) 3/23 (D) 23/3
(5)

Page 203

55. The angle of depression of a truck, standing on the ground, from the top of a 75 m high
tower, is 30°. The distance of the truck from the base of the tower is________.
(A) 25 3 m (B) 75 3 m (C) 50 3 m (D) 100 3 m

56. Two cubes each with 6 cm edge are joined end to end. The surface area of the resulting
cuboid is ____ .
(A) 36 cm2 (B) 360 cm2 (C) 720 cm2 (D) 520 cm2

57. 100 pages are numbered from 1 to 100. What is the probability of getting a prime
number?
(A) ¾ (B) ½ (C) ¼ (D) 2/3

58. In a competitive examination, one mark is awarded for each correct answer while 0.5
mark is deducted for every wrong answer. Meena answered 120 questions and got 90
marks. How many questions did she answer correctly?
(A) 95 (B) 98 (C) 100 (D) 102

59. What is XLII in Arabic Numerals?
(A) 42 (B) 62 (C) 72 (D) 92

60. Find the equation of plane passing through the points P(1, 1, 1), Q(3, -1, 2), R(-3, 5, -
4).
(A) x + 2y = 0 (B) x – y = 2 (C) –x + y = 2 (D) x + y = 2

61. Which Protocol is used for browsing data?
(A) FTP (B) HTTP (C) TCP (D) SMTP

62. Which language offers the ability to query data, insert and delete tuples?
(A) Data Definition Language (DDL)
(B) Data Manipulation Language (DML)
(C) Data Control Language (DCL)
(D) Transaction Control Language (TCL)

63. What is the purpose of the following statement in C language?
int *p[10];
(A) p is an array of 10 pointers to integers.
(B) p is a pointer to an array of 10 integers.
(C) p is a pointer to an array of 10 pointers to integers.
(D) p is an array of 10 integers.

64. Which of the following allows several objects in a class hierarchy to have different
methods with same name
(A) Inheritance (B) Aggregation (C) Encapsulation (D) Polymorphism

65. What is the location of a parent node for any arbitrary node i in a heap?
(A) i/2 (B) i+1 (C) floor(i/2) (D) ceil(i/2)
(6)

Page 204

66. ROM stores _________
(A) Operating System (B) Kernel
(C) Bootstrap Loader (D) Compiler

67. In a timesharing Operating System, when the time slot assigned to a process is
completed, the process switches to which state?
(A) Ready state (B) Suspended state
(C) Terminated state (D) Blocked state

68. Regression testing is related to _________.
(A) Functional Testing (B) Structural Testing
(C) Data Flow Testing (D) Maintenance Testing

69. An if-else statement can be replaced with _________ operator.
(A) Logical (B) Conditional (C) Relational (D) Arithmetic

70. Full form of FAT is _________.
(A) File Attribute Table (B) File Allocation Table
(C) First Allocation Table (D) Fit Allocation Table

71. _________ command is used to display the documentation of commands in Unix.
(A) man (B) help (C) search (D) what

72. In Boolean Algebra, (B.B’) + B = ?
(A) B’ (B) B (C) 0 (D) 1

73. Numerical techniques are commonly _________ in nature.
(A) Direct (B) Iterative (C) Reductive (D) Eliminative

74. _________ is a universal gate.
(A) XOR (B) AND (C) NAND (D) OR

75. In Big Data, velocity refers to _________.
(A) Data arriving at fast speed (B) Noise in data
(C) Large amount of data (D) Diverse data

x-x-x

(7)

Page 205

M.Com.(Business Innovation)
1. Armyman Avinash Sable from Beed, Maharashtra, recently surpassed the 30 year old
national record in _________________ meter race at an international event:
(A) 1000 (B) 4000 (C) 5000 (D) 10000

2. Which is the final authority for deciding the design, form and content of the currency
notes?
(A) Central Government (B) Reserve Bank of India
(C) Indian Banks Association (D) Note issuing Authority of India

3. Which city has been selected as the World Book Capital for 2022?
(A) Cairo (B) Jeddah (C) Glasgow (D) Guadalajara

4. Joe Root who has been named as the “Leading Man Cricketer in the World” plays for
which Country?
(A) South Africa (B) England (C) Australia (D) New Zealand

5. Which amendment to the Constitution proposed to add a new Part relating to
Panchayats in the Constitution?
(A) 65th (B) 77th (C) 73rd (D) 84th

6. Which of the following are the instruments of Credit Control in the hands of RBI?
I. Lowering or raising the policy interest rates
II. Raising the minimum support price of the major agro products
III. Lowering or raising the minimum cash reserves maintained by Commercial banks
IV. Directing banks to curb their lending
Select the correct option:
(A) Only I (B) Only II (C) Only III (D) Both I and III

7. Which city hosted the Khelo India University Games?
(A) Bengaluru (B) Bhubaneshwar
(C) Bhopal (D) Vishakhapatnam

8. Which Bollywood celebrity has been selected as a jury member for the Cannes Film
Festival?
(A) Amitabh Bachchan (B) Deepika Padukone
(C) Anushka Sharma (D) Shahrukh Khan

9. Which European country has become the first country in the world to suspend the
COVID-19 vaccination programme?
(A) Italy (B) Greece (C) Switzerland (D) Denmark

10. The arrangement wherein scheduled banks in India are required to maintain a certain
portion of their demand and time liabilities with the Reserve Bank of India is
called_______
(A) Statutory Liquidity Ratio (B) Cash reserve ratio
(C) Bank reserve deposit (D) Mandatory deposits

11. Which city is known as the capital of the European Union?
(A) The Hague (B) Brussels (C) Stockholm (D) Geneva

Page 206

12. The Reserve Bank of India hiked the repo rate on May 4 by 40 basis points, taking it to
4.40 percent with immediate effect. What was the main objective of this hike?
(A) To boost economic growth
(B) To allow banks to do more lending
(C) To rein in the increasing inflation
(D) To enable banks to lower the lending rates

13. Who is the India’s present Union minister of Environment, Forests and Climate
Change?
(A) Bhupendera Yadav (B) Parakash Javadekar
(C) Piyush Goel (D) Arjun Munda

14. Basel-II Norms are associated with which if the following aspects of banking industry?
(A) Risk Management (B) Business Planning
(C) Market Exposure (D) Money market operations

15. Who was the first Chief Justice of the Supreme Court of India?
(A) Sir Maurice Gwyer (B) Sir Srinivas Varadachariar
(C) Sir H J Kania (D) Mehar Chand Mahajan

16. Which of the following is not a subsidiary book?
(A) Purchase Book (B) Sales Book
(C) Bills Receivables book (D) Assets Book

17. The firm under perfect competition will be in short-run equilibrium when
(A) Rising marginal cost is equal to the minimum average cost
(B) Marginal revenue is equal to rising marginal cost
(C) Average revenue is equal to average cost
(D) Marginal revenue is equal to the falling marginal cost

18. In which type of organization is 'grapevine' communication used?
(A) Informal organization (B) Formal Organization
(C) Departmental organization (D) Matrix organization

19. Market gridding means
(A) establishing and running a web marketing facility
(B) a method of survey of expert's opinion
(C) managing brands and developing brand equity
(D) an analytical technique which facilitates dividing a market into segments

20. "360" degree method relates to
(A) Performance appraisal (B) Organization climate
(C) Employee's morale (D) Retrenchment

21. In which of the following countries the Industrial Revolution took place first?
(A) France (B) Germany (C) England (D) U.S.A

22. Which of the following concepts is considered as a myth?
(A) Oligopoly (B) Perfect Competition
(C) Monopoly (D) Imperfect Competition

Page 207

23. When a population is heterogeneous, it is divided into groups, so that there is
homogeneity within the group and heterogeneity between the groups and some items
are selected at random from each group. It is a case of
(A) Cluster Random sampling (B) Systematic Random sampling
(C) Quota sampling (D) Stratified Random sampling

24. The Concept of MBO originally came from
(A) F.W Taylor (B) A.H. Maslow (C) Henry Fayol (D) Peter F

Drucker

25. What is Hawala?
(A) Tax evasion (B) Illegal trading in stock exchanges
(C) Bank robbery (D) Illegal transactions of foreign exchange

26. The kinked demand curve model of Oligopoly was developed by
(A) Augustine Cournot (B) Stackelberg
(C) Edgeworth (D) Sweezy

27. Which of the following is not a case inflow?
(A) Decrease in creditors (B) Decrease in debtors
(C) Issue of shares (D) Sale of a fixed asset

28. Computers that recognize data as discrete signals are called?
(A) Analog computers (B) Digital computers
(C) Hybrid computers (D) Super computers

29. Which of the following is not a force in the "Porter Five Forces Model"?
(A) Buyers (B) Suppliers
(C) Complementary produce (D) Industry rivalry

30. When a business is purchased, any amount paid in excess of the total of assets, minus
the liabilities taken, is called
(A) Share Premium (B) Goodwill (C) Capital Employed (D) Working Capital

31. When RBI grants loan to commercial banks and charges interest on it, it is called
(A) Repo rate (B) Reverse Repo rate
(C) Sweep stack rate (D) Bank rate

32. When opening stock is Rs 50,000, closing stock is Rs 60,000 and the cost of goods sold
is Rs. 2,20,000, the stock turnover ratio is
(A) 2 times (B) 3 times (C) 4 times (D) 5 times

33. In what order, the following assets are shown in the balance sheet of a company?
i. Trade receivables
ii. Cash
iii. Furniture and Fittings
iv. Investment in shares and debentures
(A) ii, i, iv, iii (B) i, ii, iii, iv (C) iii, iv, i, ii (D) iv, iii, ii, i

Page 208

34. The Human Development Index (HDI) is introduced by
(A) UNDP (B) UNICEF (C) IMF (D) World Bank
35. Which of the following is not a component of Job Analysis?
(A) Job Description (B) Role Analysis (C) Job Summary (D) Job

Specification

36. In Engineering Entrance test, a student scores 4 marks for every correct answer and
loses 0.5 marks for every wrong answer. A student attempts all the 100 questions and
scores 310 marks. How many numbers of questions the student answered correctly?
(A) 80 (B) 100 (C) 90 (D) 110

37. The HCF and LCM of two numbers are 12 and 144 respectively. If one of the number
is 36, find the other number.
(A) 48 (B) 58 (C) 50 (D) 60

38. The following table shows the number of students having obtained different marks.
Number of Students Marks

10 50

6 55

5 60

21 70

2 75

5 85

3 90

2 100

Find the average marks obtained by students.
(A) 66.5 (B) 67.5 (C) 68.5 (D) 69.5

39. A child went 90m in the East to look for his father, then he turned right and went 40 m.
After this he turned right and after going 10m he reached to his uncle’s house. His father
was not there. From there he went 100 m to north and met his father. What was the
direct distance between his father’s point and the starting point?
(A) 75 (B) 100 (C) 125 (D) 150

40. A train covers a distance of 12 km in 10 minutes. If it takes 6 seconds to pass a telegraph
post, then the length of the train is
(A) 100 meters (B) 110 meters (C) 120 meters (D) 130 meters

41. Find the number of divisors of 1080 excluding the divisors which are perfect squares.
(A) 28 (B) 29 (C) 30 (D) 31

Page 209

42. A pipe can fill a tank in 6 hours. Another pipe can empty the same tank in 12 hours. If
both pipes are opened simultaneously, what part of the tank will be filled in 1 hour?
(A) 1/9th part (B) 1/6th part (C) 1/12th part (D) 1/3rd part

43. Which is the number that comes next in the sequence?
3, 6, 18, 72, __________
(A) 144 (B) 216 (C) 288 (D) 360

44. In a family the father took 1/4 of the cake and he had 3 times as much as each of the
other members had. The total number of family members is
(A) 3 (B) 7 (C) 10 (D) 12

45. If 100 cats kill 100 mice in 100 days, then 4 cats would kill 4 mice in how many days?
(A) 1 day (B) 4 days (C) 40 days (D) 100 days

46. Five bells begin to toll together and toll respectively at intervals of 6,5,7,10 and 12
seconds. How many times will they toll together in one hour excluding the one at the
start?
(A) 7 times (B) 8 times (C) 9 times (D) 11 times

47. A total of 324 coins of 20 paise and 25 paise make a sum of Rs. 71. The number of 25
paise coins is
(A) 120 (B) 124 (C) 144 (D) 200

48. In a city 40% of the adults are illiterate while 85% of the children are literate. If the
ratio of the adults to that of the children is 2:3, then what percent of the population is
literate?
(A) 20% (B) 25% (C) 50% (D) 75%

49. A number consists of two digits whose sum is 11. If 27 is added to the number, then the
digits change their places. What is the number?
(A) 47 (B) 65 (C) 83 (D) 92

50. In a garden, there are 10 rows and 12 columns of mango trees. The distance between
the two trees is 2 meters and a distance of one meter is left from all sides of the boundary
of the garden. The length of the garden is
(A) 20 m (B) 22 m (C) 24 m (D) 26 m

51. A pineapple costs Rs. 7 each. A watermelon costs Rs. 5 each. X spends Rs. 38 on these
fruits. The number of pineapples purchased is
(A) 2 (B) 3 (C) 4 (D) 5

52. Five children take part in a tournament. Each one has to play every other one. How
many games must they play?
(A) 8 (B) 10 (C) 24 (D) 30

53. If you write down all the numbers from 1 to 100, then how many times do you write 3?
(A) 11 (B) 18 (C) 20 (D) 21

Page 210

54. A bird shooter was asked how many birds he had in the bag. He replied that there were
all sparrows but six, all pigeons but six and all ducks but six. How many birds he had
in his bag in all?
(A) 9 (B) 18 (C) 27 (D) 36

55. At the end of a business conference the ten people present all shake hands with each
other once. How many handshakes will be there be altogether?
(A) 20 (B) 45 (C) 55 (D) 90

56. If 'pen' is 'table', 'table' is 'fan', 'fan' is 'chair' and 'chair' is 'roof', on which of the
following will a person sit?
(A) Fan (B) Chair (C) Roof (D) Table

57. In a certain coding system, rbm std bro pus' means 'the cat is beautiful', 'tnh pus dim
std' means 'the dog is brown', 'pus dim bro pus cus' means 'the dog has the cat'. What
is the code of 'has'?
(A) std (B) dim (C) bro (D) cus

58. If X is the brother of the son of Y's son, how is X related to Y?
(A) Son (B) Brother (C) Cousin (D) Grandson

59. Pointing to a man in a photograph, Asha said, " his mother's only daughter is my
mother". How is Asha related to that man?
(A) Nephew (B) Sister (C) Wife (D) Niece

Directions (Questions 60 to 64):All the six members of a family A, B, C, D, E and F
are travelling together. B is the son of C but C is not the mother of B. A and C are a
married couple. E is the brother of C. D is the daughter of A. F is the brother of B.
60. How many male members are there in a family?
(A) 1 (B) 2 (C) 3 (D) 4

61. Who is the mother of B?
(A) D (B) F (C) E (D) A

62. How many children does A have?
(A) One (B) Two (C) Three (D) Four

63. Which if the following is a pair of females?
(A) AE (B) BD (C) DF (D) AD

64. How is E related to D?
(A) Father (B) Brother (C) Uncle (D) Mother

Directions (Questions 65 to 67): Six students A, B, C, D, E and F are sitting in the field.
A and B are from Nehru House while the rest belong to Gandhi House. D and F are tall
while the others are short. A, C and D are wearing glasses while the others are not.

65. Which two students who are not wearing glasses are short?
(A) A & F (B) C & E (C) B & E (D) E & F

Page 211

66. Which short student of Gandhi house is not wearing glasses?
(A) F (B) E (C) B (D) A

67. Which tall student of Gandhi house is not wearing glasses?
(A) B (B) C (C) E (D) F

68. I am facing South. I turn right and walk 20 m. Then I turn right again and walk 10 m.
Then I turn left and walk 10 m and then turning right walk 20 m. Then I turn right again
and walk 60 m. In which direction am I from the starting point?
(A) North (B) North-west (C) East (D) North-east

69. If the letters in the word POWERFUL are rearranged as they appear in English
alphabet, the position of how many letters will remain unchanged after the
rearrangement?
(A) One (B) Two (C) Three (D) More than

three

Directions Questions 70 to 72: Study the following arrangement of the English
alphabet and answer the questions given below:
FJMPOWRNBEYCKAVLDGXUHQISZT
70. Which letter is the tenth to the right of the letter which is exactly the middle letter
between F and D?
(A) D (B) G (C) H (D) X

71. FMJ: TSZ in the same way as JMP: ?
(A) IZS (B) ZSI (C) ZIS (D) ISZ

72. If each letter is attached a value equal to its serial number in the above arrangement
starting from your left, then what will be the sum of the numbers attached to all the
vowels in the arrangement?
(A) 50 (B) 58 (C) 63 (D) 72

73. In the following question, three statements are given followed by four conclusions
numbered I, II, III and IV. You have to decide which of the given conclusions logically
follows from the given statements disregarding commonly known facts.
Statements: Some trains are roads. No road is jungle. All flowers are jungles.
Conclusions: I. Some trains are flowers
II. Some trains are jungles
III. Some flowers are trains
IV. No road is flower

(A) Only II follows (B) Only III follows (C) Only IV follows (D) All follow

74. If P denotes 'multiplied by', T denotes 'subtracted from', M denotes 'added to' and B
denotes 'divided by', then
28 B 7 P 8 T 6 M 4 = ?
(A) -3/2 (B) 30 (C) 32 (D) 34

Page 212

75. If the 25th of August in a year is Thursday, the number of Mondays in that month is
____
(A) 3 (B) 4 (C) 5 (D) 6

x-x-x

(7)
Space for Rough Work

Page 213

M.E.Mechanical Engg. (Manufacturing Technology)/M.E. in Mechanical Engineering (Robotics)
1. The velocity field of an incompressible flow in a Cartesian system is represented by
V  2  x 2  y2  î  vˆj  3k̂ . Which one of the following expressions for ‘v’ is valid?
(A) –4xy –4xz (B) –4xz + 6xy (C) 4xz –6xy (D) 4xy + 4xz

2. A helical gear with 20° pressure angle and 30° helix angle mounted at the mid
span of a shaft that is supported between two bearings at the ends. The nature of
the stresses induced in the shaft is
(A) normal stress due to bending in two planes; shear stress due to torsion
(B) normal stress due to bending in two planes and axial loading; shear stress due
to torsion
(C) normal stress due to bending only
(D) normal stress due to bending in one plane and axial loading; shear stress due to
torsion
3. A flywheel is attached to an engine to keep its rotational speed between 100 rad/s
and 110 rad/s. If the energy fluctuation in the flywheel between these two speeds is
1.05kJ then the moment of inertia of the flywheel is_______ kg.m2. (round off to 2
decimal places).
(A) 1 (B) 2 (C) -1 (D) -2
4. The base of a brass bracket needs rough grinding. For this purpose, the most suitable
grinding wheel gradespecification is
(A) A50G8V (B) A30D12V (C) C30Q12V (D) C90J4B
5. For an ideal gas, the value of the Joule-Thomson coefficient is
(A) Zero (B) Negative (C) Positive (D) Indetermine

6. The crystal structure of  iron (austenite phase) is
(A) BCC (B) BCT (C) FCC (D) HCP

7. Froude number is the ratio of
(A) inertia forces to gravity forces (B) buoyancy forces to inertia forces
(C) buoyancy forces to viscous forces (D) inertia forces to viscous force

8. For an assembly line, the production rate was 4 pieces per hour and the average
processing time was 60 minutes. The work in progress (WIP) inventory was
calculated. Now, the production rate is kept the same, and the average processing
time is brought down by 30 percent. As a result of this change in the processing time,
the WIP inventory.
(A) decreases by 25% (B) increases by 30%
(C) increases by 25% (D) decreases by 30%

9. A strip of thickness 40 mm is to be rolled to a thickness of 20 mm using a two-high
mill having rolls of diameter 200 mm. Coefficient of friction and arc length in mm,
respectively are
(A) 0.39 and 44.72 (B) 0.45 and 38.84
(C) 0.45 and 44.72 (D) 0.39 and 38.84
10. A small metal bead (radius 0.5 mm), initially at 100°C, when placed in a stream of

Page 214

fluid at 20°C, attains a temperature of 28°C in 4.35 seconds. The density and specific
heat of the metal are 8500 kg/m3 and 400 J/kg.K, respectively. If the bead is
considered as lumped system, the convective heat transfer coefficient (in W/m 2.K)
between the metal bead and the fluid stream is
(A) 283.3 (B) 449.7 (C) 149.9 (D) 299.8

11. Two plates, each of 6 mm thickness, are to be butt-welded. Consider the following
processes and select the correct sequence in increasing order of size of the heat
affected zone.
1. Arc welding
2. MIG welding
3. Laser beam welding
4. Submerged arc welding
(A) 3-4-2-1 (B) 4-3-2-1 (C) 3-2-4-1 (D) 1-4-2-3

12. In the space above the mercury column in a barometer tube, the gauge pressure of
the vapor is
(A) positive, but more than one atmosphere
(B) Zero
(C) positive, but less than one atmosphere
(D) Negative

13. Which one of the following statements about a phase diagram is INCORRECT?
(A) Solid solubility limits are depicted by it
(B) It indicates the temperature at which different phases start to melt
(C) It gives information on transformation rates
(D) Relative amount of different phases can be found under given equilibrium
conditions
14. In Materials Requirement Planning, if the inventory holding cost is very high and
the setup cost is zero,which one of the following lot sizing approaches should be
used?
(A) Base Stock Level (B) Lot-for-Lot
(C) Economic Order Quantity (D) Fixed Period Quantity, for 2 periods

15. A bolt head has to be made at the end of a rod of diameter d = 12 mm by localized
forging (upsetting) operation. The length of the unsupported portion of the rod is 40
mm. To avoid buckling of the rod, a closed forging operation has to be performed
with a maximum die diameter of__________ mm.
(A) 18 (B) 22 (C) 23 (D) 19

16. The number of qualitatively distinct kinematic inversions possible for a Grash of
chain with four revolute pairs is
(A) 3 (B) 2 (C) 1 (D) 4

17. Which of the following conditions is used to determine the stable equilibrium of
all partially submerged floating bodies?
(A) Metacentre must be at a lower level than the centre of gravity
(B) Centre of buoyancy must be below the centre of gravity

Page 215

(C) Centre of buoyancy must be above the centre of gravity
(D) Metacentre must be at a higher level than the centre of gravity

18. The process, that uses a tapered horn to amplify and focus the mechanical energy for
machining of glass, is
(A) electrical discharge machining
(B) abrasive jet machining
(C) electrochemical machining
(D) ultrasonic machining
19. For an air-standard Diesel cycle,
(A) heat addition is at constant pressure and heat rejection is at constant volume
(B) heat addition is at constant volume and heat rejection is at constant pressure
(C) heat addition is at constant pressure and heat rejection is at constant pressure
(D) heat addition is at constant volume and heat rejection is at constant volume

20. The values of enthalpies at the stator inlet and rotor outlet of a hydraulic
turbomachine stage are h1 and h3 respectively. The enthalpy at the stator outlet (or,
rotor inlet) is h2. The condition (h2 – h1) = (h3 – h2) indicates that the degree of
reaction of this stage is
(A) 100% (B) zero (C) 75% (D) 50%
21. If a reversed Carnot cycle operates between the temperature limits of 27°C and –
3°C, then the ratio of the COP of a refrigerator to that of a heat pump (COP of
refrigerator/COP of heat pump) based on the cycle is (round off to 2
decimal places).
(A) 0.9 (B) zero (C) 1.0 (D) 0.5
22. In a CAD package, mirror image of a 2D point P (5, 10) is to be obtained about a line
which passes through the origin and makes an angle of 450 counter-clockwise with the
X-axis. The coordinates of the transformed point will be
(A) (7.5, 5) (B) (10, 5) (C) (7.5, -5) (D) (10, -5)

23. The device used to cool the refrigerant in a vapor absorption chiller is a
(A) Vacuum pump (B) Vacuum condenser
(C) Condenser (D) None of the above

24. Higher COP can be achieved with
(A) Lower evaporator temperature and higher condenser temperature
(B) Higher evaporator temperature and higher condenser temperature
(C) Higher evaporator temperature and Lower condenser temperature
(D) Lower evaporator temperature and Lower condenser temperature

25. Co-efficient of friction for leather used for friction clutch is
(A) 0.27 (B) 3.7 (C) 0.4 to 0.5 (D) 0.35 to 0.4

26. If the compression ratio of an engine working on Otto cycle is increased from 5 to 7,
the %age increase in efficiency will be
(A) 2% (B) 4% (C) 8% (D) 14%

Page 216

27. In a typical medium speed 4-stroke cycle diesel engine the inlet valve
(A) opens at 20° before top dead center and closes at 35° after the bottom dead
center
(B) opens at top dead center and closes at bottom dead center
(C) opens at 10° after top dead center and closes 20° before the bottom dead center
(D) may open or close anywhere
28. The most commonly used material for tyre tubes is
(A) Butyl (B) Natural rubber (C) Butane (D) Nylon
29. Conformability of an engine bearing is
(A) Ability of a bearing to withstand the wear and tear
(B) Resistivity to corrosion
(C) Ability of the bearing to adjust itself to variations in shaft alignment and journal
shape
(D) Ability of a bearing to permit foreign particles to embed in it
30. A negative loop in the P.V diagram of an I.C engine is due to
(A) Pre ignition in the engine (B) Suction of air for engine
(C) Pre-opening of the exhaust valve (D) High pressure in the cylinder

31. In an axial flow steam turbine, the path traced by fluid particle at the design point is a
(A) Helix of constant radius (B) Helix of varying radius
(C) Cycloidal path (D) Toroidal path

32. Bleeding in turbine means
(A) Leakage of steam
(B) Steam doing no useful work
(C) Extracted steam for preheating feed water
(D) Exhausted steam in condenser
33. Given that T1 and T2 are the tension on the tight and slack of the belt respectively, the
initial tension of the belt taking centrifugal tension Tc, is equal to
(A) T1 + T2 + Tc/3 (B) T1 + T2 + 2Tc/2
(C) T1 + T2 - 3Tc/3 (D) T1 + T2 + 3Tc/3

34. In a cam drive, it is essential to off-set the axis of a follower to
(A) Decrease the side thrust between the follower and guide
(B) Decrease the side wear between the follower and Cam surface
(C) Take care of space limitation
(D) Reduce the cost
35. If a spring-mass dashpot system is subjected to excitation by a constant harmonic
force, then at resonance, its amplitude of vibration will be
(A) Infinity
(B) Inversely proportional to damping
(C) Directly proportional to damping
(D) Decreasing exponentially with time

Page 217

36. During torsional vibration of a shaft, the node is characterized by
(A) Maximum angular velocity (B) Maximum angular displacement
(C) Maximum angular acceleration (D) Zero angular displacement

37. Internal gears can be made by
(A) hobbing (B) gear shaping with rack cutter
(C) gear shaping with pinion cutter (D) gang milling

38. The crank radius of a single cylinder I. C. engine is 60mm and the diameter of the
cylinder is 80mm. The swept volume of the cylinder in cm 3 is
(A) 48 (B) 96 (C) 302 (D) 603

39. A cube shaped casting solidifies in 5 minutes. The solidification time in minutes for a
cube of the same material, which is 8 times heavier than the original casting will be
(A) 10 (B) 20 (C) 24 (D) 40

40. In a CAD package, mirror image of a 2D point P (5, 10) is to be obtained about a line
which passes through the origin and makes an angle of 450 counterclockwise with the
X-axis. The coordinates of the transformed point will be
(A) (7.5, 5) (B) (10, 5) (C) (7.5, -5) (D) (10, -5)
41. A bar is subjected to fluctuating tensile load from 20 kN to 100 kN. The material has
yield strength of 240 MPa and endurance limit in reversed bending is 160 MPa.
According to the Soderberg principle, the area of cross-section in mm2 of the bar for a
factor of safety of 2 is
(A) 400 (B) 600 (C) 750 (D)1000

42. For a gas turbine power plant, identify the correct pair of statements.
P. Smaller in size compared to steam power plant for same power output Starts quickly
compared to steam power plant
R. Works on the principle of Rankine cycle
S. Good compatibility with solid fuel
(A) P, Q (B) R, S (C) Q, R (D) P, S

43. The process utilizing mainly thermal energy for removing material is
(A) Ultrasonic Machining (B) Electrochemical Machining
(C) Abrasive Jet Machining (D) Laser Beam Machining

44. Cutting tool is much harder than the workpiece. Yet the tool wears out during the tool-
work interaction, because
(A) extra hardness is imparted to the workpiece due to coolant used

Page 218

(B) oxide layers on the workpiece surface impart extra hardness to it
(C) extra hardness is imparted to the workpiece due to severe rate of strain
(D) vibration is induced in the machine tool

45. The hot tearing in a metal casting is due to
(A) high fluidity
(B) high melt temperature
(C) wide range of solidification temperature
(D) low coefficient of thermal expansion

46. A streamline and an equipotential line in a flow field
(A) Are parallel to each other (B) Are perpendicular to each other
(C) Intersect at an acute angle (D) Are identical

47. If a mass of moist air in an airtight vessel is heated to a higher temperature, then
(A) Specific humidity of the air increases (B) Specific humidity of the air decreases
(C) Relative humidity of the air increases (D) Relative humidity of the air decreases

48. The operation in which oil is permeated into the pores of a powder metallurgy product
is known as
(A) Mixing (B) Sintering
(C) Impregnation (D) Infiltration

49. The maximum possible draft in cold rolling of sheet increases with the
(A) Increase in coefficient of friction (B) Decrease in coefficient of friction

(C) Decrease in roll radius (D) Increase in roll velocity

50. A column has a rectangular cross-section of 10mm x 20mm and a length of 1m. The
slenderness ratio of the column is close to
(A) 200 (B) 346 (C) 477 (D) 1000
51. Green sand mould indicates that
(A) Polymeric mould has been cured (B) Mould has been totally dried
(C) Mould is green in colour (D) Mould contains moisture

52. The cold forming process in which a hardened tool is pressed against a workpiece
(when there is relative motion between the tool and the workpiece) to produce a
roughened surface with a regular pattern is
(A) Chamfering (B) Roll forming (C) Knurling (D) Strip rolling

Page 219

53. The word Kanban is most appropriately associated with
(A) Economic order quantity (B) Just–in–time production
(C) Capacity planning (D) Product design

54. A thin cylinder of inner radius 500mm and thickness 10mm is subjected to an internal
pressure of 5MPa. The average circumferential (hoop) stress in MPa is
(A) 100 (B) 250 (C) 500 (D) 1000

55. The crystal structure of austenite is
(A) Body centered cubic (B) Face centered cubic
(C) Hexagonal closed packed (D) Body centered tetragonal

56. Which one of the following is NOT a decision taken during the aggregate production
planning stage?
(A) Scheduling of machines
(B) Amount of labour to be committed
(C) Rate at which production should happen
(D) Inventory to be carried forward

57. A solid cylinder of diameter 100mm and height 50mm is forged between two
frictionless flat dies to a height of 25mm. The percentage change in diameter is
(A) 0 (B) 2.07 (C) 20.7 (D) 41.4

58. Which one of the following configurations has the highest fin effectiveness
(A) Thin, closely spaced fins (B) Thin, widely spaced fins
(C) Thick widely spaced fins (D) Thick, closely spaced fins

59. A circular solid disc of uniform thickness 20mm, radius 200mm and mass 20kg, is used
as a flywheel. If it rotates at 600rpm, the kinetic energy of the flywheel, in Joules is
(A) 395 (B) 790 (C) 1580 (D) 3160

60. For a long slender column of uniform cross section, the ratio of critical buckling load
for the case with both ends clamped to the case with both ends hinged is
(A) 1 (B) 2 (C) 4 (D) 8

61. In abrasive jet machining, as the distance between the nozzle tip and the work surface
increases, the material removal rate
(A) Increases continuously
(B) Decreases continuously
(C) Decreases, becomes stable and then increases
(D) Increases, becomes stable and then decreases

62. During normalizing process of steel, the specimen is heated
(A) Between the upper and lower critical temperature and cooled in still air
(B) Above the upper critical temperature and cooled in furnace
(C) Above the upper critical temperature and cooled in still air
(D) Between the upper and lower critical temperature and cooled in furnace

Page 220

63. Oil flows through a 200mm diameter horizontal cast iron pipe (friction factor,
f=0.0225) of length 500m. The volumetric flow rate is 0.2m 3/s. The head loss (in m)
due to friction is (assume g=9.81m/s2)
(A) 116.18 (B) 0.116 (C) 18.22 (D) 232.36

64. For an opaque surface, the absorptivity , transitivity  and reflectivity  are
related by the equation
(A)      (B)       0 (C)     1 (D)     0

65. The following are the data for two crossed helical gears used for speed reduction:
Gear I: Pitch circle diameter in the plane of rotation 80mm and helix angle 30º.
Gear II: Pitch circle diameter in the plane of rotation 120mm and helix angle 22.5º.
If the input speed is 1440 rpm, the output speed in rpm is
(A) 1200 (B) 900 (C) 875 (D) 720

66. A thin walled spherical shell is subjected to an internal pressure. If the radius of the
shell is increased by 1% and the thickness is reduced by 1%, with the internal pressure
remaining the same, the percentage change in the circumferential (hoop) stress is
(A) 0 (B) 1 (C) 1.08 (D) 2.02

67. As per common design practice, the three types of hydraulic turbines, in descending
order of flow rate, are
(A) Francis, Kaplan, Pleton (B) Kaplan, Francis, Pelton
(C) Pelton, Kaplan, Francis (D) Pelton, Francis, Kaplan

68. During a non-flow thermodynamic process (1-2) executed by a perfect gas, the heat
interaction is equal to the work interaction (Q1-2 = W 1-2) when the process is
(A) Isentropic (B) Isothermal (C) Polytropic (D) Adiabatic

69. In a casting process, a vertical channel through which molten metal and flows
downward from pouring basin to runner for reaching the mold cavity is called
(A) sprue (B) pin hole (C) riser (D) blister

70. Consider an ideal vapor compression refrigeration cycle. If the throttling process is
replaced by an isentropic expansion process, keeping all the other processes unchanged,
which one of the following statements is true for the modified cycle?
(A) Coefficient of performance is the same as that of the original cycle
(B) Coefficient of performance is lower than that of the original cycle
(C) Refrigerating effect is lower than that of the original cycle
(D) Coefficient of performance is higher than that of the original cycle

71. In orthogonal turning of a cylindrical tube of wall thickness 5mm, the axial and the
tangential cutting forces were measured at 1259 N and 1601 N, respectively. The
measured chip thickness after machining was found to be 0.3 mm. The rake angel was
10° and the axial feed was 100 mm/min. The rotational speed of the spindle was 1000
rpm. Assuming the material to be perfectly plastic and Merchant’s first solution, the
shear strength of the martial is closest to
(A) 722 MPa (B) 875 MPa (C) 200 MPa (D) 920 Mpa

Page 221

72. Taylor’s tool life equation is given by VTn = C, where V is in m/min and T is in min.
In a turning operation, two tools X and Y are used. For tool X, n = 0.3 and C = 60 and
for tool Y, n = 0.6 and C = 90. Both the tools will have the same tool life for the
cutting speed (in m/min, round off to one decimal place) of _____.
(A) 40.5 (B) 42.5 (C) 38.5 (D) 38.0

73. In a UTM experiment, a sample of length 100 mm, was loaded in tension until failure.
The failure load was 40 kN. The displacement, measured using the cross-head motion,
at failure, was 15 mm. The compliance of the UTM is constant and is given by 5 × 10–
8 m/N. The strain at failure in the sample is ___________%.
(A) 18 (B) 13 (C) 20 (D) 15

74. A spur gear with 20° full depth teeth is transmitting 20 kW at 200 rad/s. The pitch circle
diameter of the gear is 100mm. The magnitude of the force applied on the gear in the
radial direction is
(A) 1.39 kN (B) 2.78 kN (C) 0.36 kN (D) 0.73 kN

75. Which one of the following welding methods provides the highest heat flux (W/mm 2)?
(A) Plasma are welding (B) Tungsten inert gas welding
(C) Oxy-acetylene gas welding (D) Laser beam welding

x-x-x

Page 222

(ME-BIOTECHNOLOGY)

1. Plasmids are used as cloning vectors for which of the following reasons?
(A) Can be multiplied in culture
(B) Self-replication in bacterial cells
(C) Can be multiplied in laboratories with the help of enzymes
(D) Replicate freely outside bacterial cells

2. The system of units which is internationally accepted for measurement is called as
(A) MKS system (B) CGS system (C) FPS system (D) SI system

3. Mechanical agitation is required only in which reactor
(A) Packed bed (B) Airlift reactor (C) Stirred tank (D) Bubble column

4. If the physical change accompanying the reaction is heat output, the biosensors are
referred to as ____________
(A) potentiometric biosensors (B) optical biosensors
(C) calorimetric biosensors (D) amperometric biosensors

5. Which bacterium is used in the production of insulin by genetic engineering?
(A) Saccharomyces (B) Rhizobium
(C) Escherichia (D) Mycobacterium

6. A non-directed physico-chemical interaction between heavy metal ions and microbial
surface is called
(A) biotransformation (B) biosorption
(C) bioconversion (D) biomining

7. Centrifugation is based on?
(A) Patrick's Law (B) McLaren's law (C) Stoke's Law (D) Stain's Law

8. What is not True for DNA in prokaryotes
(A) present in the form of a compact structure called nucleoid
(B) the coils are maintained by non-histone basic proteins
(C) found in cytoplasm in a supercoiled condition
(D) packaged as nucleosomes along with histones

9. Which of the following statement is incorrect?
(A) Self-assembly is a top-down manufacturing technique
(B) In self-assembly, weak interactions play very important role
(C) Self-assembling molecules adopt an organised structure which is
thermodynamically more stable than the single, unassembled components
(D) Compared to the isolated components, the self-assembled structure has a higher
order

10. Which of the Following is Produced with the Combination of Apoenzyme and
Coenzyme:
(A) Holoenzyme (B) Enzyme substrate complex
(C) Prosthetic group (D) Enzyme product complex

Page 223

11. In gas chromatography, capillary columns are open tubular columns constructed from
which of the following materials?
(A) Glass (B) Metal (C) Stainless steel (D) Fused silica

12. The computational methodology that tries to identify the best matching between two
molecules, a ligand and receptor are known as _______?
(A) Molecular matching (B) Molecule affinity checking
(C) Molecular docking (D) Molecular fitting

13. The Latin Term “Invitro” refers to_______ ?
(A) Outside the lab (B) Outside the glass
(C) Within the lab (D) Within the glass

14. One nanometre is equal to
(A) 109 mm (B) 10-6cm (C) 10-7 cm (D) 10-9 cm

15. Three unknown solutions are given with pH value of 6, 8 & 9.5 respectively. Which
solution will contain the maximum OH– ion?
(A) Solution sample-1 (B) Solution sample-2
(C) Solution sample-3 (D) Data are insufficient

16. In Snapdragon two plants with pink flowers were hybridized. The F1 plants produced
red, pink and white flowers in the proportion of 1 red, 2 pink and 1 white. What could
be the genotype of the two plants used for hybridization? Red flower colour is
determined by RR and white by rr genes.
(A) Rr (B) rr (C) rrr (D) RR

17. When is electrophoresis not used
(A) Separation of proteins (B) Separation of amino acids
(C) Separation of lipids (D) Separation of nucleic acids

18. Mendel developed his basic principles of heredity by
(A) Microscopic study of chromosomes and genes
(B) Mathematical analysis of the offspring of Pea plant
(C) Breeding experiments with Drosophila
(D) Anatomical studies of Pea plant

19. Mode of DNA replication is
(A) Conservative and bidirectional
(B) Semiconservative and unidirectional
(C) Semiconservative and bidirectional
(D) Conservative and unidirectional

20. Name the enzyme which is found in tears, sweat, and an egg white?
(A) Ribozyme (B) Lysozyme (C) Zymogen (D) Isozymes

21. Which mRNA will be translated to a polypeptide chain containing 8 amino acids?
(A) AUGUUAAUAGACGAGUAGCGACGAUGU
(B) AUGAGACGGACUGCAUUCCCAACCUGA

Page 224

(C) AUGCCCAACCGUUAUUCAUGCUAG
(D) AUGUCGACAGUCUAAAACAGCGGG

22. The enthalpy change in a reaction does not depend upon
(A) the state of reactions and products
(B) the nature of the reactants and products
(C) different intermediate steps in the reaction
(D) initial and final enthalpy of the reaction

23. The bioreactor is not capable of ______________
(A) Producing aseptic conditions (B) Meeting containment regulations
(C) Controlling pH (D) Producing electricity

24. The least random state of the water system is:
(A) ice (B) liquid water (C) steam (D) randomness is same

25. AIDS disease is caused by a virus which belongs to
(A) Retro virus group (B) Rhabdo virus group
(C) Hepatitis virus group (D) Adeno virus group

26. Macromolecule chitin is
(A) a simple polysaccharide
(B) sulphur containing polysaccharide
(C) phosphorous containing polysaccharide
(D) nitrogen containing polysaccharide

27. Which of the following is true for the enzymes?
(A) Do not require activation energy
(B) Do not change requirement of activation energy
(C) Increase requirement of activation energy
(D) Lowest requirement of activation energy

28. In Atomic Absorption Spectroscopy, which of the following is the generally used
radiation source?
(A) Tungsten lamp
(B) Xenon mercury arc lamp
(C) Hydrogen or deuterium discharge lamp
(D) Hollow cathode lamp

29. On Mac Conkey’s medium E. Coli forms
(A) Colorless colonies (B) Greenish pigmentation
(C) Pink coloured colonies (D) Medusa head appearance

30. A cell becomes flaccid when placed in a
(A) Isotonic solution (B) Hypertonic solution
(C) Hypotonic solution (D) Normal solution
31. Bacteria are more sensitive to antibiotics at which phase of growth curve?
(A) Decline phase (B) Stationary phase
(C) Lag phase (D) Log phase

Page 225

32. ___________ is one of the most important aspects of biomaterial-tissue interactions.
(A) Biocompatibility (B) Bioavailability
(C) Bioequivalence (D) Bioluminescence

33. Beer Lambert’s law gives the relation between which of the following?
(A) Reflected radiation and concentration
(B) Scattered radiation and concentration
(C) Energy absorption and concentration
(D) Energy absorption and reflected radiation

34. Which one of the following is a primary lymphoid organ:
(A) Lymph nodes (B) Spleen (C) Peyer's patch (D) Thymus

35. Which of the following statements is false about Ascorbic acid?
(A) It shows antioxidant activity
(B) It is a strong reducing agent
(C) It can be synthesized in the body
(D) Involved in the hydroxylation of prolyl- and lysyl- residues of collagen

36. The identification of bacteria by serologic tests is based on the presence of specific
antigens. Which of the following bacterial components is least likely to contain useful
antigens?
(A) Capsule (B) Cell wall (C) Flagella (D) Ribosomes

37. NMR is the study of absorption of __________ by nuclei in a magnetic field?
(A) Radioactive radiation (B) IR radiation
(C) Radio frequency radiation (D) Microwaves

38. To prepare vaccine for small pox, the material used by Edward Jenner is
(A) Small pox material (B) Chicken pox material
(C) Cow-pox material (D) Measles material

39. Richard Feynman is often credited with predicting the potential of nanotechnology.
What was the title of his famous speech given on December 29, 1959?
(A) There is a tiny room at the bottom (B) Things get nanoscopic at the bottom
(C) Bottom? What bottom? (D) There is plenty of room at the bottom

40. Which ratio is constant for DNA?
(A) A + G / T + C (B) A + T / G + C
(C) A + C / U + G (D) A + U / G + C

41. In mass spectrometer, the sample that has to be analysed is bombarded with which of
the following?
(A) Protons (B) Electrons (C) Neutrons (D) Alpha particles

42. Which out of the following technique is used for detection of gene of interest?
(A) Southern blotting (B) Polymerase chain reaction
(C) Northern Blotting (D) DNA footprinting

Page 226

43. Which of the following is not a characteristic of the immobilized enzymes?
(A) Same catalytic activity is present for number of analysis
(B) It produces reproducible results
(C) Stability exists
(D) They cannot be re-used

44. Which of the following vitamin deficiency causes Beriberi?
(A) Vitamin B1 (B) Vitamin B2 (C) Vitamin B6 (D) Vitamin B12

45. 110 joule of heat is added to a gaseous system, whose internal energy is 40J. Then the
amount of external work done is
(A) 150 J (B) 70 J (C) 110 J (D) 40 J

46. Cytochromes present in cells are
(A) Carbon acceptors (B) Oxygen acceptor
(C) Hydrogen acceptors (D) Nitrogen acceptors

47. The ability of a population of living species to increase under ideal environmental
condition is called
(A) Biotic potential (B) Carrying capacity
(C) Natality (D) Absolute nantality

48. The rate constant of a chemical reaction increases by 100 times when the temperature
is increased from 400 °K to 500 °K. Assuming transition state theory is valid, the value
of E/R is
(A) 8764°K (B) 8987°K (C) 9210°K (D) 8621°K

49. Bucky balls are made up of:
(A) Nickle (B) Carbon (C) DNA (D) Uranium

50. The Bt toxin gene from Bacillus thuringiensis used to generate genetically modified
crops is
(A) cry (B) cro (C) cdc (D) cre

51. The process by which intracellular macromolecules are supplied for lysosomal
degradation during nutrient starvation is
(A) phagocytosis (B) pinocytosis (C) autophagy (D) Apoptosis

52. Biomaterials are intended to ___. I. Replace a body part, II. Regenerate an organ,
III. Augment function
(A) I, II, and III (B) I only (C) I and II only (D) III only

53. Which of the following acts as ionising gas in Geiger Muller counter?
(A) Alcohol (B) Argon gas (C) Krypton (D) Hydrogen

54. __________ is the response curve for a step input signal from a reactor.
(A) I-curve (B) C-curve (C) S-curve (D) Z-curve

55. Decomposers which specifically act on the fecal matter of other organism
(A) Heterophagic (B) Allopagic (C) Coprophagic (D) Paraphagic

Page 227

56. In a biosensor ___________ is one which involves subtracting a ‘reference’ baseline
signal from the sample signal.
(A) signal processor (B) amplifier
(C) detector (D) transducer

57. A graft between members of the same species is termed an:
(A) Autograft (B) Isograft (C) Xenograft (D) Allograft

58. For every 10°C rise in temperature, the rate of chemical reaction doubles. When the
temperature is increased from 30 to 70°C, the rate of reaction increases __________
times.
(A) 8 (B) 12 (C) 16 (D) 32

59. The correct sequence of the mitotic cell cycle is
(A) M-Phase, G1-Phase, G2-Phase, S-Phase
(B) G1-Phase, S-Phase, G2-Phase, M-Phase
(C) M-Phase, G2-Phase, G1-Phase, S-Phase
(D) M-Phase, G1-Phase, S-Phase, G2-Phase

60. Which of the following tools is used for the identification of motifs?
(A) BLAST (B) COPIA (C) PROSPECT (D) Pattern hunter

61. Cell-mediated immunity is carried out by_________ while humoral immunity is mainly
carried out by_________
(A) B cells/T cells (B) Epitopes/Antigens
(C) T cells/B cells (D) Antibodies/Antigens

62. In Thin layer chromatography, the stationary phase is made of _________ and the
mobile phase is made of _________
(A) Solid, liquid (B) Liquid, liquid
(C) Liquid, gas (D) Solid, gas

63. The half-life period of a first order reaction is given by (where, K = rate constant)
(A) 1.5 K (B) 2.5 K (C) 0.693/K (D) 6.93K
64. _________ is a waste disposal method where solid organic wastes are converted to the
residue and gaseous products through combustion.
(A) Incarnation (B) Incineration (C) Incarceration (D) Incubation

65. Which of the following will give maximum gas conversion ?
(A) Plug-flow catalytic reactor (B) Semi-fluidised bed reactor
(C) Fixed bed reactor (D) Fluidised bed reactor

66. With increase in temperature, the equilibrium conversion of a reversible exothermic
reaction
(A) Decreases (B) Increases
(C) Remain unaffected (D) May increase or decrease
67. The stability of the nucleus can be predicted by which of the following?
(A) Electron to neutron ratio (B) Neutron to proton ratio
(C) Proton to electron ratio (D) Neutron to electron ratio

Page 228

68. The rate of degradation and microbes resistance to toxic pollutants remain better when
the
(A) mixed cell population is used
(B) individual cell is used
(C) mixed cell population along with metals is used
(D) individual cell along with metal is used

69. Eggshells of birds become unusually thin when exposed to the pesticides in their
environment. The protein that gets affected is ________
(A) Heparin (B) Calmodulin (C) Cysteine (D) Serine

70. A first order reaction A to B occurs in an isothermal porous catalyst pellet of spherical
shape. If the concentration of A at the centre of the pellet is much less than that of the
external surface, the process is limited by
(A) Diffusion within the pellet (B) Reaction
(C) Temperature (D) External mass transfer

71. Most common drawback of amalgam restoration is:
(A) Secondary expansion (B) Porosity
(C) Marginal break-down (D) Contraction away from margins

72. Normally, the rate of the heart beat in a human is determined by
(A) The bundle of His (B) All cardiac muscle
(C) The sinoatrial node (D) The cervical ganglion

73. The layer of the epidermis that sheds keratin cells that are constantly replaced is the?
(A) stratum lucidum (B) stratum corneum
(C) stratum mucosum (D) stratum granulosum

74. Which of the following is not a property or parameter of electromagnetic radiation?
(A) Wavelength (B) Voltage (C) Wave number (D) Amplitude

75. What is Callus?
(A) Tissues that grow to form an embryoid
(B) An unorganized actively dividing the mass of cells maintained in a culture
(C) An insoluble carbohydrate
(D) A tissue that grows from an embryo

x-x-x

Page 229

M.E.(Chemical/Chemical with specialization in Environmental Engg.)
1. Assuming that CO2 obeys perfect gas law, the density of CO2 (in kg/m3), at 00C and 2 atm is
(A) 1 (B) 2 (C) 3 (D) 4

2. A furnace shell has to be cooled from 90 °C to 55 °C. The mass of the furnace shell is 2 tonnes, the
specific heat of furnace shell is 0.2 kCal/kg °C. Water is available at 29 °C. The maximum allowed
increase in water temperature is 5 °C. Calculate the quantity of water required to cool the furnace.
Neglect heat loss.
(A) 1400 kg (B) 4200 kg (C) 2800 kg (D) None of these

3. By increasing the air/fuel ratio, the adiabatic flame temperature
(A) Increases (B) Decreases

(C) Remains unchanged (D) Change is unpredictable

4. A multiple effect evaporator has a capacity to process 400 kg of solid caustic soda per day which
it is concentrating from 10% to 25% solids. The water evaporated in kilograms per day is
(A) 8000 (B) 24000 (C) 60000 (D) 48000

5. Air at 293 K and 750 mm of Hg pressure has a relative humidity of 80%. What is its percent
humidity? The vapour pressure of water at 293 K is 17.5 mm of Hg.
(A) 80.38 (B) 80 (C) 79.62 (D) 78.51

6. A mixture of oxygen and sulfur dioxide is at 200kPa. The average molecular weight of mixture is
44.8. The partial pressure of the oxygen in the mixture is
(A) 89.6 kPa (B) 120 kPa (C) 101.3 kPa (D) 80 kPa

7. A gaseous reaction 𝐴 → 2𝐵 + 𝐶 takes place isothermally in a constant pressure reactor. Starting
with a gaseous mixture containing 50% A (rest inerts), the ratio of final to initial volume is found
to be 1.6. The percentage conversion of A is
(A) 60 (B) 30 (C) 50 (D) 74
8. The figure below is representing:

(A) Proportional control (B) Feedback control

(C) Domain control (D) Feed forward control

9. If a system consists of two immiscible liquids (such as CCL4 and CH3OH), how many phases are
there:
(A) 1 (B) 2 (C) 3 (D) 4

Page 230

10. Throat to the pipe diameter is constant in:
(A) Orifice-meter (B) Venturi-meter
(C) Pitot-tube (D) All of the above

11. Hagen-Poiseuille equation is applicable for
(A) Laminar flow of non-newtonian fluids
(B) Laminar flow of Newtonian fluids
(C) Turbulent flow
(D) The flow of Newtonian and non-newtonian fluid

12. A floating body displaces a volume of liquid equal to
(A) Its own weight (B) Its submerged weight

(C) Its own volume (D) Its submerged volume

13. For laminar flow in a pipe, the value of momentum correction factor (β) is
(A) 3/4 (B) 4/3 (C) 0 (D) 1

14. Positive displacement pumps
(A) Are usually self-priming
(B) Deliver fluid at a uniform pressure without pulsations
(C) Run at higher speeds than centrifugal pumps
(D) Can be operated with a closed discharged valve for a longer time
15. The equivalent diameter of a 6 by 12 cm cross-section is , in centimeters
(A) 1 (B) 2 (C) 6 (D) 8

16. A gas can be liquefied
(A) Above its critical temperature (B) At its critical temperature
(C) Below its critical temperature (D) At its any temperature

17. Which of the following processes is employed in petrochemical industry to produce Benzene,
Toulene and Xylene (BTX)
(A) Thermal cracking (B) Catalytic reforming

(C) Steam reforming (D) Catalytic cracking

18. 40% oleum comprises of 40% free
(A) SO2 (B) H2SO3 (C) SO3 (D) H2SO4

19. Non-fibrous raw material is
(A) resin (B) cotton rag (C) reuse pulp (D) paper pulp

20. SBR is not used for making
(A) shoe soles (B) heavy duty tyres

(C) gaskets (D) coated fabrics

21. The main raw materials for the production of soap are
(A) tallow and 20% oleum (B) vegetable oils and 98.7% H2SO4

(C) vegetable oils and caustic soda (D) tallow and soda ash

22. Which of the following petroleum products has minimum ˚API ?
(A) Gasoline (B) Kerosine

(C) Furnace oil (D) High speed diesel oil

Page 231

23. Most of the bacteria in sewage are
(A) pathogenic (B) anaerobic (C) saprophytic (D) parasitic

24. The lowest layer of atmosphere is called
(A) ionosphere (B) troposphere (C) stratosphere (D) exosphere

25. Which of the following devices of particulate collection is the least efficient ?
(A) Cyclone separator (B) Electrostatic precipitator

(C) Fabric filter (D) Wet scrubber

26. Ethanol-water mixture
(A) Forms a minimum boiling azeotropes (B) Forms a maximum boiling azeotropes
(C) Shows negative deviation from ideality (D) Both (B) and (C)

27. Heat is liberated during phase change in
(A) Boiler (B) Evaporator (C) Condenser (D)Both (A) and (B)

28. If the moisture content of the solid on dry basis is X, then the same on wet basis is
(A) X/(1-X) (B) (1+X)/X (C) X/(X+1) (D) (1-X)/X

29. __________ column is the most suitable for achieving the best performance for mass transfer
operations involving liquid with dispersed solids.
(A) Wetted wall (B) Packed (C) Plate (D) Spray
30. Air is best heated with steam in a heat exchanger of
(A) plate type (B) double pipe type with fin on steam side
(C) double pipe type with fin on air side (D) shell and tube type

31. It is not preferable to use superheated steam in evaporators, because of its very
(A) high temperature (B) low film co-efficient

(C) high pressure (D) high film co-efficient

32. Swenson-walker crystallizer is a ________ unit
(A) Continuous (B) Batch
(C) Semi-batch (D) Cooling(adiabatic)-cum-evaporation

33. In natural convection heat transfer the correlating parameter is
(A) Graetz number (B) Eckert number (C) Grashoff number (D) Bond number
34. Filter aid is used to
(A) Increase the rate of filtration (B) Increase the porosity of the cake
(C) Decrease the pressure drop (D) Act as a support base for the septum

35. Which is the most suitable conveyor for transportation of sticky material
(A) Apron (B) Belt (C) Screw (D) Pneumatic

36. Highly viscous liquids & pastes are agitated by
(A) Propellers (B) Turbine agitators
(C) Multiple blade paddles (D) None of these

37. Wet sieving is employed, when the product contains _______ materials
(A) Abrasive (B) Large quantity of very fine
(C) Coarse (D) Non-sticky

Page 232

38. With increase in temperature the vapour pressure of liquids
(A) Increases (B) Increases linearly
(C) Decreases (D) Remains constant

39. Brittle materials are
(A) weak in tension but strong in compression
(B) strong in tension but weak in compression
(C) weak in tension as well as in compression
(D) strong in tension as well as in compression
40. Bronze is an alloy of
(A) copper and zinc (B) zinc and tin
(C) nickel and tin (D) copper and tin
41. An input which increases linearly with time is known as
(A) step-input (B) impulse-input
(C) sinusoidal-input (D) ramp-input
42. For underdamped second-order response, damping coefficient (ζ) is
(A) equal to 1 (B) less than 1
(C) greater than 1 (D) equal to zero
43. Solenoid valve works like
(A) proportional controller
(B) on-off controller
(C) proportional-derivative controller
(D) proportional-integral-derivative controller
44. Phase Margin is equal to
(A) 180˚-Φ (B) Φ-180˚ (C) Φ+90˚ (D) Φ - 90˚
45. What is the steady state output of the transfer function ( )( )
for a unit ramp Input
(A) 1/2 (B) 12 (C) 3/4 (D) 0

46. Size reduction of asbestos and mica is done by
(A) hammer mills (B) rod mills

(C) gyratory crushers (D) crushing rolls

47. 20-mesh screen means
(A) 20 openings per square inch (B) 20 openings per linear cm

(C) 20 openings per linear inch (D) 20 openings per square cm

48. If the density of a fluid changes from point to point in a flow region, it is called
(A) Steady Flow (B) Unsteady flow

(C) Non uniform Flow (D) Compressible flow

49. For incompressible sludge, the specific cake resistance is
(A) independent of the pressure drop over cake

(B) directly proportional to the pressure drop over cake

(C) inversely proportional to the pressure drop over cake

(D) directly proportional to the square root of the pressure drop over cake

Page 233

50. Breakeven point is the point where
(A) fixed and variable cost lines intersect (B) fixed and total cost lines intersect

(C) variable and total cost lines intersect (D) Sales revenue and total cost lines intersect

51. Depreciation of machines, according to income tax regulations is calculated on the basis of
(A) direct expenses (B) indirect expenses

(C) receipts (D) administrative expenses

52. Gibbs free energy of mixing at constant temperature and pressure must always be
(A) zero (B) positive (C) negative (D) infinity

53. On a Mollier chart the slope of the curve representing a reversible isothermal process is equal to
(A) T - (B) T (C) T - β (D) T +

54. The ratio of isothermal compressibility to adiabatic compressibility is always
(A) 1 (B) > 1 (C) <1 (D) << 1

55. Triple point of water occurs at 0.00602 atm and
(A) 0.01˚C (B) 444.6˚C (C) 100˚C (D) 4˚C

56. In a throttling process, which one of the following parameters remains constant?
(A) Temperature (B) Pressure (C) Enthalpy (D) Entropy

57. Heat conduction does not occur
(A) if a physical is impermeable

(B) if the parts of a body are not in motion relative to one another

(C) if the bodies are kept in vacuum

(D) if the temperatures of the two bodies are identical

58. For the first order reaction, half-life is 14 s, the time required for initial concentration to reduce
to 1/8 of its value is
(A) (14)3 s (B) 28s (C) 42s (D) (14)2s

59. For perfect mixed flow the dispersion number must be
(A) zero (B) less than 2100

(C) less than 2 (D) infinity

60. One litre per second of gaseous reactant A is introduced into a mixed reactor. The stoichiometry
is A  3R, the conversion is 50% and under these conditions the leaving flow rate is 2 litres per
second. The space-time for this operation is
(A) 1 sec (B) ½ sec (C) 2 sec (D) 1/3 sec

61. At the thermal equilibrium the ratio of the total emissive power to the absorptivity for all bodies
is the same. This statement is known as
(A) Wien’s displacement law (B) Stefan-Boltzmann law

(C) Planck’s law (D) Kirchhoff’s law

62. In natural convection, fluid moves under the influence of
(A) buoyant forces arising from changes in density

Page 234

(B) changes in fluid pressure produced by external work

(C) surface tension forces

(D) elastic forces

63. A cold fluid is heated from 40˚C to 130˚C by steam at 150˚C. The LMTD in parallel flow is
(A) lower than the LMTD in counterflow

(B) greater than the LMTD in counterflow

(C) equal to the LMTD in counterflow

(D) zero

64. Duhuring’s rule states that in boiling point of a given solution is a linear function of
(A) density of water

(B) viscosity of water

(C) thermal conductivity of water

(D) boiling point of pure water at the same pressure

65. Work required to form a particle of size Dp from very large feed is proportional to the square root
of surface to the volume ratio of the product is known as
(A) Kick’s law (B) Bond’s law (C) Rittinger’s law (D) Work index
66. For turbulent flow past a flat plate, when no form drag is present, the friction factor ‘f’ and the
Chilton-colburn factor ‘jD’ are related as
(A) f and jD cannot be related (B) f = jD
(C) f > jD (D) f < jD

67. In countercurrent liquid-liquid extraction, the solvent B is used to separate solute C from a given
solution A & C. The liquids A & B are insoluble. The slope of the operating line will be :
(A) 0 (B) infinity (C) positive (D) negative

68. All moisture in a non-hygroscopic material is
(A) bound moisture (B) free moisture

(C) unbound moisture (D) equilibrium moisture

69. At a given equilibrium pressure, the concentration of adsorbed gas on adsorbent solid
(A) remains constant with change in temperature

(B) increases with increased temperature

(C) decreases with increased temperature

(D) decreases linearly with increased temperature

70. The McCabe ΔL law states that the
(A) molar heats of vaporization of components are nearly equal

(B) linear crystal growth rate depends on the degree of super saturation

(C) linear crystal growth rate does not depend on the crystal size

(D) linear crystal growth rate depends on the crystal size

Page 235

71. The number of ideal plates required for specified separation in a plate column can be calculated
by use of

(A) Kremser-Brown-Souders equation (B) underwood equation

(C) Murphree equation (D) Rayleigh equation

72. An azeotropic mixture of two liquids has boiling point lower than either of boiling two liquids when
it
(A) shows negative deviation from the Raoult’s law

(B) shows positive deviation from the Raoult’s law

(C) shows no deviation from the Raoult’s law

(D) is saturated

73. In distillation column design, the McCabe-Thiele procedure is inadequate and a Ponchon Savarit
Procedure is needed when
(A) saturated feed is not used

(B) an azeotrope forms

(C) the latent heats of vaporization of the more and less volatile components are greatly
different

(D) a total condenser is used

74. The gases from a sulphur burner in a sulphuric acid plant has the composition
SO2 6.5%

SO3 2.78%

O2 10.65%

H2 80.07%

What was the percentage completion of oxidation of S to SO3 ?

(A) 59.92% (B) 14.98% (C) 36.47% (D) 29.96%.

75. The exhaust gas from a hydrocarbon fuel oil fired furnace shows 10.2% CO2, 7.9% O2 and 81.9%
N2. By orsat analysis, calculate % excess air used.
(A) 28.48% (B) 56.96% (C) 14.24% (D) 89.56%

x-x-x

Page 236

M.E. Civil Engg. (Construction Technology & Management)
1. In a wet soil mass, air occupies one-sixth of its volume and water occupies one-third of
its volume. The void ratio of soil is
(A) 0.50 (B) 0.25 (C) 0.75 (D) 1.0

2. A fully saturated clay sample is subjected to a pressure increment of 200 kpa in
consolidation test. If after certain time period, the pore pressure is recorded as 50 kpa,
the degree of consolidation is
(A) 40% (B) 25% (C) 75% (D) 50%

3. Shape factor S(C) for a strip footing with width of 2 m is
(A) 1 (B) 0.5 (C) 0.4 (D) 2

4. A spread footing which supports two or more columns is termed as
(A) Stepped footing (B) Combined footing
(C) Strip footing (D) Column footings

5. The number of blows recorded in a standard penetration test is for a penetration of
(A) 10 cm (B) 25 cm (C) 30 cm (D) 40 cm

6. The R.L, of the point A which is on the floor is 100 m and back sight reading on A is
2.455 m. If the foresight reading on the point B which is on the ceiling is 2.745 m, the
R.L. of point B will be
(A) 94.80 m (B) 99.71 m (C) 100.29 m (D) 105.20 m

7. A lighthouse is visible just above the horizon at a certain station at the sea level. The
distance between the station and the lighthouse is 40 km. The height of the light house
is approximately
(A) 187 m (B) 137.7 m (C) 107.7 m (D) 87.3 m

8. Which one of the following is NOT strictly a method of remote sensing?
(A) Thermal and multi spectral scanning (B) Microwave sensing
(C) Earth resource satellite (D) Stereoscopy

9. Shape factor is property which depends on
(A) Ultimate stress of material
(B) Field stress of material
(C) Geometry of section
(D) Yield stress and ultimate stress and ultimate stress of material

10. Maximum stress theory of failure is applicable to
(A) Ductile materials only (B) Brittle materials only
(C) Both brittle and ductile materials (D) All structural materials

11. The deflection due to couple M at the free end of a cantilever of length L is
(A) ML/EI (B) 2ML/EI (C) ML2/2EI (D) M2L/2EI

12. The ratio between the stress produced in a bar by impact loading as compared to the
stress produced by the gradual application of the same load is
(A) 1.5 (B) 2.5 (C) 2.0 (D) 2.25

Page 237

13. The ratio of Young’s modulus to modulus of rigidity for a material having Poisson’s
ratio 0.25 is
(A) 2.0 (B) 2.5 (C) 1.5 (D) 1.67

14. The static indeterminacy of a two hinged arch is
(A) 4 (B) 3 (C) 2 (D) 1

15. A Column that fails due to direct stress is called
(A) Short column (B) Long Column (C) Weak Column (D)Medium Column

16. Gypsum to the cement is added for
(A) Induce colour (B) Increase strength
(C) Retard setting time (D) Quick hardening

17. Abrasion test is conducted to find the
(A) Hardness of aggregates (B) Impact value aggregates
(C) Toughness of aggregates (D) Water absorption of aggregates

18. Minimum grade of concrete to be used in Reinforced concrete as per IS:456-2000 is
(A) M15 (B) M20 (C) M25 (D) M30

19. In a steel plate with bolted connections, the rupture of the net section is a mode of failure
under:
(A) Tension (B) Compression (C) Flexure (D) Shear

20. Transverse Fillet Welds are designed for
(A) Tensile Strength (B) Compressive Strength
(C) Shear Strength (D) Bending strength

21. The Efficiency of Sedimentation Tank for a given discharge, can be increased by
(A) Increasing the depth of the tank (B) Decreasing the depth of the tank
(C) Increasing the Surface Area of the Tank (D) Decreasing the surface area of the Tank

22. The most common Coagulant is
(A) Lime (B) Alum (C) Chlorine (D) Bleaching
Powder

23. The loss of stress with time at constant strain is called
(A) Relaxation (B) Creep (C) Shrinkage (D) Ductility
24. Sullage does not contain waste from
(A) Bathroom (B) Wash basin (C) Kitchen sinks (D) Water closets

25. The diameter of longitudinal bars of a column should never be less than
(A) 6 mm (B) 8 mm (C) 10 mm (D) 12 mm

26. A flat slab is supported
(A) On beams (B) On columns
(C) On beams and columns (D) On columns monolithically built with slab

(2)

Page 238

27. As the percentage of steel in beams increase
(A) The depth of NA decreases (B) The depth of NA increases
(C) Lever arm decreases (D) Lever arm increases

28. The Shear reinforcement in RCC is provided to resist
(A) Vertical stress (B) Horizontal shear
(C) Diagonal compression (D) Diagonal tension

29. Economical depth of plate girder concept is based on:
(A) Minimum weight (B) Minimum depth
(C) Minimum width (D) Minimum thickness of web

30. The maximum shear force at a section is 56 kn. An ISWB of height 350 mm breadth
200 mm, thickness of web 8 mm with a section modulus of 887 cm 3 is used as a beam
at the section. The shearing stress is:
(A) 10 N/mm2 (B) 20 N/mm2 (C) 28.4 N/mm2 (D) 41.6 N/mm2

31. A simply supported beam of rectangular section of width 150 mm and depth 300 mm
subjected to a maximum bending moment of 22.5 kn-m. The maximum bending stress
induced in the beam will be
(A) 20 mpa (B) 15 mpa (C) 10 mpa (D) 25 mpa

32. For the frame shown in Figure, the distribution factors for members BC and BA at joint
B are

(A) 0.4, 0.6 (B) 0.5, 0.5 (C) 0.6, 0.4 (D) 0.7, 0.3

33. For 12 mm thick cement plastering 1:6 on 100 m2 new brick work, the quantity of
cement required is
(A) 0.200 m3 (B) 0.247 m3 (C) 0.274 m3 (D) 0.295 m3

34. The floor area includes the area of balcony up to
(A) 100% (B) 75% (C) 50% (D) 25%

Page 239

35. Earliest start and completion times of the various activities of a project are obtained by
(A) Backward pass (B) Forward pass
(C) Shortest path (D) Longest path

36. The system in which owner acquires land, prepare drawings & estimation and the
contractor execute the work, operate and collect fee from the users till the full cost is
realized is known as
(A) Rate contract (B) BOT
(C) Lump sum contract (D) Turnkey

37. For each critical activity, total, free and independent floats are equal to
(A) 1 (B) 2 (C) 0 (D) 3

38. A floating body with its centre of gravity at G, Centre of Buoyancy at B, and metacentre
at M, is stable when;
(A) G lies above B (B) B lies above M
(C) B lies below M (D) G lies below M

39. The specific energy in an open channel is defined as;
(A) Total energy measured in a horizontal datum
(B) Kinetic energy plotted above the free surface
(C) Total energy measured with respect to the channel bottom taken as the datum
(D) Total energy of a specified weight of liquid

40. The concept of stream function, ψ, is applicable to;
(A) Uniform flow cases only (B) Rotational flows only
(C) Two dimensional flows only (D) Three dimensional flows only

41. When compared to an orifice having the same diameter, d, and discharging head, H, the
discharge through the mouth piece will be
(A) The same as that through the orifice
(B) More than the discharge through the orifice
(C) Less than that through the orifice
(D) Some time more and some times less than the orifice

42. The hydraulic-grade line indicates the variation of
(A) The energy of the flow in the direction of flow
(B) Velocity head in the direction of flow
(C) Piezometric head in the direction of flow
(D) Pressure head in the direction of flow

43. Critical depth is defined as the depth of flow at which the;
(A) Specific energy is maximum
(B) Unit discharge, q, is minimum
(C) Specific energy is minimum
(D) Froude number is greater than unity

44. A change in the original shape of the pavement is known as
(A) Rutting (B) Deformation (C) Deflection (D) Depression

Page 240

45. Vehicular live load of highway bridges is expressed in terms
(A) Design axles and lane loading (B) Design pressure and lane loading
(C) Design lanes and lane loading (D) Design width and lane loading

46. In Concrete Roads, Camber provided is
(A) 1 in 20 to 1 in 24 (B) 1 in 36 to 1 in 48
(C) 1 in 60 to 1 in 72 (D) 1 in 48 to 1 in 60

47. The rainfall hyetograph is the graph drawn between
(A) Cumulative rainfall and time (B) Rainfall intensity and time
(C) Rainfall depth and Area (D) Rainfall intensity and cumulative rainfall

48. The hydrologic flood –routing methods use
(A) Equation of continuity only
(B) Both momentum and continuity equations
(C) Energy equation only
(D) Equation of motion only

49. The self-cleansing velocity for all the sewers in India is usually
(A) Less than 1 m/s (B) 1 m/s to 1.2 m/s
(C) 1.5 m/s to 2.0 m/s (D) 3.0 m/s to 3.5 m/s

50. A road surface is corrected by spreading a layer of dry sand in a thickness varying from
5 mm to 10 mm and rolling the surface by heavy rollers. Which one of the following
maintenance works does it apply to?
(A) Repair of ruts and patches (B) Repair of joints and cracks
(C) Repair of bleeding surface (D) Repair of blow ups

51. The single grained structure is a characteristic of __________
(A) Coarse-grained soil (B) Fine-grained soil
(C) None of the mentioned (D) All of the mentioned

52. The toughness index (It) is defined by the ratio of __________
(A) It=WP/IP (B) It=IP/If (C) It=IF/IP (D) It=WL/If

53. Who will prepare the specifications for the highway?
(A) NHAI (B) BIS (C) IRC (D) MORTH

54. The width of a pavement of 2 lane national highway is
(A) 8.80 m (B) 3.00 m (C) 3.75 m (D) 7.0 m

55. Which of the following type of irrigation method can be used for both flat lands and
relatively steep lands?
(A) Free Flooding (B) Basin Flooding
(C) Furrow Method (D) Drip Irrigation Method

56. The difference in level between the top of a bank and supply level in a canal, is called
(A) Berm (B) Free board (C) Height of bank (D) None of these

Page 241

57. Which of the following is NOT a primary pollutant?
(A) Nitrogen oxide (B) Carbon monoxide
(C) Ground-level ozone (D) Carbon dioxide

58. The detention period of a rectangular tank is given by _______
(A) t0 = HQ/LB (B) t0 = LB/HQ (C) t0 = Q/LBH (D) t0 = LBH/Q

59. Which of the following property of a substance that resists abrasion or scratching that
causes penetration or indentation?
(A) Hardness (B) Stiffness (C) Toughness (D) Strength
60. Bulking ___________ with increase in moisture.
(A) Increase (B) Decrease
(C) First increase then decrease (D) First decrease then increase

61. For design of flexural members by limit state design, the compressive strength of
concrete in the structure is assumed to be
(A) 0.67 times of the characteristic strength (B) 0.75 times of the characteristic strength
(C) 0.87 times of the characteristic strength (D) None of these

62. The immediate settlement can be computed from the expression, based on
____________
(A) Theory of plasticity (B) Theory of elasticity
(C) Terzaghi’s analysis (D) Pressure distribution

63. A long natural slope of cohesion-less soil is inclined at 12° to the horizontal. What will
be the factor of safety of the slope if φ = 30°?
(A) 1.6 (B) 2.7 (C) 0.13 (D) 0.4

64. If duty (D) is 1428 hectares/cumec and base period (B) is 120 days for an irrigated crop,
then delta in meters is given by
(A) 102.8 (B) 0.73 (C) 1.38 (D) 0.01

65. If total hardness of the water is greater than the its total alkalinity, then carbonate
hardness will be equal to
(A) Total alkalinity (B) Total Hardness
(C) Total Hardness - Total alkalinity (D) Non- Carbonate hardness

66. Which of the following is taken into consideration while determining overtaking sight
distance in four lane highway?
(A) Distance cover during reaction time
(B) Distance covered during overtaking operation
(C) Reaction distance plus overtaking distance
(D) Distance covered during reaction time plus distance covered by the opposing traffic

67. In prismatic compass
(A) Magnetic needle move with the box
(B) Magnetic needle and graduated circle do not move with the box
(C) Line of sight does not move with the box
(D) Graduated circle is fixed to the box and the magnetic needle always remains in the
N - S direction

Page 242

68. For the purpose of design as per IS 456, deflection of the RC slab or beam is limited to
(A) 0.2 % of span (B) 0.25 % of span
(C) 0.4 % of span (D) 0.45 % of span

69. An angle section can be used as purlin when slope of roof truss is
(A) Between 40 degree to 70 degree (B) Less than 30 degree
(C) Greater than 30 degree (D) Less than 45 degree

70. If a soil sample is having porosity 40 % and degree of saturation 80 % then its %age of
air voids is
(A) 5 (B) 6 (C) 7 (D) 8

71. The _______ arrangement of preventing the slip of earth in the foundation trenches is
adopted when a large area is to be excavated for depth greater than 10 meters.
(A) Sheet piling (B) Runner (C) Box sheeting (D) Stay bracing

72. Which of the following is an indirect method of surveying?
(A) Countouring (B) Chain surveying
(C) Tacheometry (D) All of the mentioned

73. For setting the tangent, which process is most commonly used?
(A) Rankine’s method (B) Trial and error method
(C) Tacheometric method (D) Two theodolite method

74. Which type of bacteria are used in trickling filters?
(A) Facultative (B) Nitrifying (C) Anaerobic (D) Blue-green bacteria

75. Which of the following waste water does not contain sewage?
(A) Sewerage (B) Grey water (C) Sullage (D) Sewage

x-x-x

Page 243

M.E.(Computer Science & Engg.)/M.E. in Computer Science & Engg.(Internet of Things)
1) Which of the following code is NOT valid in BCD code?
(A) 0010 (B) 0101 (C) 1000 (D) 1010
2) Which of the following is a Universal gate?
(A) AND (B) OR (C) NOT (D) NAND
3) The minimum number of NAND gates required to implement a NOT gate is
(A) 1 (B) 2 (C) 3 (D) 4
4) The minimum number of 2-input NAND gates required to realize the
functionality of a half-adder is
(A) 3 (B) 4 (C) 5 (D) 6
5) A logic circuit that accepts several inputs and forwards only one input to the
output is known as
(A) Multiplexer (B) Demultiplexer
(C) Encoder (D) Decoder
6) The J input of a J-K flip-flop is connected to logic 1 and the K input is
connected to the output Q. After a clock pulse, the output Q of the flip-flop
will be
(A) Same as the previous output
(B) Complement of the previous output
(C) 0
(D) 1
7) The number of clock pulses required to shift a byte of data into and out of a
8-stage parallel-in, serial-out shift register is
(A) 1 (B) 4 (C) 8 (D) 12
8) The minimum number of clock pulses required to change the content of 8-bit
Johnson counter from 11000000 to 00000011 is
(A) 2 (B) 3 (C) 4 (D) 5
9) What would be the cost of minimum spanning tree for the following graph?

(A) 21 (B) 22 (C) 23 (D) 24

Page 244

10) The number of spanning trees in a cycle graph with 𝒏 vertices is
(A) n 1 (B) n (C) n (D) 1
2
11) Suppose that the universe 𝑼 has the keys {𝟎 … 𝒏𝟐 − 𝟏}. For a hash table of size
𝒏, what is the greatest number of distinct keys the table can hold with chaining
as the collision resolution strategy?
(A) n (B) n2 1 (C) n2 (D) n2  1
12) The following keys are inserted in a hash table (in the given order) with 7 slots
(indexed from 0 to 6) that using linear probing and hash function
𝒉(𝒌) = 𝒌 𝒎𝒐𝒅 𝟕:
4, 11, 5, 12, 6
In which slot the key value 6 is stored?
(A) 1 (B) 4 (C) 5 (D) 6
13) Which of the following is NOT a stable sorting algorithm?
(A) Insertion Sort (B) Selection Sort
(C) Bubble Sort (D) Mergesort
14) Suppose an array is to be sorted using quick sort. The content of array after
first partitioning looks like this: 3, 6, 2, 8, 10, 13, 12, 11. Which of the following
statement is correct?
(A) The pivot could be either 8 or 10.
(B) The pivot could be the 8, but it is not the 10.
(C) The pivot is not the 8, but it could be the 10.
(D) Neither the 8 nor the 10 is the pivot.

15) Let 𝑮 = (𝑽, 𝑬) be a connected, undirected graph. Let 𝒗𝟏 and 𝒗𝟐 be two distinct
vertices in the graph. Let 𝑷𝟏 be the problem of finding a shortest path between
the vertices 𝒗𝟏 and 𝒗𝟐 , and let 𝑷𝟐 be the problem of finding a longest simple
path between the vertices 𝒗𝟏 and 𝒗𝟐 . Which of the following statements about
𝑷𝟏 and 𝑷𝟐 are TRUE?
(A) Both the problems 𝑃 and 𝑃 can be solved in polynomial time.
(B) 𝑃 is solved in polynomial time and 𝑃 is not known to be solvable in
polynomial time.
(C) 𝑃 is not known to be solvable in polynomial time but 𝑃 can be solved in
polynomial time.
(D) It is not known that whether either 𝑃 or 𝑃 can be solved in polynomial
time.

Page 245

16) Let 𝑷𝟏 be the problem of determining if there exists a Hamiltonian cycle in a
graph, and let 𝑷𝟐 is the problem of finding Hamiltonian cycle in a graph.
Which one the following is TRUE?
(A) Both 𝑃 and 𝑃 are NP-hard
(B) 𝑃 is NP-hard but 𝑃 is not
(C) 𝑃 is NP-hard but 𝑃 is not
(D) Neither 𝑃 nor 𝑃 is NP-hard
17) The finite automaton accepts a language known as
(A) Regular language
(B) Context free language
(C) Context sensitive language
(D) Recursively enumerable language
18) Finite automata accept
(A) Type 0 language (B) Type 1 language
(C) Type 2 language (D) Type 3 language
19) 𝜺 is in the language accepted a DFA if
(A) there is no transition from final state
(B) there is no transition from initial state
(C) if initial state is the final state
(D) if there is more than one final state
20) Which of the following string is in the language represented by the regular
expression (𝟎∗ 𝟏𝟎∗ 𝟏𝟎∗ )∗ ?
(A) 001 (B) 0011101 (C) 1000 (D) 10
21) The regular expression equivalent to the expression 𝜺 + 𝒓𝒓∗ is
(A) 𝑟 (B) 𝜀 (C) 𝜙 (D) 𝑟∗
22) The class of context free languages is NOT closed under
(A) Union (B) Intersection
(C) Reversal (D) Homomorphism
23) The string 𝒂𝒂𝒂𝒂 over the alphabet 𝚺 = {𝒂, 𝒃} can be generated through the
regular expression
i) (𝑎𝑎)∗
ii) (𝑎 + 𝑎𝑏)∗
iii) (𝑎𝑎 + 𝑏𝑎)∗
iv) (𝑎𝑎 + 𝑏)∗
(A) i) only (B) i) and ii) only
(C) i), ii) and iii) only (D) i), ii), iii) and iv)

24) A context free grammar is said to be in Chomsky normal form if productions
has

Page 246

(A) only one terminal on its RHS
(B) only two no-terminals on its RHS
(C) string on non-terminals on its RHS
(D) both (A) and (B)
25) The automaton associated with context-sensitive languages is
(A) Finite automaton (B) Push-down automaton
(C) Linear bounded automaton (D) Turing machine
26) Which object is/are constant in the declaration statement int const* const ptr;?
(A) Ptr
(B) The object pointed to by ptr
(C) Both ptr and the object pointed to by ptr
(D) The given declaration is not valid
27) Consider an implementation of unsorted singly linked list. Suppose it has its
representation with a head and a tail pointer (i.e., pointers to the first and last
nodes of the linked list). Given the representation, which of the following
operations can be implemented in 𝑶(𝟏) time?
I. Insertion at the front of the linked list.
II. Insertion at the end of the linked list.
III. Deletion of front node of the linked list.
IV. Deletion of the last node of the linked list.
(A) I and II (B) I and III
(C) I, II and III (D) I, II and IV
28) What would be the output of the following code, if the language uses static
scoping?
int a=3;
void foo(){ print(a);}
void bar(){int a=5; foo()}
void abc(){int a=7; foo()}
main(){
foo()
bar();
abc();
}
(A) 333 (B) 357
(C) 557 (D) 775
29) The concatenation of two linked lists is to be performed in 𝑶(𝟏) time. Which
of the following variations of the linked lists can be used?
(A) Singly linked list

Page 247

(B) Doubly linked list
(C) Circular doubly linked list
(D) Array implementation of list
30) Which of the following statement(s) about stack data structure is/are NOT
correct?
(A) Stack data structure can be implemented using linked list
(B) New nodes can only be added at the top of the stack
(C) Stack is a First-In-First-Out (FIFO) data structure
(D) The last node at the bottom of the stack has a NULL link
31) The postfix representation of the expression (12-X)*(Y+9)/(Z*4) is
(A) 4 Y * Z 9 + X 12 - * / (B) / 12 X – Y 9 + Z 4 *
(C) 12 – X * Y + 9 / Z * 4 (D) 12 X – Y 9 + * Z 4 * /
32) If MAX_SIZE is the size of the array used in the implementation of circular
queue. How is rear manipulated while inserting an element in the queue?
(A) rear=(rear%1)+MAX_SIZE (B) rear=rear%(MAX_SIZE+1)
(C) rear=(rear+1)%MAX_SIZE (D) rear=rear+(1%MAX_SIZE)
33) Which of the following algorithms solve all-pair shortest path problem?
(A) Dijkstra’s algorithm (B) Floyd-Warshall’s algorithm
(C) Prim’s algorithm (D) Kruksal’s algorithm
34) In a full binary tree every internal node has exactly two or no children. If there
are 100 leaf nodes in the tree, how many internal nodes are there in the tree?
(A) 25 (B) 49 (C) 99 (D) 101
35) Which of the following combinations of traversals can identify a binary tree
uniquely?
(A) In-order and pre-order (B) Pre-order and post-order
(C) Pre-order and level-order (D) Post-order and level-order
36) OS routines and privileged instructions cannot be executed in
(A) Kernel mode (B) Supervisor mode
(C) User mode (D) None of the above
37) The total time spent by a process in ready queue is called
(A) Waiting time (B) Throughput
(C) Turnaround time (D) Burst time
38) Convoy effect in FCFS scheduling is
(A) When a large process does not get CPU
(B) When all other processes have to wait for one large process to release the
CPU
(C) When a small process does not get CPU
(D) None of the above

Page 248

39) In which of the following scheduling algorithm, context switching is NOT
required
(A) First come First Serve scheduling
(B) Shortest Job First Scheduling
(C) RR scheduling
(D) Both (A) and (B)
40) In a deadlock
(A) All processes are in wait state.
(B) All but one are in wait state.
(C) No one in wait state.
(D) Noting can be said about the state of processes.
41) Cycle in resource allocation graph
(A) Represents deadlock if there is only one instance per resource
(B) Represents deadlock if there are multiple instances per resource
(C) Represents deadlock in all cases
(D) None of the above
42) Which of the following is not the necessary condition for a deadlock to occur?
(A) Mutual Exclusion (B) Hold and Wait
(C) Preemption (D) Circular Wait
43) Consider a system having 4 processes and each require 3 units of a resource
R. How many minimum number of resources of R should be there for no
possibility of deadlock.
(A) 3 (B) 6 (C) 8 (D) 9
44) Page table can be located using
(A) PTBR (B) PTLR (C) PTCR (D) PBTR
45) Translation look-aside buffers contains
(A) Full page table
(B) Partial Page table
(C) Direct memory contents
(D) Can be anything as it varies with each operating system

46) The stack of LR parser holds
(A) only terminals
(B) only non-terminals
(C) grammar symbols
(D) grammar symbols as well as states

Page 249

47) A handle of a string is a substring that matches the right side of a production,
and whose reduction to the non-terminal on the left side of the production
represents
(A) one step along the leftmost derivation
(B) one step along the reverse of leftmost derivation
(C) one step along the rightmost derivation
(D) one step along the reverse of rightmost derivation
48) Which of the following is most powerful parser?
(A) SLR parser (B) Canonical LR parser
(C) LALR parser (D) Operator-precedence parser
49) Which of the following statement is true?
(A) SLR parser is more powerful than LALR parser
(B) LALR parser is more powerful than Canonical LR parser
(C) Canonical LR parser is more powerful than LALR parser
(D) The parsers SLR, Canonical LR and LALR have the same power
50) Choose the correct statements:
i. A syntax tree is a condensed form of a parse tree.
ii. In a syntax tree, operators and keywords do not appear as leaves.
iii. In a syntax tree, operands appear as leaves.
(A) only i (B) only ii
(C) ii and iii (D) i, ii and iii
51) The C language uses which form of the type equivalence
(A) Structural equivalence
(B) Name equivalence
(C) Structural equivalence under naming
(D) Declaration equivalence
52) Which of the following data structure in a compiler is responsible for
managing information about variables and their attributes?
(A) parse tree (B) attribute grammar
(C) symbol table (D) semantic stack
53) The symbol table implementation which has minimum access time is
(A) linear list (B) self-organizing list
(C) search tree (D) hash table
54) The storage allocation strategy in which activation record is maintained even
after the execution of a procedure is complete is
(A) Stack allocation (B) Heap allocation
(C) Static allocation (D) Dynamic allocation

Page 250

55) The graph that shows basic blocks and their successor relationship is called
(A) DAG (B) flow graph
(C) control graph (D) dependency graph
56) The “90-10” rule states that
(A) 90% of code is executed in 10% of time
(B) 90% of time is spent in 10% of code
(C) 90% of time is spent in correcting 10% of errors
(D) 90% of errors are corrected in 10% of time
57) Data link layer uses the start and stop bits for
(A) Error Correction (B) Flow Control
(C) Error Detection (D) Synchronization
58) In CSMA, when channel is busy, which of the following statements are true?
I. In non-persistent, system waits for random time and then sense again.
II. In 1-persistent, system never waits and continually senses the channel.
(A) Only I is true (B) Only II is true
(C) Both are false (D) Both are true
59) In CSMA/CD, after detecting the collision, station immediately stops the
transmission by sending the
(A) Stop pattern (B) Preamble pattern
(C) Jam Signal (D) Block Signal
60) What is the range of data carried by IEEE 802.3 MAC frame?
(A) 64-1518 bytes (B) 46-1500 bytes
(C) 46-1518 bytes (D) 64-1500 bytes
61) Which of the following is NOT a valid frame type in IEEE 802.11?
(A) Management frame (B) Control frame
(C) Data frame (D) Access frame
62) Which of the following is NOT a valid IP address?
(A) 192.168.50.10 (B) 172.16.8.4
(C) 10.25.45.16 (D) 192.168.50.08
63) Which class of IP addresses are used for multicasting?
(A) Class E (B) Class B
(C) Class C (D) Class D
64) What is the maximum size of IPv4 data packet?
(A) 232-1 (B) 216-1
(C) 28-1 (D) 232
65) An entity and attribute in ER model is represented respectively as
(A) Diamond box and Ellipse
(B) Rectangle box and Ellipse

Page 251

(C) Ellipse and Rectangle Box
(D) Rectangle Box and Diamond box
66) Which of the following is NOT a valid type of integrity constraints?
(A) Domain constraint (B) Entity Integrity
(C) Referential Integrity (D) Attribute Integrity
67) Which of the following commands are NOT parts of data definition language?
(A) Create (B) Delete
(C) Insert (D) Select
68) SQL is a
(A) Procedural language
(B) Declarative language
(C) Based on Relational Calculus
(D) Both (B) and (C)
69) A primary key and foreign key relationship represents the
(A) One to one relationship between tables that connect them
(B) One to many relationship between tables that connect them
(C) Many to one relationship between tables that connect them
(D) None of the above
70) Choose the correct order of operators in SELECT statement
(A) WHERE, GROUP BY, HAVING
(B) HAVING, GROUP BY, WHERE
(C) WHERE, HAVING, GROUP BY
(D) HAVING, WHERE, GROUP BY
71) Which of the following is NOT a query language?
(A) SQUARE (B) SEQUEL
(C) SQL (D) All are valid query languages
72) Enumeration of different levels of cohesion in increasing order is
(A) Coincidental, temporal, procedural, functional
(B) Coincidental, procedural, temporal, functional
(C) Coincidental, procedural, functional, temporal
(D) Temporal, procedural, functional, coincidental
73) What is the shape used to represent function or processes in DFD?
(A) Ellipses (B) Square
(C) Open rectangle (D) Polygon
74) Which one is not a size measure for software?
(A) Lines of Code
(B) Function Point Count
(C) Cyclomatic Complexity

Page 252

(D) Halstead’s program length
75) The testing technique that requires devising test cases to exercise the internal
logic of a software module is called
(A) Behavioral testing
(B) Black-box testing
(C) Grey-box testing
(D) White-box testing
*-*-*

Page 253

M.E. Electrical Engg. (Instrumentation & Control)

1. At a certain current, the energy stored in iron cored coil is 1000J and its copper loss id 2000W.
The time constant (in seconds) of the coil is
(A) 0.25 (B) 0.5 (C) 1.0 (D) 2.0

2. Two coils in differential connection have self-inductance of 2mH and 4mH and a mutual
inductance of 0.15 mH. The equivalent inductance of the combination is
(A) 5.7 mH (B) 5.85 mH (C) 6 mH (D) 6.15 mH

3. A network contains linear resistors and ideal voltage sources. If values of all the resistors are
doubled, then the voltage across each resistor is
(A) halved (B) doubled
(C) increased by 4 times (D) not changed

4. Two incandescent light bulbs of 40 W and 60 W ratings are connected in series across the
mains. Then
(A) The bulbs together consume 100 W (B) The bulbs together consume 50 W
(C) The 60W bulb glows brighter (D) The 40W bulb glows brighter

5. The maximum value of mutual inductance of two inductively coupled coils with self-
inductance, L1 = 49 mH and L2 = 81 mH is
(A) 130 mH (B) 63 mH (C) 32 mH (D) 3969 mH

6. A battery charger can drive a current of 5A into a 1 ohm resistance connected at its output
terminals. If it is able to charge an ideal 2V battery at 7A rate, then its Thevenin’s equivalent
will be
(A) 7.5 V is in series with 0.5 ohm (B) 12 V is in series with 1.5 ohms
(C) 7.5 V is in parallel with 0.5 ohm (D) 1.25 V is in parallel with 1.5 ohm

7. A ramp voltage v(t) = 100 volts, is applied to and RC differentiating circuit with R= 5 kΩ and C=
4µF. The maximum output voltage is
(A) 0.2 volt (B) 2.0 volts (C) 10.0 volts (D) 50.0 volts

8. Two 2-port networks are connected in cascade. The combination is to be represented as a
single 2-port network. The parameters of the network are obtained by multiplying the
individual
(A) z-parameter matrix (B) h-parameter matrix
(C) y-parameter matrix (D) ABCD-parameter matrix

9. Building steel core out of stampings reduces eddy current loss because it
(A) Increases core resistivity
(B) Increases the effective length of eddy currents paths thereby increasing effective
resistance to the flow of eddy currents
(C) Increases core permeability
(D) Reduces the effective length of eddy current path, thereby reducing effective
resistance to the flow of eddy currents

Page 254

10. Which of the following tests must be performed on a transformer to determine its leakage
reactance?
(A) SC test only (B) OC test only
(C) Both OC and SC tests (D) test by an impedance bridge

11. Power transformers are designed to have maximum efficiency at
(A) Full load (B) 50% load (C) 80% load (D) No load

12. A 20 kVA, 2000/200 V, single-phase transformer has a leakage impedance of 8%. What
voltage applied to the HV side will result in full-load current flow in the LV side, when
the LV side is short-circuited?
(A) 64 V (B) 160 V (C) 86 V (D) 132 V

13. A centrifugal switch is used to dis- connect ‘starting winding when motor has
(A) run for about 1 minute
(B) run for about 5 minutes
(C) picked up about 50 to 70 per cent of rated speed
(D) picked up about 10 to 25 per cent of rated speed

14. A capacitor-start single phase induction motor is switched on to supply with its capacitor
replaced by an inductor of equivalent reactance value. It will
(A) start and then stop (B) start and run slowly
(C) start and run at rated speed (D) not start at all

15. An ideal synchronous motor has no starting torque because the
(A) rotor is made up of salient poles

(B) rotor winding is highly reactive

(C) relative velocity between the stator and rotor mmf is zero

(D) relative velocity between the stator and rotor mmf is not zero

16. The energy stored in the magnetic field of solenoid 30 cm long and 3 cm diameter wound with
1000 turns of wire carrying a current of 10 A is
(A) 0.015 Joule (B) 0.15 Joule (C) 0.5 Joule (D) 1.15 Joule

17. A 120 V shunt generator running at 850 rpm has its armature and shunt field resistance of
0.15 ohm and 50 ohm respectively. It supplies 200 lamps each rated at 60 W, 100 V. The
friction and windage and core loss of the machine is 400 W. Its armature copper loss on full
load and shunt field loss is
(A) 2156.7 W, 200 W (B) 2232.6 W, 200 W
(C) 2156.7 W, 240 W (D) 2232.6 W, 240 W
18. If the armature current of dc series motor has become twice then the torque will become
(A) Twice of the former (B) Four times of the former
(C) One fourth of the former (D) Remains same

Page 255

19. The armature reaction in d.c. machine causes distortion in the main field flux. This effect of
armature reaction can be reduced by
(A) Increasing the length of air gap (B) Decreasing the length of air gap
(C) Increasing the number of poles (D) Decreasing the number of poles

20. Crawling is a phenomenon associated with squirrel cage design in which IM runs at a very slow
speed, this phenomenon occurs due to:
(A) Low voltage
(B) Heavy loads connected to rotor
(C) Bad mechanical design of the machine
(D) Space Harmonics produced by winding currents
21. Why is a centrifugal switch used in a single-phase induction motor?
(A) To protect the motor from overloading
(B) To improve the starting performance of the motor
(C) To cut off the starting winding at an appropriate instant
(D) To cut in the capacitor during running conditions

22. A synchronous motor with negligible armature resistance runs at a load angle of 20° at the
rated frequency. If supply frequency is increased by 10%, keeping other parameters constant,
the new load angle will be
(A) 16° (B) 18° (C) 20° (D) 22°

23. A 50Hz synchronous generator is initially connected to a long lossless transmission line
which is open-circuited at the receiving end. With the field voltage held constant, the
generator is disconnected from the transmission line. Which of the following may be
said about the steady-state terminal voltage and field current of the generator?
(A) Magnitude of terminal voltage decrease but field current remains the same
(B) The magnitude of terminal voltage decrease and field current increase
(C) The magnitude of terminal voltage increase and field current decrease
(D) Both magnitudes of terminal voltage as well as field current remain the same

24. A field excitation of 20 A in certain alternator results in an armature current of 400 A
in a short circuit and a terminal voltage of 2000 V on an open circuit. The magnitude
of the internal voltage drop within the machine at a load current of 200 A is
(A) 1 V (B) 10 V (C) 100 V (D) 1000 V

25. Mobility of an electron in a conductor is expressed in terms of
(A) cm2/V-s (B) cm/V-s (C) cm2/V (D) cm2/s

26. As the temperature is increased, the voltage across a diode carrying a constant current
(A) increases
(B) decreases
(C) remains constant
(D) may increase or decrease depending upon the doping levels in the junction

27. If differential amplifier has a differential gain of 20000. CMRR= 80dB, then common
mode gain is
(A) 2 (B) 1 (C) ½ (D) 0

Page 256

28. Opamp used as a tuned amplifier has the tuned circuit connected
(A) across input (B) across series impedance at the input

(C) across feedback impedance (D) across output

29. If transistors are mounted on a heat sink so that Pcmax changes to 3 watts, what will be
the new value of the maximum power delivered?
(A) 0.1 watt (B) 0.13 watt (C) 1.13 watt (D) 11 watt

30. When we take up design of systems, ideally how do we define the stability of a
system?
(A) A system is stable, if a bounded input gives a bounded output, for some values of
the input
(B) A system is unstable, if a bounded input gives a bounded output, for all values of
the input
(C) A system is stable, if a bounded input gives a bounded output, for all values of the
input
(D) A system is unstable, if a bounded input gives a bounded output, for some values
of the input

31. Discrete time signal is derived from continuous time signal by _____________
process.
(A) Addition (B) Multiplying
(C) Sampling (D) Addition and multiplication

32. Find the function f(t) for the following function F(s):
1
F ( s) 
ss  1s  5
(A) 0.25e-t+0.05e-5t (B) -0.2-0.25e-t+0.05e-5t
(C) -0.2+0.25e-t+0.05e-5t (D) 0.25e-5t+0.05e-t

33. Determine the transfer function of the given system:

(A) G1G2G3/ (1 + H2G2G3 + G2G1H1)
(B) G1G2G3/ (1 + G1G2G3H2H1)
(C) G1G2G3 / (1 + G1G2G3H1 + G1G2G3H2)
(D) G1G2G3 / (1 + G1G2G3H1)

Page 257

34. If s^3 + Ks^2 + 5s + 10 = 0, the root of the feedback system's characteristic equation is
said to be critically stable. Then, the value of K will be:
(A) 1 (B) 2 (C) 3 (D) 4

35. For the given closed-loop system, the ranges of the values of K for stability is:

(A) K > -19.5 (B)-k > 8 (C)-19.5 < k < 8 (D) K > 0

36. Which of the following statements are correct?
1. Bode plot is in the frequency domain.
2. Root locus is in the time domain.
3. Nyquist criteria are in the frequency domain.
4. Routh Hurwitz's criteria are in the time domain.
(A) 1 and 2 (B) 1 and 3 (C) 1, 3, and 4 (D) 2 and 3

37. What will be the controller output for PD controller at t = 2s, if the error begins to
change from 0 at the rate of 1.2% /s? The given parameters are Po = 50%, Kp = 4, and
KD = 0.4.
(A) 61.52% (B) 61.92% (C) 51.52% (D) 51.92%

38. Find the phase shift provided by the lead compensator for a given transfer function
G(s) = (1 + 6s)/ (1 + 2s)
(A) 15 degrees (B) 30 degrees (C) 45 degrees (D) 60 degrees

39. In an 8085 microprocessor, the number of address lines required to access a 16K byte memory
bank is ______.
(A) 12 (B) 14 (C) 8 (D) 16

40. The 8051 microcontroller is of ___ pin package as a ______ processor.
(A) 30, 1 byte (B) 20, 1 byte (C) 40, 8 bit (D) 40, 8 byte

41. An alternator has a phase sequence of RYB for its phase voltage. In case the direction of
rotation of alternator is reversed, the phase sequence will become
(A) YRB (B) YBR (C) RYB (D) RBY

Page 258

42. If the positive, negative, and zero-sequence reactance of an element of a power system
is 0.3, 0.3, and 0.8 p.u. respectively, then the element would be a?
(A) Transmission line (B) Synchronous generator
(C) Synchronous motor (D) Static load

43. A 100 km long transmission line is loaded at 110 kV. If the loss of line is 5 MW and
the load is 150 MVA, the resistance of the line is
(A) 8.06 ohms per phase (B) 0.806 ohms per phase
(C) 0.0806 ohms per phase (D) 80.6 ohms per phase

44. A 100 km transmission line is designed for a nominal voltage of 132 kV and consists
of one conductor per phase. The line reactance is 0.726 W/km. The static transmission
capacity, in megawatts, would be:
(A) 145 (B) 360 (C) 240 (D) 140

45. The insulation resistance of a cable of length 20 km is 2 MΩ. What will be the insulation
resistance of the same cable but for a length of 200 km?
(A) 12 MΩ (B) 20 MΩ (C) 0.2 MΩ (D) 40 MΩ

46. The conductors of 1.6 km long, 3-phase, 3.3 kV overhead lines are in horizontal
formation with 762 mm between centres. The effective diameter of the conductors is
3.5 mm. The equivalent spacing (in mm) is
(A) 360 (B) 400 (C) 780 (D) 960

47. Which of the following is not a characteristic of an ideal transducer?
(A) High dynamic range (B) Low linearity
(C) High repeatability (D) Low noise

48. Given input out characteristic of a typical system, name the region marked as ‘a’.

(A) Dead zone (B) Range (C) Drift region (D) Threshold
49. IPTS stands for ________________
(A) International Practical Temperature Scale

Page 259

(B) Indian Primary Temperature Scale
(C) International Primary Temperature Scale
(D) International Practical Temperature Standard

50. Which of the following applications are suited for thin plate diaphragms?
(A) Static pressure only
(B) Dynamic pressure only
(C) Both static and dynamic pressure with large frequency
(D) Both static and dynamic pressure with small frequency
51. ________ are capable of providing a visual comparison between a calibrated light source and
the targeted object’s surface
(A) Optical pyrometers (B) Non Optical pyrometers
(C) Temperature pyrometer (D) None of the above

52. Which of the following represents obstruction type flow measuring systems?
(A) Centrifugal force type (B) Rotating vane system
(C) Flow nozzle device (D) None of the mentioned

53. Which of the following statements is not necessarily correct for open control system?
(A) Input command is the sole factor responsible for providing the control action

(B) Presence of non-linearities causes malfunctioning

(C) Less expensive

(D) Generally free from problems of non-linearities

54. If the doping levels of the semiconductor is increased, then the width of the depletion layer
(A) increases (B) decreases (C) is unchanged (D) keeps oscillating

55. In a power transistor, the IB vs VBE curve is
(A) a parabolic curve (B) an exponentially decaying curve
(C) resembling the diode curve (D) a straight line Y = IB

56. A power BJT is used as a power control switch by biasing it in the cut off region (off
state) or in the saturation region (on state). In the on state

(A) both the base-emitter & base-collector junctions are forward biased
(B) the base-emitter junction is reverse biased, and the base collector junction is
forward biased
(C) the base-emitter junction is forward biased, and the base collector junction is
reversed biased
(D) both the base-collector & the base-emitter junctions are reversed biased

57. A GTO can be represented by two transistors T1 & T2. The current gain of both
transistors are α1 and α2 respectively. A low value of gate current requires
(A) low value of α1 and α2 (B) low value of α1 and high value of α2
(C) high value of α1 and low value of α2 (D) high values of α1 and α2

Page 260

58. A step-down delta-star transformer, with per-phase turns ratio of 5 is fed from a 3-phase
1100 V, 50 Hz source. The secondary of this transformer is connected through a 3-pulse
type rectifier, which is feeding feeding an R load. Find the average value of output
voltage.
(A) 220 V (B) 257 V (C) 1100/√3 V (D) 206 V

59. A 3-phase bridge rectifier charges a 240 V battery. The rectifier is given a 3-phase, 230
V supply. The current limiting resistance in series with the battery is of 8 Ω.
Find the average value of battery charging current.
(A) 12.56 A (B) 8.82 A (C) 9.69 A (D) 6.54 A

60. Which of the following motors is preferred when quick speed reversal is the main
consideration ?
(A) Squirrel cage induction motor (B) Wound rotor induction motor
(C) Synchronous motor (D) D.C. motor

61. For a D.C. shunt motor which of the following is incorrect?
(A) Unsuitable for heavy duty starting (B) Torque varies as armature current
(C) Armature current is a straight line (D) Torque is zero for zero armature
current

62. Diesel electric traction has comparatively limited overload capacity because
(A) diesel engine is a constant output prime mover
(B) diesel engine has shorter life span
(C) regenerative braking cannot be employed
(D) diesel-electric locomotive is heavier than an ordinary electric locomotive

63. An instrument in which the value of ethnical quantity to be measured can be determined
from the deflection of the instrument when it has been precalibrated by comparison
with an absolute instrument is
(A) Absolute instrument (B) Secondary instrument
(C) Recording instrument (D) Integrating instrument

64. A resistance of 75 Ohms is connected in shunt of a galvanometer, having an internal
resistance of 25 Ohms, to convert it into an ammeter. What is the value of current (in
A) flowing through the galvanometer, if the total current in the circuit is 5 A?
(A) 2 (B) 2.5 (C) 3.65 (D) 3.75

65. A moving coil milliammeter having a resistance of 10 ohms gives full-scale deflection when a
current of 5 mA is passed through it. If the instrument is to be used to measure current upto
1 A.
(A) resistance of 0.502 Ω must be connected in series with the instrument

(B) resistance of 0.502 Ω must be connected in parallel to the load

(C) resistance of 0.502 Ω must be connected parallel with the resistance of the ammeter

(D) resistance 0.50 Ω must be connected in series with the load

Page 261

66. When the damping of an instrument is adjusted to enable the pointer to rise quickly to
its deflected position without overshooting in that case the instrument is said to be
(A) Dead beat (B) Off-Beat (C) Over damped (D) Under damped

67. A moving coil galvanometer has a resistance of 4 ohms and gives full-scale deflection
when carrying 30 milliamperes. The instruments can be used to measure 150 volts by
connecting in sereis with the instrument a resistance of
(A) 9996 ohms (B) 4996 ohms (C) 5000 ohms (D) 5004 ohms

68. A 15-volt moving iron voltmeter has a resistance of 300 ohms and an inductance of
0.12 Henry. The instrument reads correctly on DC and on AC at 36 Hz when it shows
a voltage of 14.75 V. What will its reading for the same voltage at 100 Hz?
(A) 14.5 V (B) 15.4 V (C) 14.85 V (D) 15 V

69. A moving coil instrument gives full deflection with 15 mA. The instrument has the
resistance of 5 ohms. If a resistance of 0.80 ohms is connected in parallel with the
instrument, the instrument will be capable of reading upto
(A) 150 mA (B) 1087 mA (C) 750 mA (D) 600 mA

70. For the measure of voltage and current in the ratio frequency range, a suitable instrument is
(A) Electrothermic type (B) Moving iron type

(C) Moving coil type (D) Electrostatic type

71. The braking torque of induction type single-phase energy meter is
(A) Directly proportional to the square of the flux
(B) Directly proportional to the flux
(C) Inversely proportional to the flux
(D) Inversely proportional to the square of the flux

72. A 220 V single phase meter has a constant load current of 5.0 A passing through it for
2 hours, at unity power factor. If the meter disc makes 1056 revolution during this
period. What is the meter constant in revolutions/kWh?
(A) 120 (B) 240 (C) 360 (D) 480

73. The reading on the ammeters connected for the three ammeter method of power
measurement is 2.0 A, 4 A and 6 A in the non-inductive resistor, the load and the main
respectively. The terminal voltage is 300V. The non-inductive resistance of the load is
(A) 50 ohms (B) 25 ohms (C) 150 ohms (D) 75 ohms

74. In an energy meter, the steady speed of disc can be achieved when
(A) Operating torque is equal to or less than half the braking torque
(B) Braking torque is zero
(C) Operating torque is equal to the braking torque
(D) Braking torque is more than operating the torque

Page 262

75. Holes are drilled on the opposite sides of the spindles of an energy meter to
(A) Avoid creep on load
(B) Balance the disc
(C) Dissipate heat generated due to eddy currents
(D) Increases the deflection torque

x-x-x

Page 263

M.E. Electrical Engg. (Power System)
1. In a series RLC high Q circuit, the current peaks at a frequency
(A) Equal to resonant frequency
(B) Greater than the resonant frequency
(C) Less than the resonant frequency
(D) No relation with resonant frequency

2. For a two port network to be reciprocal,
(A) Z11=Z22 (B) Y21=Y12
(C) h21=h12 (D) AD-BC=0

3. A network has seven nodes and five independent loops. The number of branches in the
network is
(A) 13 (B) 12 (C) 11 (D) 10

4. If each branch of a delta circuit has impedance √3Z, then each branch of the equivalent
wave circuit has impedance
(A) Z/√3 (B) 3Z (C) 3√3Z (D) Z/3

5. The value of R in ohms required for maximum power transfer in the network shown in
figure is

(A) 2 (B) 4 (C) 8 (D) 16

6. In the circuit of figure the energy absorbed by 4 ohm resistor in the time interval (0, ∞)
is

(A) 36 Joules (B) 16 Joules (C) 256 Joules (D) 94 Joules

7. Two coils having equal resistance but different inductances are connected in series. The
time constant of the series combination is
(A) Sum of the time constants of individual coils
(B) Average of the time constant of the individual coils
(C) Geometric mean of the time-constants of the individual coils
(D) Product of the time constants of the individual coils

Page 264

8. A practical current source is usually represented by
(A) A resistance in series with an ideal current source
(B) A resistance in parallel with an ideal current source
(C) A resistance in parallel with an ideal voltage source
(D) A resistance in series with an ideal voltage source
9. In a uniform electric field, field lines and equipotentials are
(A) Parallel to one another (B) Intersect at 45°
(C) Intersect at 30° (D) Are orthogonal
10. Two incandescent light bulbs of 40 W and 60 W rating are connected in series across
the mains. Then
(A) The bulbs together consume 100 W
(B) The bulbs together consume 50 W
(C) The 60 W bulb glows brighter
(D) The 40 W bulb glows brighter
11. A cylindrical rotor synchronous motor is switched on the supply with its field windings
shorted on them. It will
(A) Not start
(B) Start but not run at synchronous speed
(C) Start as an induction motor and then run as synchronous motor
(D) Start and run as synchronous motor
12. Auto transformer is used in transmission and distribution
(A) When operator is not available
(B) When iron losses are to be reduced
(C) When efficiency considerations can be reduced
(D) When the transformation ratio is small
13. The torque speed characteristics of a repulsion motor resembles which of the following
DC motor characteristics
(A) Separately excited (B) Shunt
(C) Series (D) Compound
14. In case of a split phase motor, the phase shift between currents in the two windings is
around
(A) 20 degrees (B) 70 degrees (C) 90 degrees (D) 120 degrees
15. In an induction motor if the air gap is increased
(A) Speed will reduce (B) Efficiency will improve
(C) Power factor will be lowered (D) Breakdown torque will reduce
16. The magnetizing current in a transformer is rich in
(A) 3rd harmonic (B) 5th harmonic
th
(C) 7 harmonic (D) 13th harmonic
17. Ratio of the rotor reactance X to the rotor resistance R for a two-phase servomotor
(A) Is equal to that of a normal induction motor
(B) Is less than that of a normal induction motor
(C) Is greater than that of a normal induction motor
(D) May be less or greater than that of a normal induction motor
18. A rotating electric machine having its self inductances of both the stator and rotor
winding, independent of rotor position will be definitely not develop
(A) Starting torque (B) Synchronizing torque
(C) Hysteresis torque (D) Reluctance torque
(2)

Page 265

19. In the protection of transformers harmonic restraint is used to guard against
(A) Magnetizing inrush current (B) Unbalance operation
(C) Lightning (D) Switching over-voltage

20. A 75 MVA, 10 kV synchronous generator has X d=0.4pu. the Xd value to a base of
100MVA, 11 kV is
(A) 0.578 (B) 0.279 (C) 0.412 (D) 0.44

21. The insulation level of a 400kV EHV overhead transmission line is decided on the base
of
(A) Lightning over-voltage (B) Switching over-voltage
(C) Corona inception voltage (D) Radio and TV interference

22. A water boiler at home is switched on to the Ac mains supplying power at 230 V, 50
Hz. The frequency of instantaneous power consumed by the boiler is
(A) 0 Hz (B) 50 Hz (C) 100 Hz (D) 150 Hz

23. W1 and W2 are the readings of two wattmeters used to measure power of a three phase
balanced load. The reactive power drawn by the load is
(A) W1+W2 (B) W1-W2 (C) √3(W1-W2) (D) √3 (W1+W2)

24. In a thyristor, the forward breakover voltage
(A) is constant
(B) may be constant or may depend on gate current
(C) decreases as gate current is increased
(D) Increases as gate current is increased

25. Bundled conductors are mainly used in High voltage overhead transmission lines to
(A) reduce transmission line losses (B) increase mechanical strength of the
line
(C) reduce corona (D) reduce sag

26. A negative sequence relay is commonly used to protect
(A) an alternator (B) a transformer
(C) a transmission line (D) a bus bar

27. For a 500 Hz frequency excitation, a 50 km short power line will be modeled as
(A) Short line (B) Medium line
(C) Long line (D) Data insufficient

28. A thyristor circuit is feeding an RL load. The turn on time can be reduced by
(A) decreasing R (B) decreasing L
(C) Increasing L (D) decreasing R and L together

29. Interpoles are provided in dc machines to
(A) neutralize the cross magnetizing component of armature reaction
(B) neutralize the demagnetizing component of armature reaction
(C) reduce iron loss
(D) reduce copper loss

Page 266

30. Three equal resistances are connected in star. If this star is converted into equivalent
delta, then
(A) the resistance of the delta network will be smaller than that of the star network
(B) the resistance of both the network will be equal
(C) the resistance of the delta network will be larger than that of the star network
(D) data insufficient to calculate resistance

31. A 4-pole, separately excited, wave wound DC machine with negligible armature
resistance is rated for 230 V and 5 kW at a speed of 1200 rpm. If the same armature
coils are reconnected to form a lap winding, what is the rated voltage (in volts) and
power (in kW), respectively at 1200 rpm of the reconnected machine if the field circuit
is left unchanged?
(A) 230 and 5 (B) 115 and 5
(C) 115 and 2.5 (D) 230 and 2.5

32. A three-phase balanced load which has a power factor of 0.707 is connected to a
balanced supply. The power consumed by the load is 5 kW. The power is measured by
the two-wattmeter method. The readings of the two wattmeters are
(A) 3.94 kW and 1.06 kW (B) 2.50 kW and 2.50 kW
(C) 5.00 kW and 0.00 kW (D) 2.96 kW and 2.04 kW

33. When a bipolar junction transistor is operating in the saturation mode, which one of the
following statements is TRUE about the state of its collector-base (CB) and the base-
emitter (BE) junctions?
(A) The CB junction is forward biased and the BE junction is reverse biased
(B) The CB junction is reverse biased and the BE junction is forward biased
(C) Both the CB and BE junctions are forward biased
(D) Both the CB and BE junctions are reverse biased
34. For an unbalanced fault, with paths zero sequence currents, at the point of fault
(A) The negative and zero sequence voltage are minimum
(B) The negative and zero sequence voltage are maximum
(C) The negative sequence voltage is minimum and zero sequence voltage is
maximum
(D) The negative sequence voltage is maximum and zero sequence voltage is
minimum

35. If the fault current is 2000A, the relay setting is 50% and CT ratio is 400:5, the plug
setting pliers will be
(A) 25 A (B) 1 A (C) 50 A (D) 10 A

36. Gauss-Seidel iterative method can be used of solving a set of
(A) Linear differential equations only
(B) Linear algebraic equations only
(C) Both linear and non-linear differential equations
(D) Both linear and non-linear algebraic equations

37. For a fault at the terminals of the synchronous generator, the fault current is maximum
for a
(A) 3-phase fault (B) 3-phase to ground fault
(C) Line- to ground fault (D) Line-to line fault

Page 267

38. Reactance relay is normally preferred for protection against
(A) Earth faults (B) Phase faults
(C) Open circuit faults (D) Short circuit faults

39. The use of high speed circuit breakers
(A) Reduces the short circuit current (B) Improves system stability
(C) Decreases system stability (D) Increases the short circuit current

40. If the length of the wire of resistance R is uniformly stretched to n times its original
value, its new resistance will be
(A) nR (B) R/n (C) n2R (D) R/n2

41. The most useful ac bridge for comparing capacitances of two air capacitors is .........
bridge.
(A) Schering (B) De Sauty (C) Wien series (D) Wien parallel

42. Heaviside-Campbell Equal Ratio bridge is used for measuring
(A) self-inductance in terms of mutual inductance
(B) capacitance in terms of inductance
(C) dielectric loss of an imperfect capacitor
(D) phase angle of a coil

43. In a balanced Wheatstone bridge, if the position of detector and source are interchanged,
the bridge will still remain balanced. This reference can be drawn from
(A) Duality Theorem (B) Compensation Theorem
(C) Reciprocity Theorem (D) Equivalnce Theorem

44. Which bridge is used to determine frequency :
(A) Wheatstone bridge (B) Maxwell bridge
(C) Anderson bridge (D) Wien bridge

45. The advantage of Anderson’s bridge over Maxwell's bridge is that
(A) reduces cost
(B) balance equation independent of frequency
(C) attaining balance condition is easier
(D) measures high Q inductors

46. The primary mmf is least affected by the secondary terminal conditions in a
(A) power transformer (B) potential transformer
(C) current transformer (D) distribution transformer

47. Base load power plants are-
P- Wind farms,
Q- Run-of-river plants,
R- Nuclear power plants,
S- Diesel power plants
(A) P, Q and S only (B) P, R and S only
(C) P, Q and R only (D) Q and R only

Page 268

48. Of the four characteristics given below, which are the major requirements for an
instrumentation amplifier?
P. High common mode rejection ratio
Q. High input impedance
R. High linearity
S. High output impedance
(A) P, Q and R only (B) P and R only
(C) P, Q and S only (D) Q, R and S only

49. A differentiable non-constant even function x(t) has a derivative y(t), and their
respective Fourier transforms are X(ꞷ) and Y(ꞷ). Which of the following statements is
TRUE?
(A) X(ꞷ) and Y(ꞷ) are both real
(B) X(ꞷ) is real and Y(ꞷ) is imaginary
(C) X(ꞷ) and Y(ꞷ) are both imaginary
(D) X(ꞷ) is imaginary and Y(ꞷ) is real

50. A non-ideal voltage source Vs has an internal impedance of Zs. If a purely resistive
load is to be chosen that maximizes the power transferred to the load, its value must be
(A) 0 (B) real part of Zs
(C) magnitude of Zs (D) complex conjugate of Z

51. In an oscilloscope screen, linear sweep is applied at the
(A) vertical axis (B) horizontal axis
(C) origin (D) both horizontal and vertical axis

52. A cascade of three identical modulo-5 counters has an overall modulus of
(A) 5 (B) 25 (C) 125 (D) 62

53. In the formation of Routh—Hurwitz array for a polynomial, all the elements of a row
have zero values. This premature termination of the array indicates the presence of
(A) only one root at the origin (B) imaginary roots
(C) only positive real roots (D) only negative real roots

54. The undesirable property of an electrical insulating material is
(A) high dielectric strength (B) high relative permittivity
(C) high thermal conductivity (D) high insulation resistivity

55. A 220 V, 20 A, 1000 rpm, separately excited DC motor has an armature resistance of
2.5 Ω. The motor is controlled by a step down chopper with a frequency of 1 kHz. The
input DC voltage to the chopper is 250 V. The duty cycle of the chopper for the motor
to operate at a speed of 600 rpm delivering the rated torque will be
(A) 0.518 (B) 0.608 (C) 0.852 (D) 0.902

56. A single-phase fully-controlled bridge converter supplies a load drawing constant and
ripple free load current. If triggering angle is 30°, then input power factor will be
(A) 0.65 (B) 0.78 (C) 0.85 (D) 0.866

Page 269

57. A three-phase, 440 V, 50 Hz AC mains fed Thyristor Bridge is feeding a 440 V DC,
15kW. 1500 rpm separately excited DC motor with a ripple free continuous current in
the DC link under all operating conditions. Neglecting the losses, the power factor of
the AC mains at half the rated speed, is
(A) 0.354 (B) 0.372 (C) 0.90 (D) 0.955

58. A voltage source inverter is used to control the speed of a three-phase, 50 Hz, squirrel
cage induction motor. Its slip for rated torque is 4%. The flux is maintained at rated
value. If the stator resistance and rotational losses are neglected, then the frequency of
the impressed voltage to obtain twice the rated torque at starting should be
(A) 10 Hz (B) 5 Hz (C) 4 Hz (D) 2 Hz

59. A three-phase, fully controlled thyristor bridge converter is used as line commutated
inverter to feed 50 kW power at 420 V DC to a three-phase, 415 V(line), 50 Hz AC
mains. Consider DC link current to be constant. The rms current of the thyristor is
(A) 119.05 A (B) 79.37 A (C) 68.73 A (D) 39.68 A

60. Twelve 4 Ω resistances are used as edges to form a cube. Resistance between two
diagonally opposite corners of cube is
(A) 20/6 Ω (B) 20/3 Ω (C) 40/6 Ω (D) 40/3 Ω

61. An ideal current source should have
(A) Zero internal resistance (B) Infinite internal resistance
(C) Large value of emf (D) Finite internal resistance

62. The three resistors each of R ohm are connected in star. When they are formed into
delta connections the resistance of each arm will be
(A) 2R ohms (B) 3R ohms (C) 4R ohms (D) R/2 ohm

63. In an LC circuit, at resonance the
(A) Impedance is maximum (B) Voltage across C is minimum
(C) Current is maximum (D) Current is minimum

64. The power dissipated in the pure capacitance of an RC series circuit will be
(A) Zero
(B) Small
(C) Higher than dissipated in resistance
(D) Equal to dissipated in resistance

65. For the same rating, the size of three phase machine to that of single phase machine
will be
(A) More (B) Less
(C) Same (D) Independent of phases

66. Wattmeter is an instrument which measures
(A) Instantaneous Power (B) Average real Power
(C) Apparent Power (D) Reactive Power

Page 270

67. In the dc machine , iron losses occur in
(A) The yoke (B) The pole shoe
(C) The armature (D) The field

68. The horse power obtained from the shaft torque is called
(A) Brake horse power (B.H.P.) (B) Indicated horse power (I.H.P.)
(C) Fractional Horse Power (F.H.P.) (D) Real Horse Power (R.H.P.)

69. A 3 V DC supply with an internal resistance of 2 Ω supplies a passive non-linear -
resistance characterised by the relation VNL = I 2 NL. The power dissipated in the non-
linear resistance is
(A) 1.0 W (B) 1.5 W (C) 2.5 W (D) 3.0 W

70. A capacitor consists of two metal plates each 500 × 500 mm2 and spaced 6 mm apart.
The space between the metal plates is filled with a glass plate of 4 mm thickness and a
layer of paper of 2 mm thickness. The relative permittivities of the glass and paper are
8 and 2, respectively. Neglecting the fringing effect, the capacitance will be
(Given that e0 = 8.85 × 10-12 F/m)
(A) 983.33 pF (B) 1475 pF (C) 6637.5 pF (D) 9956.25 pF

71. The capacitor charged up to 5 ms, as per the current profile given in the figure, is
connected across an inductor of 0.6 mE. Then value of voltage across the capacitor after
1 ms will approximately be 18.8 V
(A) 23.5 V (B) -23.5 V (C) -30.6 V (D) 30.6

72. A low-pass filter with a cut-off frequency of 30 Hz is cascaded with a high-pass filter
with a cut-off frequency of 20 Hz. The resultant system of filters will function as
(A) an all-pass filter (B) an all-stop filter
(C) a band stop (band-reject) filter (D) a band-pass filter

73. An extra high voltage transmission line of length 300 km can be approximated by a
lossless line having propagation constant. Then percentage ratio of line length to
wavelength will be given by
(A) 24.24% (B) 12.12% (C) 19.05% (D) 6.06%

74. A lossless transmission line having surge impedance loading (SIL) of 2280 MW is
provided with a uniformly distributed series capacitive compensation of 30%. Then,
SIL of the compensated transmission line will be
(A) 1835 MW (B) 2280 MW (C) 2725 MW (D) 3257 MW

75. For enhancing the power transmission in a long EHV transmission line, the most
preferred method is to connect a
(A) series inductive compensator in the line
(B) shunt inductive compensator at the receiving end
(C) series capacitive compensator in the line
(D) shunt capacitive compensator at the sending end

x-x-x

Page 271

M.E. (Food Technology)
1. Cider is fermented by
(A) Apple (B) Banana (C) Orange (D) Cherries

2. Alcohol content in beer is (by weight)
(A) 3-4% (B) 5-12% (C) 20-23% (D) 35-38%

3. Which vitamin is the example of sugar acids
(A) Vitamin A (B) Vitamin C (C) Vitamin D (D) Vitamin E

4. Lactose is
(A) Monosaccharide (B) Disaccharides
(C) Oligosaccharide (D) Polysaccharide

5. Which of the following is the primary refrigerant?
(A) NaCl (B) CaCl2 (C) Water (D) Ammonia

6. Which law is the basis for refrigeration cycle?
(A) First law of thermodynamics (B) Second law of thermodynamics
(C) Newtons first law of motion (D) Newton’s second law of motion

7. 1BTU is approximately equal to
(A) 1 J (B) 1 KJ (C) 1 Calorie (D) 1 Kilocalorie

8. FPO stands for
(A) Fruit protection operation (B) Fruit product order
(C) Flavour production office (D) Fruit procurement order

9. Defence food laboratory is located in
(A) Mumbai (B) Madurai (C) Mysore (D) Murshidabad

10. Most abundant material present in egg shell is
(A) Iron (B) Magnesium (C) Zinc (D) Calcium

11. The protein portion of the myoglobin is called
(A) Heme (B) Globin
(C) Flavone (D) Myoglobin does not contain any portion

12. Most of the world’s rice is grown in which country of the world
(A) China (B) USA (C) Brazil (D) Indonesia

13. Corn gluten is rich in the corn protein known as
(A) Zein (B) Glutenin (C) Glutelin (D) Prolamin

14. In dough system the flour to water ratio is about
(A) 1: 1.8 (B) 1: 1.2 (C) 1: 0.6 (D) 1: 0.3

15. Whole wheat flour is also known as
(A) Perfect flour (B) Straight flour (C) Graham flour (D) Complete flour

Page 272

16. Velocity of drag flow in an extruder is directly proportional to
(A) Motor power (B) Input energy (C) Screw speed (D) Length of screw

17. What should be the TSS of a tomato sauce?
(A) 15% (B) 20% (C) 10% (D) 5%

18. For the preparation of good quality potato chips, potatoes are stored at
(A) Below 0 0C (B) Below 5 0C (C) Below 8 0C (D) Above 10 0C

19. SWAMA stands for
(A) Standards of weight and measure act (B) Switzerland Weight and Measure Act
(C) Sweden Weight and Measure Act (D) Survey Weight and Measure Act

20. ‘MR’ types of cans are used for
(A) Mild acidic foods (B) Highly acidic foods
(C) Low acid food (D) Non acidic foods

21. Which of the following is excellent oxygen barrier?
(A) Polyethylene (B) Ethylene vinyl alcohol
(C) Polyvinyl alcohol (D) Propylene

22. At what HLB value do we expect oil in water emulsion?
(A) 0-2 (B) 3-10 (C) 6-12 (D) 8 – 18

23. Noodles originated in
(A) China (B) Japan (C) Korea (D) Taiwan

24. A shaping operation in which the a material is pressurized by some means to force it
through a die is
(A) Fermentation (B) Extrusion (C) Winterizing (D) Tempering

25. Puffed products are dried to less than ________ moisture content
(A) 12% (B) 8% (C) 4% (D) 16%

26. Number of carbon atoms present in stearic acid is
(A) 12 (B) 16 (C) 18 (D) 20

27. Final product of rancidity is
(A) Oxides (B) Peroxides (C) Hydroperoxides (D) Carbon dioxide
28. Colorant used in butter is
(A) Annato (B) Erythrosine (C) Congo red (D) Bixin

29. Blue cheese is also known as
(A) Roquefort cheese (B) Cottage cheese
(C) Camembert cheese (D) Soft cheese

30. For the formation of water in oil emulsion the HLB value of emulsifier must be
(A) 3-6 (B) 5-9 (C) 10-14 (D) 12 -18
31. pH of saliva is
(A) 2.6 (B) 5.6 (C) 9.2 (D) 6.8

Page 273

32. Green rot in the egg is due to
(A) Pseudomonas flurescens (B) Serratia marcescens
(C) Cladosporium (D) Aspergillus niger

33. Consumer Protection Act was passed in the year of
(A) 1946 (B) 1966 (C) 1977 (D) 1986

34. Sarcina sickness is the defect of
(A) Wine (B) Sauerkraut (C) Beer (D) Bread

35. Which microorganism is used in beer making
(A) Yeast (B) Bacteria (C) Mold (D) Protozoa

36. The technique used to amplify DNA in in-vitro is
(A) PSR (B) TCR (C) PCER (D) PCR

37. Which of the following is not used as filler in paper
(A) Aluminium silicate (B) Calcium sulphate
(C) Magnesium silicate (D) Magnesium sulphate

38. What is WVTR and OTR?
(A) Water to vapor transient rate/odor transfer rate
(B) Water to vapor transfer rate/ Oxygen testing result
(C) Water to vapor total ratio/ Odor testing result
(D) Water vapor transfer rate / oxygen transfer rate

39. The bacteria present during maturation of nector to honey
(A) Glucanobacter (B) Aspergillus (C) Penicillum (D) Bacillus panis

40. pH of honey is
(A) 2.3-2.9 (B) 3.4 – 6.1 (C) 6.3- 6.9 (D) 7.0 – 8.0

41. Who explained the structure of protein?
(A) Emil Fischer (B) Pauling and Corey
(C) R. F. Rose (D) Johnson and Cristae

42. The peptide bond has
(A) Planar structure (B) Angular structure
(C) Tetrahedral structure (D) Pyramidal structure

43. Starch gel is
(A) Pseudoplastic (B) Plastic (C) Elastic (D) Thixotropic

44. The number of rotations per residue in alpha helical structure of protein is
(A) 3.0 (B) 3.2 (C) 3.4 (D) 3.6

45. Oil of wintergreen is
(A) Methyl salicylate (B) Methyl salicaldihyde
(C) Ethyl salicylate (D) Ethyl salicaldihyde

Page 274

46. Citral is obtained from
(A) Peppermint (B) Lemongrass oil (C) papaya (D) Mango

47. Monoterpenes and Sesquiterpenes have
(A) 10 and 15 carbon atoms respectively
(B) 5 and 10 carbon atoms respectively
(C) 10 and 20 carbon atoms respectively
(D) 15 and 5 carbon atoms respectively

48. For packaging of bread the packaging material should have
(A) High WVTR (B) Low WVTR
(C) Aluminium coating (D) White surface

49. BOPP stands for
(A) Biaxially Oriented Polypropylene
(B) Biodegradable Oxidised Polypropylene
(C) Biodegradable and Oriented Polypropylene
(D) Binomial oxidized polypropylene

50. Sucrose shows which color with Iodine reagent
(A) Red (B) Pink (C) Purple (D) Blue

51. Kjeldahl method is for the estimation of
(A) Crude fibre (B) Crude fat (C) Crude protein (D) Vitamins

52. In gas chromatography the area under a graph shows the
(A) Type of compound present in the sample
(B) Concentration of the substance present in the sample
(C) Elution time
(D) Cost of estimation of unit sample

53. Smoking is done
(A) After slaughtering (B) Before curing
(C) After curing (D) At any time

54. The collagen on heating in the presence of moisturte dissolves and yiels
(A) Alginate (B) Gelatin (C) Pectin (D) Casein

55. Which one is a constituent of coenzyme
(A) Lipase (B) Sucrase (C) B2 (D) Ascorbic acid

56. Hexokinase is inhibited by
(A) ATP (B) GTP
(C) Glucose -6- phosphate (D) Pyruvate

57. Canning is also sometimes known as
(A) Appertization (B) Pasteurization (C) Sterilization (D) Cold Sterlization

58. Protein content of beef is nearly
(A) 10% (B) 20% (C) 30% (D) 40%

Page 275

59. Which crop is responsible for ergotism
(A) Rice (B) Wheat (C) Barley (D) Rye

60. Storage of food under reduced pressure is called
(A) Aseptic packaging (B) Hyperbaric storage
(C) Hypobaric storage (D) Gas packaging

61. Moisture content of banana is nearly
(A) 10% (B) 40% (C) 80% (D) 95%

62. Which of the following product should have 9% TSS?
(A) Jam (B) Tomato paste (C) Tomato ketchup (D) Fruit drinks

63. Lecithin is used as
(A) Stabilizer (B) Emulsifier (C) Leavening agent (D) Preservative

64. The equipment where sedimentation process is being carried out is called
(A) Thickeners (B) Centrifuge (C) Equilization tank (D) Propeller

65. CMC is
(A) Critically modified cellulose (B) Cellulose manufacturing center
(C) Carbon methyl cellulose (D) Carboxy methyl cellulose

66. Which fatty acid is the most susceptible to flavour reversion
(A) Stearic acid (B) Lauric acid (C) Palmitic acid (D) Linolenic acid

67. Iodine value measures
(A) Degree of unsaturation (B) Degree of saturation
(C) Amount of carbon present (D) Number of iodine present

68. Measurement of energy value of food is called
(A) Calorimetry (B) Joulimetry (C) Energymetry (D) Digestibility

69. Calorimetric value of protein is
(A) 1.9 kcal (B) 2.8kcal (C) 3.7 kcal (D) 4.1 kcal

70. Hops are used in the manufacture of
(A) Wine (B) Beer (C) Brandy (D) Whiskey

71. Match the following spoilage caused due to
SPOILAGE ORGANISM
1. Canned meat A) Alcaligens viscolactis
2. Smoked fish B) Streptococcus lactis
3. Maltiness in butter C) Aspergillus flavus
4. Ropiness of milk D) Clostridium

(A) 1D 2C 3B 4A (B) 1A 2C 3D 4B
(C) 1C 2D 3A 4B (D) 1D 2A 3B 4C

Page 276

72. The force involved in the crusher is
(A) Impact force (B) Compression (C) Attrition (D) Pseudo force

73. Which of the following parameter of a compressible fluids are sensitive to temperature
and pressure?
(A) Volume (B) Mass (C) Density (D) Temperature

74. A reduced compound is
(A) NAD (B) FAD (C) NADH (D) ADP

75. IPP stands for
(A) Institute of plastic packaging
(B) Institute of packaging professionals
(C) Institute of package protection
(D) Indian packaging professionals
x-x-x

(6)
Space for Rough Work

Page 277

M.E. (Mechanical Engineering)
1. For a particle to be in equilibrium under the action of two forces, the forces must be
(A) Concurrent and parallel (B) Unequal non concurrent
(C) Equal parallel non collinear (D) Equal, opposite and collinear

2. A beam simply supported at A and B of span 10 m is carrying a point load of 10 kN at
a distance of 4 m from A. Determine the reactions at the supports
(A) 7 kN, 8 kN (B) 4 kN, 6 kN
(C) 5 kN, 4 kN (D) 10 kN, 8 kN

3. Lami’s theorem gives the following when three concurrent forces acting on a body kept
in equilibrium
(A) Force divided by tan of angle is zero
(B) Force is proportional to tan θ
(C) Force/cos θ is constant
(D) Each force is proportional to the sine of angle between the other two

4. Bars PQ and QR, each of negligible mass support a load F as shown in the figure below.
In this arrangement, it can be deciphered that

(A) Bar PQ is subjected to bending but bar QR is not subjected to bending
(B) Bars PQ and QR are subjected to bending
(C) Neither bar PQ nor bar QR is subjected to bending
(D) Bar QR is subjected to bending but bar PQ is not subjected to bending

5. Mention the statements which are governing the laws of friction between dry surfaces
consisting of a body kept in equilibrium on an inclined plane by an upward force
(i) The friction force is independent on the velocity of sliding.
(ii) The friction force is proportional to the normal force across surface of contact.
(iii) The friction force is dependent on the materials of the contacting surfaces.
(iv) The friction force is independent of the area of contact.
(A) 2, 3, 4 (B) 1 and 3 (C) 2 and 4 (D) 1, 2, 3 and 4

6. A body of weight 200 N is placed on a rough horizontal plane. The coefficient of
friction, if a horizontal force of 80 N just causes the body to slide over the horizontal
plane, is
(A) 0.6 (B) 0.1 (C) 0.2 (D) 0.4

Page 278

7. Moment of Inertia of a square of side ‘a’ about an axis passing through its C.G. is equal
to
(A) a3/12 (B) a4/12 (C) a3/36 (D) a4/36

8. Two beams, one having a square cross-section and another a circular cross-section are
subjected to the same amount of bending moment. If the cross-sectional area as well as
the material of both the beams are the same, then
(A) maximum bending stress developed in both the beams are same.
(B) circular beam has more bending stress induced.
(C) square beam has more bending stress induced.
(D) bending stress does not depend on the cross-section.

9. The maximum stress at which even a billion reversal of stress cannot cause failure of
the material is called
(A) Safe stress (B) Proof stress
(C) Endurance limit (D) Fatigue stress

10. The maximum strain energy which can be stored by a body without undergoing
permanent deformation isknown as
(A) Safe resilience (B) Modulus of rigidity
(C) Modulus of resilience (D) Proof resilience

11. A body subjected to uni-axial tension will fail in a plane at 45° due to shear, if its shear
strength is less than
(A) Tensile strength
(B) Compressive strength
(C) Half the tensile strength
(D) Difference between tensile and compressive strength

12. A cantilever of span L subjected to a uniformly varying load, w/unit length at fixed end
to zero at free end,undergoes a maximum bending moment of
(A) wL2/6 (B) wL2/8 (C) wL3/6 (D) wL2/12

13. Which mechanism produces intermittent rotary motion from continuous rotary motion?
(A) Whitworth mechanism (B) Scotch Yoke mechanism
(C) Geneva mechanism (D) Elliptical trammel

14. The amount of energy absorbed by a flywheel is determined from the
(A) Speed-energy diagram (B) Speed-space diagram
(C) Torque-crank angle diagram (D) Acceleration-crank angle diagram

15. A simple spring mass vibrating system has a natural frequency of N. If the spring
stiffness is halved and the mass is doubled, then the natural frequency will become
(A) N/2 (B) 2N (C) 4N (D) 8N

16. In cyclic loading, stress concentration is more serious in
(A) Brittle materials (B) Ductile materials
(C) Elastic materials (D) Brittle and ductile materials

Page 279

17. In the case of brittle materials, the most appropriate theory of failure applied is
(A) maximum shear stress theory (B) maximum principal stress theory
(C) maximum strain theory (D) maximum total strain energy theory

18. A wire rope is designated as 6 X 19 standard hoisting. The numbers 6 X 19 represent
(A) Diameter is mm X length mm (B) Diameter is cmX length mm
(C) No of strands X no of wires in strand(D) No of wires in each strand X no of strands
19. The efficiency of a self-locking screw jack is
(A) 50% (B) more than 50%
(C) less than 50% (D) 68.75%
20. A sphere having a uniform density throughout and submerged in a liquid
(A) is always stable (B) is always unstable
(C) always neutrally stable (D) could be stable or unstable

21. If points G, M and B denote the centre of gravity metacentre and centre of buoyancy
for a body floating in aliquid, the sufficient condition for the body to be stable is
(A) point M being above point G (B) point M being above point B
(C) point B being below point G (D) point M being below point B

22. The surface temperature of a furnace is 7000C. From the surface, 3 rods of equal length
and cross section protrudes one made of steel, other made of copper and the third made
of aluminium. The free ends of the rods are exposed. The atmospheric temperature is
270C. For which of the rod tip temperature is highest
(A) Steel rod (B) Copper rod
(C) Aluminium rod (D) All the rods will have same tip temperature

23. The rate of heat flow through 10 cm thick wall of material having thermal conductivity
40 W/mK for a temperature difference of 100C will be
(A) 40 W/m2 (B) 4000 W/m2 (C) 6666.66 W/m2 (D) 800 W/m2

24. Two plates spaced 150 mm apart are maintained at 1000°C and 70°C. The heat transfer
will take place mainly by
(A) Convection (B) Free convection
(C) Forced convection (D) Radiation and convection

25. The ratio of emissive power of a body to emissive power of a perfectly black body is
called
(A) Absorptivity (B) Emissivity (C) Diffusivity (D) Absorptive power

26. ‘Fouling factor’ is used in heat exchanger design for
(A) Compensating the directional changes in the fluid flow
(B) Compensating the for loss of heat transfer due to scale formation
(C) Compensating for the head loss due to friction within the tubes
(D) Compensating for the coolant contamination

27. A case of natural convection is given by:
(A) Cooling of billets in atmosphere
(B) Cooling of IC engines
(C) Flow of water inside condensers
(D) Cooling of a hot plate in a stream of cold water

Page 280

28. In a closed vessel a gas undergoes reversible expansion from P1V1 to final pressure P2,
according to the following laws
a) Isothermal b) Adiabatic c) Polytropic (n >γ) d) Polytropic (n <γ)

Arrange the above four process in the ascending order of their work done

(A) c <b <d <a (B) a <b <c <d
(C) d <c <b <a (D) c <d <b <a

29. Which of the following statement holds good for the equation dQ = dE + dW
(A) Any process undergone by a closed stationary system
(B) Any process, reversible and irreversible and for any system
(C) A closed system when only pdv work is present
(D) Only reversible process

30. In a free expansion process
(A) Work done is zero (B) Heat transfer is zero
(C) Both (A) and (B) above (D) Work done is zero but heat increases

31. Which of the following is not the intensive property?
(A) Pressure (B) Temperature (C) Density (D) Heat

32. The Carnot efficiency of the engine working at temperature limits of 730°C and 27°C
is
(A) 60% (B) 70% (C) 65% (D) 75%

33. During a test on separating calorimeter the following observations were taken
Mass of water separated = 0.5 kg/min
Mass of steam passing through calorimeter = 5 kg/min
The dryness fraction is
(A) 0.902 (B) 0.905 (C) 0.909 (D) 0.99

34. The most popular firing order in case of 4-cylinder inline IC engine is
(A) 1 – 3 – 4 – 2 (B) 1 – 2 – 3 – 4
(C) 1 – 4 – 2 – 3 (D) 1 – 2 – 4 – 3

35. For the same compression ratio and heat addition
(A) ηOtto>ηDiesel >ηDual (B) ηDiesel >ηOtto >ηDual
(C) ηDual>ηDiesel >ηOtto (D) ηOtto >ηDual >ηDiesel

36. The atmospheric air at DBT 17°C enters a heating coil maintained at 40°C. If the air
leaves the heating coil at 28°C, the coil efficiency would be equal to
(A) 47.8% (B) 50% (C) 52% (D) 550.2%

37. When air is adiabatically saturated, the temperature attained is
(A) dew point temperature (B) dry bulb temperature
(C) wet bulb temperature (D) triple point temperature

Page 281

38. Equal volume of all gasses, at the same temperature and pressure contain equal number
of molecules. Thisis according to
(A) Charle’s law (B) Avagadro’s law
(C) Joule’s law (D) Gay Lusssac’s law
39. Specific heat of a gas, CP= CV at
(A) Absolute zero (B) Critical temperature
(C) Triple point (D) All temperatures

40. Failure of a material due to fatigue occurs
(A) At elastic limit (B) Below the elastic limit
(C) At the yield point (D) Below the yield point

41. When austenite steel is air cooled, the structure produced will be
(A) Martensite (B) Fine pearlite
(C) Coarse pearlite (D) Troostite

42. The percentage of chromium in 18 – 4 – 1 HSS tool material is
(A) 1% (B) 4% (C) 18% (D) 0.4%

43. Choose the most appropriate set of heat treatment process and corresponding process
characteristics.
P – Tempering
Q – Austempering
R – Martempering
1. Austenite →Bianite
2. Austenite →Martensite
3. Cementite →Globular structure
4. Hardness and brittleness reduced
(A) P -4, Q-2, R-1 (B) P-4, Q-3, R-1 (C) P-4, Q-1, R-2 (D) P-2, Q-3, R-4

44. For two specimens A & B of identical size, Young’s modulus of specimen A is greater
than that of specimen B. This means
(A) A is stiffer than B (B) B is stiffer than A
(C) A is harden than B (D) B is harden than A
45. By a 10 ton press, it is meant that
(A) The weight of press is 10 ton (B) It can handle work weighing up to 10 ton
(C) It can exert force up to 10 ton (D) Turn over per day is 10 mton

46. In DC arc welding when work is connected to the positive terminal it is called a
(A) Straight polarity (B) Reversed polarity
(C) Cross polarity (D) None of the above

47. In resistance welding, the voltage required for heating is
(A) 1 to 5 V (B) 11 to 20 V (C) 6 to 10 V (D) 50 to 100 V

48. Match the lists and select correct answer
Machining process Associated medium
(P) USM (1) Kerosene
(Q) EDM (2) Abrasive slurry

Page 282

(R) ECM (3) Vacuum
(S) EBM (4) Salt solution
(A) P-2, Q-3, R-4, S-1 (B) P-4, Q-1, R-2, S-3
(C) P-2, Q-1, R-4, S-1 (D) P-4, Q-3, R-2, S-1

49. A hole and mating shaft have nominal size of 50 mm. Maximum clearance is 0.15 mm
and minimum clearance is 0.05 mm. Hole tolerance is 1.5 times the shaft tolerance.
Limits for hole in a shaft basis system is
(A) 49.02, 49.08 mm (B) 51.04, 51.10 mm
(C) 49.05, 49.11 mm (D) 50.05, 50.11 mm

50. According to Taylor’s principle, NO GO gauge checks
(A) Only important dimensions at a time
(B) All the dimensions at a time
(C) Only one feature at a time
(D) Only related dimensions at a time

51. A lead plate is mechanically worked at room temperature. It is
(A) A cold working process
(B) A hot working process
(C) Neither hot working nor cold working
(D) It is not defined

52. Delphi method of forecasting is applicable
(A) When previous data from the market are available
(B) When a study about a product already in the market is required
(C) When a new product is launched in the market
(D) The market is highly competitive

53. In graphical solution of linear programming problem, the optimum unique solution will
be
(A) Anywhere in the feasible region
(B) Only at a corner value
(C) In the feasible region but away from the origin
(D) In the feasible region rearer to the origin

54. A transportation problem is said to be balanced, if
(A) the total capacity is equal to the total demand
(B) the number of origins are numerically equal to the number of destinations
(C) the problem does not degenerate
(D) the problem can be a maximisation or a minimisation problem

55. Which of the following statements is correct?
(A) PERT is a deterministic model
(B) CPM is used for activities where the duration is uncertain
(C) CPM is usually used for repetitive jobs
(D) In PERT, time is the controlling factor

56. A Fluid is said to be Newtonian fluid when the shear stress is
(A) directly proportional to the velocity gradient

Page 283

(B) inversely proportional to the velocity gradient
(C) independent of the velocity gradient
(D) None of these
57. Naiver Stoke’s equation represents the conservation of
(A) Energy (B) Mass (C) Pressure (D) Momentum

58. Torque to weight ratio for a circular shaft transmitting power is directly proportional to
the
(A) square root of the diameter (B) diameter
(C) square of the diameter (D) cube of the diameter

59. Stress concentration in a machine component of a ductile material is not so harmful as
it is in a brittle material because
(A) In ductile material local yielding may distribute stress concentration
(B) Ductile material has larger young’s material
(C) Possion’s ratio is larger in ductile materials
(D) Modulus of rigidity is larger in ductile materials

60. The second moment of a circular area about the diameter is given by (D is the diameter)
(A) (B) (C) (D)

61. A simply supported laterally loaded beam was found to deflect more than a specified
value. Which of the following measures will reduce deflection?
(A) Increase the area moment of inertia
(B) Increase the span of the beam
(C) Select a different material having lesser modulus of elasticity
(D) Magnitude of the load to be increased

62. A rod of length L and diameter D is subjected to a tensile load P. Which of the following
is sufficient to calculate the resulting change in diameter?
(A) Young’s modulus
(B) Shear modulus
(C) Poisson’s ratio
(D) Both Young’s modulus and shear modulus

63. In terms of Poisson’s ratio (µ) the ratio of Young’s modulus (E) and shear modulus (G)
of elastic material is
(A) 2(1+ µ) (B) 2(1- µ) (C) ½(1+ µ) (D) ½(1- µ)

64. A thin cylinder of inner radius 500 mm and thickness 10 mm subjected to an internal
pressure of 5 MPa. The average circumferential (hoop) stress in MPa is
(A) 100 (B) 250 (C) 500 (D) 1000

65. For a simply supported beam on two end supports the Bending moment is maximum
(A) usually on the supports (B) always at mid span
(C) where there is no shear force (D) where the deflection is maximum

Page 284

66. Match the property with their units
Property Units
A. Bulk modulus 1. W/s
B. Thermal conductivity 2. N/m2
C. Heat transfer coefficient 3. N/m3
D. Heat flow rate 4. W
5. W/mK
6. W/m2K
Codes :
A B C D
(A) 1 2 6 5
(B) 2 5 6 1
(C) 2 6 4 1
(D) 1 5 3 2

67. For a given heat flow and for the same thickness, the temp. Drop across material will
be maximum for
(A) Copper (B) Steel (C) Glass wool (D) Refractory brick

68. From where does the global load vector F is assembled?
(A) Element force vectors only
(B) Point loads only
(C) Both element force vectors and point loads
(D) Undefined

69. The finite element method is used to solve the problem ______
(A) Uniformly (B) Vigorously (C) Approximately (D) Identically
70. Shape function is just a ___________
(A) Displacement function (B) Equation
(C) Interpolation function (D) Matrix function
71. Von-mises theory, is often used to estimate the yield of
(A) Hard materials (B) Ductile materials (C) Both (D) Polymers

72. Four noded tetrahedral element consists of following degree of freedoms per element
(A) 4 (B) 8 (C) 12 (D) 16
73. During the execution of a CNC part program block NO20 GO2 X45.0 Y25.0 R5.0 the
type of tool motion will be
(A) circular Interpolation – clockwise
(B) circular Interpolation – counterclockwise
(C) linear Interpolation
(D) rapid feed

74. NC contouring is an example of
(A) continuous path positioning (B) point-to-point positioning
(C) absolute positioning (D) incremental positioning

75. The direct laser deposition process is used to make parts from _____.
(A) plastic (B) metal (C) paper (D) any of these

x-x-x

Page 285

M.Com. (Master of Entrepreneurship and Family Business)
1. "Spanish" is the official language of _____.
(A) Mexico (B) Comoros (C) Armenia (D) Vatican City

2. Gangtok is capital of:
(A) Tripura (B) Manipur (C) Nagaland (D) Sikkim

3. In India the term Black Revolution is associated with
(A) Self dependence in the production of Coal
(B) Nurturing the Black soil
(C) Self dependence in production of petroleum crude oil
(D) Self dependence in production of black crop

4. Present Governor of RBI is
(A) Urjit Patel (B) Raghuram Rajan (C) C Rangaraja (D) Shaktikanta Das

5. The members of the Rajya Sabha are elected by
(A) The people
(B) Lok Sabha
(C) Elected members of the legislative assembly
(D) Elected members of the legislative council

6. Who is education Minister of India:
(A) Mr. Dharmendra Pradhan (B) Mrs. Smriti Irani
(C) Mr. Prakash Javadekar (D) Mr. Ramesh Pokhriyal

7. Which institution/ department notifies cost inflation index (CII) every year?
(A) Reserve Bank of India (B) Central Board of Direct Taxes
(C) National Statistical Office (D) Department of Economic Affairs

8. ‘Scholarship for PMCARES Children’ scheme was launched under which Ministry?
(A) Ministry of Women and Children
(B) Ministry of Social Justice and Empowerment
(C) Ministry of Law and Justice
(D) Ministry of Home Affairs

9. Which pair is not correct?
(A) EXIM Bank- Financing for export-import
(B) RBI- Banker’s bank
(C) IDBI- industrial finance
(D) FCI- financial assistance to commercial institutions

10. The constitution of India was adopted by the constituent assembly on:
(A) 26th January 1950 (B) 26th November 1949
(C) 26th January 1949 (D) 15th August 1947

11. Amul is related to ________.
(A) Green Revolution (B) Pink Revolution
(C) White Revolution (D) Black revolution

Page 286

12. In which city are the headquarters of International Monetary Fund?
(A) Washington DC (B) New York (C) Berlin (D) London
13. How many states are there in India?
(A) 28 (B) 27 (C) 29 (D) 24

14. The main source of National Income of India is
(A) Service sector (B) Agriculture (C) Industrial sector (D) Trade sector

15. Satellite launching station is located at
(A) Sriharikotta (Andhra Pradesh) (B) Solapur (Maharashtra)
(C) Salem (Tamilnadu) (D) Warangal (Telangana)

16. The main purpose of ASEAN (Association of South-East Asian Nations) is
(A) To accelerate economic progress and maintain economic stability
(B) To maintain higher standards of living among member nations
(C) To provide collective defence and economic cooperation
(D) To provide finance to different countries

17. The language spoken in Lakshadweep island is
(A) Malayalam (B) Marathi (C) Tamil (D) Gujarati

18. The maximum revenue source of village panchayat is
(A) Government grants (B) Sales tax
(C) Voluntary help by village cooperatives (D) Local taxes on lands, fairs and festivals

19. Find out the wrong number in the series
28, 84, 112, 196, 308, 504, 872
(A) 112 (B) 196 (C) 308 (D) 872

20. Bank is related to money in the same way as transport is related to
(A) Traffic (B) Goods (C) Speed (D) Road

21. Find the odd one out
(A) Jupiter: Planet (B) Musician: Artist
(C) Merchant: Business (D) Maze: Cereal

22. Sukhbir is taller than Randhir but not as tall as Ajit. If Manoj is taller than Nitin, who
is shorter than Ajit, then who among them is the shortest?
(A) Nitin (B) Sukhbir (C) Manoj (D) Data inadequate

23. Statement: "If you trouble me, I will slap you." - A mother warns her child.
Assumptions: With the warning, the child may stop troubling her.
All children are basically naughty.
(A) Only assumption I is implicit (B) Only assumption II is implicit
(C) Either I or II is implicit (D) Neither I nor II is implicit

24. A is 2 years older than B who is twice as old as C. If the total of the ages of A,B and C
be 27, then how old is B?
(A) 7 (B) 8 (C) 9 (D) 10

Page 287

25. Suppose the average weight of 9 persons is 50 Kg. Average weight of the first 5 persons
is 45 Kg, whereas average weight of the last 5 persons is 55 Kg. Then the weight of 5 th
member will be
(A) 45.0 Kg (B) 47.5 Kg (C) 50.0 Kg (D) 52.5 Kg

26. Which of the following two signs need to be interchanged to make the given equation
correct?
4 + 2 – 5 X 7 ÷ 12 = - 21
(A) ÷ and – (B) ÷ and + (C) X and + (D) X and –

27. MIND : BODY ::
(A) Water : Air (B) CPU : Hard Disk (C) Ship : Oil (D) Software : Computer

Directions (Q.28 - 31): In each of the questions below, two statements are given
followed by two conclusions numbered I and II. You have to take the two statements
to be true even if they seem to be at variance with commonly known facts and then
decide which of the given conclusions logically follows from the given statements,
disregarding commonly known facts
28. Statements: All scooters are vehicles
No vehicle is a four-wheeler.
Conclusions: I. All scooters being four-wheelers is a possibility.
II. Some four-wheelers may be scooters.
(A) If only conclusion I follows
(B) If only conclusion II follows
(C) If either conclusion I or conclusion II follows
(D) If neither conclusion I nor conclusion II follows

29. Statements: Some pencils are black.
Some pens are pencils.
Conclusions: I. Some pencils are pens.
II. No pen is black.
(A) If only conclusion I follows
(B) If only conclusion II follows
(C) If either conclusion I or conclusion II follows
(D) If neither conclusion I nor conclusion II follows

30. Statements: No doctor is rich
All professionals are doctors.
Conclusions: I. Some rich which are not doctors may be professionals.
II. Some rich being professional is a possibility.
(A) If only conclusion I follows
(B) If only conclusion II follows
(C) If either conclusion I or conclusion II follows
(D) If neither conclusion I nor conclusion II follows

31. Statements: Some poor are honest.
Some honest are sharp.
Conclusions: I. Some poor being sharp or honest is a possibility.
II. At least some poor will be sharp.

Page 288

(A) If only conclusion I follows
(B) If only conclusion II follows
(C) If either conclusion I or conclusion II follows
(D) If neither conclusion I nor conclusion II follow

32. Which word does NOT belong with the others?
(A) Tyre (B) Steering wheel (C) Engine (D) Car

33. The study of ancient societies
(A) Anthropology (B) Archaeology (C) History (D) Ethnology

34. A person of good understanding knowledge and reasoning power
(A) Expert (B) Intellectual (C) Snob (D) Literate

35. State in which the few govern the many
(A) Monarchy (B) Oligarchy (C) Plutocracy (D) Autocracy

36. I read an advertisement that said
P : posh, air-conditioned
Q: gentleman of taste
R: are available for
S : fully furnished rooms
The Proper sequence should be
(A) PQRS (B) PSRQ (C) PSQR (D) SRPQ

37. How many seconds will a 500-metre-long train take to cross a man walking with a
speed of 3 km/hr in the direction of the moving train if the speed of the train is 63
km/hr?
(A) 25 (B) 30 (C) 40 (D) 45

Directions for Q 38-42: A University offers five specialisation disciplines Agriculture,
Marketing, Finance, Systems and Personnel for Post-Graduate studies in Management
Sciences. Five students Abhijit, Vijay, Saira, Deepak and Meeta opt for different
specialisations while studying from four different institutes P, Q, R & S.
1. Institute S doesn't provide facility to study Agriculture and Systems
Management.
2. Only Abhijit and Deepak have taken Marketing as the specialisation and they
are studying in different Institutes.
3. Both the lady students are studying in Institute S.
4. Vijay is the only student who has taken Finance. He is studying in Institute Q.
5. Deepak does not study in Institute P.
6. Abhijit and Deepak do not go to any of the institutes to which Vijay, Saira or
Meeta go.

38. In which of the following institutes is Abhijit studying?
(A) P (B) R (C) Q (D) S

39. In which of the following institutes is Deepak studying?
(A) P (B) Q (C) R (D) S

Page 289

40. Which discipline(s) has (have) not been opted by any student?
(A) Agriculture only (B) Systems only
(C) Personnel only (D) Both Agriculture and Systems

41. Which of the following combinations is right?
(A) Deepak - Finance (B) Meeta - Personnel
(C) Marketing - Institute S (D) Vijay – Institute R

42. Which are the specialisations opted by two students each?
(A) Marketing only (B) Finance only
(C) Personnel only (D) Both Marketing and Personnel

For questions 43 to 45: the financial profile of a company is as given below:
Rs. Million Year ended 31st Mar 2001 Year ended 31st Mar 2000
Gross Revenue 187.1 147.8
Gross Profit 10.8 3.9
Profit after Tax 8.8 3.1
Equity Capital 7.5 7.5
Reserves 18.4 20.0
EPS 117.33 41.33
Net Margin% 4.65 1.82

43. What is the % growth shown of total revenue in 2001 over 2000? (Figures shown in
parenthesis represent negative growth)
(A) 18 % (B) 27 % (C) 22 % (D) 10 %

44. The net margin in 2001 has shown an increase over 2000 of (Net margin is % of Gross
revenue)
(A) 3 m (B) 6 m (C) 0.6 m (D) 1.2 m

45. By how many percentage points has Gross Margin (Gross Profit as a % of Gross
Revenue) increased?
(A) 2.56 % (B) 3.82 % (C) 5.21 % (D) 3.13 %

46. Which is the smallest fraction among the following?
(A) 7/9 (B) 4/5 (C) 6/7 (D) 9/13
47. Sam purchased 20 dozens of toys at the rate of Rs. 375 per dozen. He sold each one of
them at the rate of Rs. 33. What was his percentage profit?
(A) 3.5 (B) 4.5 (C) 5.6 (D) 6.5

48. Find the number of triangles in the given figure.

(A) 8 (B) 10 (C) 12 (D) 14

Directions for question 49 & 50: Read the information below and answer the questions
that follow:

Page 290

Fifteen years ago Mrs. Gilani had three daughters Sudha, Riddhi, Nidhi. Her age was
double the combined age of her three daughters. Aftersome years, she had two sons
Amit and Keshav. Now the combined age of all her daughters and sons is double the
age of Mrs. Gilani. Sudha’s age is equal to the total age of Amit and Keshav. Mrs.
Gilani’s age is equal to total age of sudha and Riddhi. All the ages are whole number
of years.

49. The present age of Nidhi is 18 years. Find the present age of Mrs. Gilani (in years).
(A) 37 (B) 39 (C) 41 (D) 45

50. If two of the children are twins, they are:
(A) Sudha & Riddhi (B) Sudha & Amit
(C) Riddhi & Nidhi (D) Can’t say

51. How many numbers between 333 and 666 are divisible by 5?
(A) 67 (B) 70 (C) 75 (D) 55

52. A test has 50 questions. A student scores 1 mark for a correct answer, -1/3 for a wrong
answer, and -1/6 for not attempting a question. If the net score of a student is 32, the
number of questions answered wrongly by that student cannot be less than:
(A) 6 (B) 12 (C) 3 (D) 9

53. An inspector rejects 0.08% of the total meters as defective. How many will he examine
to reject 2?
(A) 3000 (B) 3050 (C) 2500 (D) 1600

54. Despite his best efforts to conceal his anger ________.
(A) he failed to give us an impression of his agony
(B) he succeeded in camouflaging his emotions
(C) he could succeed in doing it easily
(D) people came to know that he was an

55. Open market operation is a part of
(A) Credit policy (B) Debit policy (C) Deposit policy (D) Loan Policy

56. The first fully Indian Bank is
(A) Punjab National Bank (B) State Bank of India
(C) Canara Bank (D) Indian overseas bank

57. Gross Domestic Product (GDP) is defined as the value of all
(A) Goods produced in an economy in a year
(B) Goods and services in an economy in a year
(C) Final goods produced in economy in an economy in a year
(D) Final goods and service produced in an economy in a year

58. Which of the following does not constitute the purpose of setting up SEBI?
(A) To protect the interests of investors in securities
(B) To promote the development of the securities market
(C) To regulate the global securities market
(D) To deal with matters connected with fraudulent and unfair trade practices relating
to securities market

Page 291

59. In which of the following type of insurance, insurable interest should be present only
at the time when policy is taken
(A) Fire insurance (B) Life insurance
(C) Marine insurance (D) Life and marine insurance

60. Which is the principle of Corporate Responsibility?
(A) Trusteeship Principle (B) Principle of stewardship
(C) Principle of the charity (D) All of these

61. Diffusion of routine information takes place through
(A) Downward communication (B) Upward communication
(C) Horizontal communication (D) External communication

62. Which sector is called primary sector in India?
(A) Industrial sector (B) Service Sector (C) External Sector(D) Agricultural Sector

63. Strategic planning is about:
(A) Strategic thinking (B) Strategic programming
(C) Tactical Planning (D) Portfolio planning

64. Which one of the following can be legally protected?
(A) Brand name (B) Trade mark (C) Brand mark (D) Package

65. International banking dealing with non-residents only and not in the currency of the
country where they are located is called
(A) Non resident banking (B) Offshore banking
(C) Euro currency banking (D) London discount house

66. Which of the following is an indirect tax?
(A) Wealth tax (B) Corporation tax (C) Excise duty (D) Capital gains tax

67. A situation of monopoly in the market refers to
(A) One seller one buyer (B) Many seller one buyer
(C) Many seller many buyer (D) One seller many buyer

68. Working capital can be used for the purchase of
(A) Machinery (B) Goodwill (C) Land and Building (D) Raw material

69. The investment of long term funds is made after a careful assessment of the various
projects through:
(A) Sales (B) Fund Flow (C) Capital budgeting (D) Cost of Capital

70. Which one of the following is a Indian private bank
(A) Central Bank of India (B) American Express
(C) HDFC (D) Bank of Baroda

71. Macroeconomics basically concerns with which of the following in an economy:
(A) Industry, trade and commerce (B) Agriculture, industry and trade

Page 292

(C) Employment, inflation and growth (D) Population, Income and Economic
planning

72. An entrepreneur doing business within the national border is called
(A) International entrepreneurship (B) Intrapreneurship
(C) Domestic entrepreneurship (D) Imports

73. Which is not the object of Entrepreneurial Development Programme:
(A) To create awareness about government schemes and programme
(B) To create a successful entrepreneur
(C) To remove doubts of entrepreneurs and to give solution to their problem
(D) To Use Intellectual property of others

74. Effective Selling Skills depends on ______________
(A) Number of language known to the DSA (B) Data on marketing staff
(C) Information regarding IT market (D) Knowledge of related markets

75. A good brand can be built up by way of
(A) Customer grievances (B) Break down of IT support
(C) Old age (D) Consistent offering of good services

x-x-x

Page 293

MSc(2Yr)(Microbial Biotechnology)

1. In the pentose phosphate pathway
(A) Only the C-1 carbon of glucose are oxidized to CO 2
(B) All the carbons of glucose are oxidized to CO2
(C) No decarboxylation occurs
(D) C-4 and C-5 of glucose is oxidized to CO2

2. Who won the Nobel Prize in 2020 for discovering the method for genome editing?
(A) George Smith, Frances Arnold and Greg Winter
(B) Emmanuelle Charpentier and Jennifer A. Doudna
(C) Jacques Dubochet, Joachim Frank and Richard Henderson
(D) John B. Goodenough, M. Stanley Whittingham and Akira Yoshino

3. What is the nature of the genetic material of coronavirus?
(A) Positive-sense ssRNA (B) Negative-sense ssRNA
(C) dsRNA (D) dsDNA

4. Biodiversity hot spots are characterized on the basis of
(A) Endemic species and threat perception
(B) Endemic flowering plants
(C) Species of flowering plants
(D) Threat perception

5. Many plasmids have ampicillin marker. This implies
(A) The plasmids contain genes for ampicillin biosynthesis
(B) Ampicillin is required for bacterial growth after transformation
(C) The plasmid contains the gene encoding β-lactamase
(D) Ampicillin is essential for cell survival

6. The date and Theme for the World Environment Day, 2022 was
(A) 5th June; Biodiversity (B) 15th June; Natural resources
(C) 25th June; Bioavailability (D) 5th June; Only One Earth

7. The metabolite that bridges the gap between glycolysis and the Krebs cycle is
(A) Oxaloacetate (B) Pyruvate (C) Acetyl CoA (D) Citrate

8. Penicillin acts as an antibiotic in susceptible bacteria by interfering with
(A) Cell wall formation
(B) Protein synthesis
(C) Krebs cycle
(D) Electron transport chain

Page 294

9. Using circular dichroism one can obtain
(A) relative proportions of α-helices, β-sheets and loops in proteins
(B) three-dimensional structure of a protein
(C) amino acid sequence of a protein
(D) quaternary structure of a protein

10. The largest unit within which gene flow can readily occur is a
(A) Population (B) Species (C) Genus (D) Phylum

11. The molecule that is known to be completely non immunogenic
(A) Collagen (B) Bovine serum albumin
(C) Cytochrome c (D) Gelatin

12. Cyanobacteria differ from purple and green photosynthetic bacteria because they
(A) have a membrane-enclosed nucleus
(B) use H2S as an electron donor
(C) do not require light
(D) produce oxygen during photosynthesis

13. The Calvin-Benson (carbon fixation) occurs in the
(A) Nucleus (B) Cytosol
(C) Thylakoids of chloroplasts (D) Stroma of chloroplasts

14. A diagnosis of diptheria is confirmed by
(A) Isolation of typical organisms from materials such as blood agar
(B) Isolation of a typical colony on Tinsdale’s agar
(C) Demonstration of toxin production by suspicious isolate
(D) Microscopic appearance of organisms stained with methylene blue

15. Which of the following molecules moves regularly from the nucleus to the cytoplasm?
(A) Glycogen (B) RNA (C) DNA (D) Cholesterol

16. The two types of cellular organelles that transform energy are
(A) Chromoplasts and leucoplasts (B) Mitochondria and chloroplasts
(C) Mitochondria and chromoplasts (D) Chloroplasts and leucoplasts

17. In tissue culture, callus can be induced to form shoot or root by altering the ratio of
(A) Auxin to cytokinin (B) Cytokinin to ethylene
(C) Auxin to gibberellins (D) Gibberellin to cytokinin

(2)

Page 295

18. Henry’s law relates to
(A) The partial pressure of oxygen and the saturation concentration of oxygen in the
liquid
(B) The oxygen transfer rate and the bubble size
(C) The oxygen transfer rate and the temperature
(D) The oxygen transfer rate to the partial pressure of oxygen in the liquid

19. Continuous feed during fermentation is used to maintain
(A) Temperature (B) Water level
(C) Product concentration (D) Substrate concentration

20. Green fluorescent protein (GFP) cloned from jellyfish has now wide application in
biological research. The fluorescence emitted by GFP is due to
(A) Presence of two zinc ions in GFP molecule
(B) Heme, that serves as a prosthetic group in GFP molecule
(C) Three amino acid residues within GFP molecule
(D) Whole GFP molecule

21. What best summarizes the MALDI method by which gas phase ions are produced for
mass spectrometry?
(A) Sample is hit by a low energy xenon beam
(B) Sample is forced through a narrow capillary tube and solvent rapidly
(C) Sample is embedded in a crystalline matrix and bombarded by laser beams
(D) Sample is heated and then bombarded by electrons

22. The wall-less mycoplasmas are considered to be related to gram-positive bacteria.
Which of the following would provide the most compelling evidence for this?
(A) They share common rRNA sequences
(B) Some gram-positive bacteria and some mycoplasmas produce catalase
(C) Some gram-positive bacteria and some mycoplasmas have coccus-shaped cells
(D) Both groups are prokaryotic

23. Streptococcus agalactiae is also known by its Lancefield group which is
(A) Group A (B) Group B (C) Group C (D) Group D

24. What property of biomembranes is responsible for their self-sealing nature?
(A) Hydrophilicity of the phospholipid head group
(B) Presence of protein in biomembranes
(C) Presence of cholesterol in biomembranes
(D) Hydrophobocity of the fatty acid side chains of phospholipids

25. Fatty acids enter cellular respiration as
(A) One-carbon fragments (B) Two-carbon fragments
(C) Three-carbon fragments (D) Long chains of 16 to 20 carbon atoms
(3)

Page 296

26. Clostridium botulinum that causes botulism is
(A) Obligate aerobe (B) Facultative anaerobe
(C) Obligate anaerobe (D) Facultative aerobe

27. The SOS repair mechanism is activated by
(A) 5-bromouracil (B) 2-aminopurine
(C) Hydroxylamine (D) Thymine dimers

28. Which of the following eukaryotic genera contain common cloning host cells
(A) Paramecium (B) Saccharomyces
(C) Penicillium (D) Spirogyra

29. Fungi of class Deuteromycetes are notable because they
(A) undergo photosynthesis
(B) lack septa
(C) produce basidiospores
(D) lack a known sexual cycle of reproduction

30. The phosphorous cycle differs from carbon and nitrogen cycles in that
(A) it lacks a gaseous phase
(B) it lacks a liquid phase
(C) living organisms don’t need phosphorous
(D) contains a gaseous phase

31. Wash out in steady state fermentation occurs when
(A) dilution rate is less than maximum specific growth rate
(B) dilution rate is higher than the specific growth rate
(C) cell concentration reaches the maximum
(D) specific growth rate is maximum

32. 25 year-old woman whose blood tested positive for hepatitis B surface antigen (HBsAg)
gave birth to a full-term child. Which of the following therapies would most likely
minimize the transmission of hepatitis B to the neonate?
(A) Administer hepatitis B immunoglobulin
(B) Administer hepatitis B vaccine
(C) Administer hepatitis B immunoglobulin and hepatitis B vaccine
(D) Bottle-feed the neonate

33. The cellular productivity in a continuous stirred tank fermenter increases with an
increase in dilution rate and reaches a maximum value. If the dilution rate is increased
beyond the maximum point, the productivity will
(A) Decrease abruptly (B) Increase
(C) Increase drastically (D) Be zero

(4)

Page 297

34. Which of the following amino acid pairs have two chiral centers?
(A) Proline and arginine (B) Leucine and isoleucine
(C) Isoleucine and threonine (D) Methionine and cysteine

35. Name a clinical trial in which blood is transfused from recovered COVID-19 patients
to a coronavirus patient who is in critical condition?
(A) Plasma Therapy (B) Solidarity (C) Remdesivir (D) Platelet therapy

36. During the initiation phase of translation in bacteria, which of the following is first to
dissociate from the 30S ribosomal subunit?
(A) IF1 (B) IF2 (C) IF3 (D) GTP

37. GTP is required by which of the following steps in protein synthesis?
(A) Aminoacyl-tRNA synthetase activation of amino acids
(B) Attachment of ribosomes to endoplasmic reticulum
(C) Translocation of tRNA-nascent protein complex from A to P sites
(D) Attachment of mRNA to ribosomes

38. Peptides derived from exogenous antigens are presented by
(A) MHC-I molecules on the antigen presenting cell surface
(B) both MHC-I and MHC-II molecules on the antigen presenting cell surface
(C) MHC-II molecules on the antigen presenting cell surface
(D) CD-I molecules present on the antigen presenting cell surface

39. The tuberculin skin test is an example of a
(A) Type IV delayed hypersensitivity (B) Allergy reaction
(C) Precipitation reaction (D) Serum sickness

40. Plasmids generally code for genetic traits that are
(A) Not essential for the survival of the species
(B) Essential for the survival of the species
(C) Also present in the chromosome
(D) Mostly involved in imparting resistance to heavy metals

41. Which of the following statements about a plot of V versus substrate concentration for
an enzyme that follows Michaelis-Menten kinetics is false
(A) Km is the substrate concentration at which V=1/2 Vmax
(B) The shape of the curve is a hyperbola
(C) As substrate concentration increases, the initial velocity of the reaction, V also
increases
(D) At very high substrate concentration, the velocity curve becomes a horizontal line
that intersects the y-axis at Km
(5)

Page 298

42. The bacterium Bacillus thuringiensis is widely used in contemporary biology as
(A) A source of fermentation enzymes
(B) A producer of cheese and cheese products
(C) An insecticide
(D) A purifier of water systems

43. When milk has been pasteurized successfully, the milk will no longer contain the
enzyme
(A) Polymerase (B) Phosphatase (C) Peroxidase (D) Purinase

44. Information Technology Act, 2000 was notified on
(A) 28th October (B) 2nd October (C) 21st October (D) 17th October

45. Which of the following does not kill endospores?
(A) Autoclaving (B) Incineration (C) Hot-air sterilization (D) Pasteurization

46. Which of the following is most likely to be bactericidal?
(A) Membrane filtration (B) Ionizing radiation
(C) Lyophilization (D) Deep freezing

47. The information retrieval tool of NCBI GenBank is
(A) Entrez (B) STAG (C) SeqIn (D) Text search

48. A fungus that can attack hair is
(A) Trichophyton (B) Rhizopus (C) Microsporum (D) Sporothrix

49. Which of the following sites may be thousands of base pairs from a promoter, yet
regulate transcription?
(A) Operators (B) Initiators (C) Enhancers (D) Attenuators

50. Choose the item that correctly matches the microorganism with appropriate stain or
preparation
(A) Mycobacterium tuberculosis – India ink
(B) Fungi - KOH
(C) Cryptococcus neoformans in cerebrospinal fluid – Ziehl Neelsen stain
(D) Chlamydia – Gram stain

51. A delayed hypersensitivity reaction is characterized by
(A) Edema without a cellular infiltrate
(B) An infiltrate composed of neutrophils
(C) An infiltrate composed of helper T cells and macrophages
(D) An infiltrate composed of eosinophils

(6)

Page 299

52. The melting temperature, Tm, of a DNA duplex is defined as the temperature at which
half the molecules have dissociated into single strands. Tm will be maximal at
(A) Low ionic strength and high DNA concentration
(B) High ionic strength and high DNA concentration
(C) High ionic strength and low DNA concentration
(D) Low ionic strength and low DNA concentration

53. When changes in the phenotype or gene expression occur without changes in the
underlying DNA sequence, the phenomenon is called
(A) Mutation (B) Eugenics (C) Epigenetics (D) Epistasis

54. In biological membrane, integral proteins and lipids interact mainly by
(A) Covalent bond (B) H-bond
(C) Hydrophobic interactions (D) Van der waals force

55. Which of the following chemical mutagens is likely to cause GC→AT transitions?
(A) 5-Bromouracil (B) 2-amino-purine (C) Acrydine orange (D) Hydroxylamine

56. The term cDNA library means
(A) Collection of cDNA clones by an individual researcher
(B) Compilation of cDNA sequences in the database
(C) Pool of cDNA’s generated from a specific tissue inserted into an appropriate vector
that can be used as a source of cDNA of interest
(D) It is manual for cDNA research

57. The portion of the antibody molecule responsible for the effector functions is
(A) Fab (B) Fc (C) Hinge (D) Hypervariable

58. Removal of bursa of Fabricius from chicken results in
(A) A markedly decreased number of circulating T lymphocytes
(B) Anemia
(C) A delayed rejection of skin graft
(D) Low serum levels of antibodies

59. FOS, JUN and MYC are
(A) Genes coding for surface proteins expressed on cancerous cells
(B) Genes coding for protein kinases that phosphorylate transcription factors regulating
cancer genes
(C) Genes coding for transcription factors that induce growth dependent genes
(D) Genes coding for MHC proteins

(7)

Page 300

60. Which of the following is the most important element of Koch’s germ theory of
disease? The animal shows disease symptoms when
(A) The animal has been in contact with a sick animal
(B) The animal has a lowered resistance
(C) A microorganism is not observed in the animal
(D) A microorganism is inoculated into the animal
61. Three-dimensional images of the surface of the cells and tissues could be visualized
through
(A) Transmission Electron Microscope (B) Scanning Electron Microscope
(C) Compound Microscope (D) Florescence Microscope

62. The first ribozyme was found in
(A) A nuclear gene for DNA replicating enzyme
(B) A mitochondrial gene for a respiratory enzyme
(C) A mRNA for a mitochondrial enzyme
(D) An intron within a pre-rRNA molecule

63. Which one of the following is characteristic of mycobacteria?
(A) They contain mycolic acids (B) They are resistant to inactivation by heat
(C) They grow extracellularly (D) They are anaerobic

64. Species of Trypanosoma and Naegleria are both
(A) Transmitted by tsetse flies (B) Treated with penicillin antibiotics
(C) Types of protozoa (D) Causes of sleeping sickness
65. Nonbiological foreign chemicals are termed
(A) Xenobiotics (B) Probiotics (C) Prebiotics (D) Neurobiotics

66. Which of the following organism is widely used as a biocontrol agent in organic
farming?
(A) Rhizobium tropicii (B) Trichoderma viride
(C) Fusarium oxysporum (D) Nostoc muscorum
67. When a number of genes are transcribed as one mRNA, the mRNA is said to be
(A) Multimeric (B) Polymeric (C) Polycistronic (D) Polyclonal

68. The purity of a solute collected between two times t1 and t2 during chromatographic
separation can be calculated as
(A) Amount of solute eluted-amount of impurity eluted
(B) Amount of solute eluted/amount of impurity eluted
(C) Amount of solvent eluted + amount of impurity eluted
(D) Amount of solvent eluted/amount of impurity eluted

(8)

Page 301

69. Who is the director general of WHO at present?
(A) Margaret Chan (B) Tedros Adhanom
(C) Sania Nishtar (D) Audrey Azoulay

70. Pseudopeptidoglycan is present in the cell wall of
(A) Escherichia coli (B) Bacillus subtilis
(C) Scacharomyces cerevisae (D) Methanococcus jannaschii

71. The purity of an enzyme at various stages of purification is best measured by
(A) Total protein (B) Total enzyme activity
(C) Specific activity of the enzyme (D) Percent recovery of protein

72. Which would be best to separate a protein that binds strongly to its substrate
(A) Gel filtration (B) Affinity chromatography
(C) Cation exchange (D) Anion exchange

73. Which technique can be used to obtain information about protein shape?
(A) X-ray crystallography (B) Western blotting
(C) SDS-PAGE (D) Sequencing

74. Which of the following microorganisms is the cause of bacillary dysentery and uses a
type III secretion system to deliver specific virulence factors to target epithelial cells?
(A) Escherichia coli (B) Salmonella spp.
(C) Shigella spp. (D) Staphylococcus spp.

75. Steroid hormone receptors, when bound by an appropriate hormone, bind to
(A) rRNA (B) mRNA (C) snRNA (D) DNA

x-x-x

Page 302

M.P.Ed.
1) The body mind relationship was first promulgated by:
(A) Socrates (B) Plato (C) Aristotle (D) Homer
2) Who propounded the theory of ‘survival of the fittest’?
(A) Charles Darwin (B) Thomas Huxley
(C) Herbart Spencer (D) Francis Galton
3) Human growth is the fastest during:
(A) Adolescents (B) Infancy
(C) Later childhood (D) Pre- natal period
4) What creates antibodies in the blood?
(A) White blood cells (B) Red blood cells
(C) Blood platelets (D) Blood plasma
5) Which of the following associated with bellows breath?
(A) Bhastrika (B) NadiShodhan
(C) Sitkari (D) Kapalabhati
6) Which of the following cells responsible for the storage of fat?
(A) Mast (B) Fibroblasts
(C) Macrophage (D) Adipose
7) The word metabolism means:
(A) Exchange of gases in the lungs
(B) Production of lactic acid in the muscles
(C) Production of lactic acid in the liver
(D) Chemical changes which take place in the body
8) The concepts of maximal oxygen uptake and oxygen debt introduced by whom?
(A) A. V. Hill (B) A. B. Hill (C) B.C. Hill (D) B. P. Hill
9) Push up is the finest example of which class of lever:
(A) First class lever (B) Second class lever
(C) Third class lever (D) Fourth class lever
10) An amphiarthrosis is a:
(A) Immovable joint (B) Freely moveable joint
(C) Slightly moveable joint (D) Non- moveable joint
11) Red blood cells are produced in the:
(A) Heart (B) Cerebrum

Page 303

(C) Bone marrow (D) Spinal column
12) Platelets scientifically are known as:
(A) Thrombocytes (B) Lymhocytes
(C) Monocytes (D) Lymphomatics
13) Pulmonary edema is a disorder characterized by accumulation of fluid in the:
(A) Skin (B) Skeletal tissues
(C) Spinal cord (D) Alveoli
14) Which country has won Men’s Hockey Asia Cup, 2022:
(A) South Korea (B) Malaysia (C) India (D) Japan
15) The cartilage which serves to cushion the impact of large forces on bone ends is called:
(A) Hyaline cartilage (B) Notch
(C) Fossa (D) Fibrous cartilage
16) Which part in human body is known as chemical factory of the body?
(A) Skin (B) Liver (C) Muscles (D) Veins
17) Amino acids scientifically known as:
(A) Protein (B) Fat
(C) Carbohydrates (D) Starch
18) Headquarter of World Anti-Doping Agency (WADA) is situated at:
(A) Montreal (B) Toronto (C) Vancouver (D) Surrey
19) The term ‘Bulimia nervosa’ associated with:
(A) Eating more food (B) Very thin body
(C) Eating less food (D) Normal body
20) The most desirable skill of a teacher is to:
(A) Make the students understand what the teachers says
(B) Keep higher authorities informed about the class activities
(C) Cover the prescribed course
(D) Keep students relaxed while teaching
21) A new teacher to start with will have to:
(A) Enforce discipline in the class
(B) Establish rapport with the students
(C) Cut jokes with the students
(D) Tell the students about his qualification

Page 304

22) Which of the followings should not be the main role of the teacher at the higher educational
level?
(A) Provide information to students
(B) Promotes self- learning among students
(C) Encourage healthy competition among students
(D) Help the students to solve their personal problems
23) An effective teacher will ensure:
(A) Cooperation among his students
(B) Laissez-faire role
(C) Competition among students
(D) Competition or cooperation as the situation demands
24) The prime requirement to become a good teacher is to have:
(A) Genuine Interest in teaching
(B) Knowledge about controlling students
(C) Subject knowledge
(D) Good expression
25) The quality of a research is judged by:
(A) Relevance of the research
(B) Methodology adopted for conducting the research
(C) Depth of research
(D) Experience of the researcher
26) The conceptual framework in which a research is conducted is called a:
(A) Synopsis of research (B) Research design
(C) Research hypothesis (D) Research Paradigm
27) Research can be conducted by a person who:
(A) Has studied research methodology (B) Holds postgraduate degree
(C) Possesses thinking and reasoning ability (D) Is a hard worker
28) The depth of any research can be judged by:
(A) The title of the research (B) Objective of the research
(C) Total expenditure on the research (D) Duration of the research
29) An important practical issue to consider while designing a research project is:
(A) An interesting theoretical perspective
(B) Addition to knowledge of researcher only
(C) Availability of time and other resources

Page 305

(D) That it should be qualitative
30) Find the missing number in the following series: 512, 256, 128, ?, 32, 16, 8
(A) 52 (B) 61 (C) 64 (D) 56
31) Find the missing number in the following series: 2/3, 4/7, ?, 11/21, 16/31
(A) 10/8 (B) 6/10 (C) 5/10 (D) 7/13
32) Param travels a distance of 5 km in south direction. He turns to his right. After walking 3 km,
he turns to the left and walks 5km. Now in which direction is he from the starting place?
(A) West (B) South (C) South West (D) North East
33) Pointing to a woman in a picture, Amit said, ‘her granddaughter is the only daughter of my
brother.’ How is the women related to Amit.
(A) Sister (B) Grand mother
(C) Mother in law (D) Mother
34) In a certain code, COMPUTER is written as ‘RFUVQNPC’. How is ‘PRINTER’ written in
the same code?
(A) RFUOJSP (B) PFUOJSR (C) PSJOUFP (D) RSJOUFP
35) Group play is a royal road to:
(A) Socialization (B) Civilization
(C) Globalization (D) Urbanization
36) Which of the following is the best source for omega-3 fatty acids?
(A) Corn oil (B) Wheat products
(C) Pork (D) Sardines
37) The Central Advisory Board of Physical Education and Recreation (CABPER) was set up in
the year:
(A) 1951 (B) 1950 (C) 1952 (D) 1953
38) A test measures what it purports to measure is assessed by:
(A) Norms (B) Objectivity (C) Reliability (D) Validity
39) Reliability of the test measures:
(A) Subjectivity (B) Consistency of performance
(C) Validity (D) Norms
40) General motor ability test is propounded by:
(A) Scott (B) Jhonson (C) Mc Donald (D) Rogers
41) Who was the founder of world's first experimental psychology lab?
(A) Sigmund Freud (B) Wilhelm Wundt
(C) Albert Bandura (D) Wolfgang Kohler

Page 306

42) The CPR stands for:
(A) Cardio-pumping respiration (B) Cardio-pulmonary resuscitation
(C) Cardiac pain rehabilitation (D) Circulatory pain rehabilitation
43) Summer Olympics, 2024 will be held at:
(A) Paris (B) Los angeles (C) Rio (D) Beijing
44) What is the motto of 2022 Commonwealth Games?
(A) Games for everyone (B) Play for all
(C) A game for all (D) Heart to heart
45) What is the motto of 19th edition Asian Games?
(A) Heart to Heart, @ Future (B) Heart to Heal, @ Future
(C) Head to Heart, @ Future (D) Head to Toe, @ Future
46) The International Association of Athletics Federations (IAAF) has been officially renamed
as:
(A) Amateur Athletic World Federation (B) World Athletics
(C) Athletic Federation of World (D) World Athletic Federation
47) In statistics, the formula to calculate range is:
(A) The difference between highest and lowest value
(B) The under root of lowest and highest value
(C) The Addition of highest and lowest value
(D) The multiplication of highest and lowest value
48) Which country is going to host 2023 Men’s Hockey World Cup?
(A) Netherlands (B) Australia
(C) Germany (D) India
49) The most reliable measure of variability is:
(A) Standard Deviation (B) Mean
(C) Quartile Deviation (D) Correlation
50) Acceleration of an object will increase as the net force increases, depending on its
(A) Mass (B) Density (C) Volume (D) Velocity
51) Which of the following is a scaler quantity?
(A) Speed (B) Displacement (C) Velocity (D) Strength
52) The International Olympic Committee was formed on:
(A) 21 june 1984 (B) 22 june 1894 (C) 23 june 1894 (D) 24 june 1984
53) The official languages of the International Olympic Committee are:
(A) French and English (B) English and German

Page 307

(C) Russian and English (D) English and Greek
54) ‘Kraus weber test’ is used for measuring:
(A) Minimum muscular strength (B) Physical fitness
(C) Motor educability (D) Skill ability in a sports
55) Which measure divides the whole array into two equal halves?
(A) Median (B) Mode
(C) Standard deviation (D) Mean
56) Which country won the Thomas cup 2022?
(A) Indonesia (B) Malaysia (C) South Korea (D) India
57) Nikhat Zareen associated with which sports?
(A) Badminton (B) Ball badminton
(C) Boxing (D) Shooting
58) Which state has won the 12th Hockey India Senior Women’s National Championship Title?
(A) Punjab (B) Odisha (C) Haryana (D) Manipur
59) Number of medals won by India at International shooting sports federation (ISSF) Junior
World Cup 2022:
(A) 32 (B) 33 (C) 34 (D) 35
60) John Dewey is referred to as the father of:
(A) Pragmatism (B) Realism (C) Naturalism (D) Idealism
61) One gram of properly digested carbohydrates produces:
(A) 4 calories per gram (B) 4.5 calories per gram
(C) 5 calories per gram (D) 5.5 calories per gram
62) The city ‘Olympia’ is in:
(A) Greece (B) Germany (C) France (D) Rome
63) Scientific name of the calf muscle is :
(A) Sartorius (B) Hamstrings
(C) Quadriceps (D) Gastrocnemius
64) Water therapy is also known as:
(A) Electrotherapy (B) Wax therapy
(C) Hydrotherapy (D) Ice therapy
65) Circuit training method was developed by whom?
(A) R. E Morgan and G.T Anderson
(B) A.R Morgan and M.P Anderson
(C) James Morgan and James Naismith

Page 308

(D) Johns Morgan and M. Naismith
66) Meso-cycle is a training cycle that consist of :
(A) 6 to 8 weeks (B) 3 to 6 weeks (C) 3 to 6 days (D) 6 to 8 days
67) The immediate source of energy for the muscular contraction is:
(A) ADP (B) DAP
(C) O2 (D) ATP
68) Sergent jump is the measure of:
(A) Horizontal jumping ability (B) Vertical jumping ability
(C) Reaction ability (D) Locomotor ability
69) The endocardium is:
(A) Outer lining of the heart
(B) Innermost lining of the heart
(C) Outer lining of the lungs
(D) Innermost lining of the lungs
70) The path of projectile is called:
(A) Arc (B) Parabola (C) Acceleration (D) Velocity
71) Feedback system is an effective way to:
(A) Hinders learning (B) Delays learning
(C) Makes learning process faster (D) Makes learning process ineffective
72) While serving in tennis, if the ball touches the net and crosses over in the right court, it is
called:
(A) Let (B) Foul (C) Correct (D) Deuce
73) The Yankee stadium is associated with which game?
(A) Baseball (B) Boxing (C) Football (D) Volleyball
74) The Olympic flame was lighted for the first time in:
(A) 1928 (B) 1936 (C) 1932 (D) 1896
75) Rameshbabu Praggnanandhaa associated with which game?
(A) Chess (B) Cricket (C) Billiards (D) Boxing

*-*-*

Page 309

MSc(HS)(Computer Science)

1. Which data structures are typically used to represent matrices:
(A) Linked lists (B) Pointers (C) Strings (D) Arrays

2. What is the size of an IPv6 address?
(A) 32 bits (B) 64 bits (C) 128 bits (D) 256 bits

3. Which one out of the following is not an agile software methodology
(A) Spiral model (B) Extreme Programming
(C) Scrum (D) Lean Software Development

4. Karnaugh map is used to
(A) minimize the number of flip flops in a digital circuit
(B) minimize the number of gates only in a digital circuit
(C) minimize the number of gates and fan-in of a digital circuit
(D) design gates

5. In a microprocessor, the address of the next instruction to be executed is stored in the
(A) stack pointer (B) address latch
(C) program counter (D) general purpose register

6. What does the following C-statement declare?
int (* f) (int * );
(A) A function that takes an integer pointer as argument and returns an integer
(B) A function that takes an integer as argument and returns an integer pointer
(C) A pointer to a function that takes an integer pointer as argument and returns an
integer
(D) A function that takes an integer pointer as argument and returns a function pointer

7. The use of a DTD in XML development is:
(A) required when validating XML documents
(B) no longer necessary after the XML editor has been customized
(C) used to direct conversion using an XSLT processor
(D) a good guide to populating a templates to be filled in when generating an XML
document automatically

8. Which of the following transport layer protocols is used to support electronic mail?
(A) SMTP (B) IP (C) TCP (D) UDP

9. The greatest negative number that can be stored in a computer that has 8-bit word length
and uses 2’s complement arithmetic is
(A) -256 (B) -225 (C) -128 (D) -127

Page 310

10. Consider a direct mapped cache of size 32 KB with block size 32 bytes. The CPU
generates 32 bit addresses. The number of bits needed for cache indexing and the
number of tag bits are respectively:
(A) 10, 17 (B) 10, 22 (C) 15, 17 (D) 5, 17

11. Which of the database normal forms eliminates transitive dependencies?
(A) 3NF (B) 2NF (C) Unnormalized (D) 1NF

12. Select the correct definition of a database relation.
(A) Subset of Cartesian product of a list of tuples
(B) Subset of Cartesian product of a list of attributes
(C) Subset of Cartesian product of a list of relations
(D) Subset of Cartesian product of a list of domains

13. Which of the following SQL commands is used to modify columns of a database table?
(A) Update (B) Alter (C) Drop (D) Set

14. Which of the following is the lowest level of abstraction that describes how data is
stored?
(A) Physical (B) Abstract (C) View (D) User

15. If a transaction does not modify the database until it has committed, it is said to use the
___________ technique.
(A) Undo (B) Late-modification
(C) Immediate-modification (D) Deferred-modification

16. In operating system deadlock management, when transaction T i requests a data item
currently held by Tj, Ti is allowed to wait only if it has a timestamp larger than that of
Tj. Otherwise, Tj is rolled back. This scheme is known as:
(A) Wait-die (B) Wait-wound (C) Wound-wait (D) Wait

17. For real time operating systems, interrupt latency should be _________
(A) zero (B) minimal
(C) maximum (D) dependent on the scheduling

18. On systems where there are multiple operating system, the decision to load a particular
one is done by _____________
(A) process control block (B) file control block
(C) boot loader (D) bootstrap

19. To access the services of the operating system, the interface is provided by the
________
(A) Library (B) System calls
(C) Assembly instructions (D) API

20. What is compaction?
(A) a technique for overcoming internal fragmentation
(B) a paging technique

Page 311

(C) a technique for overcoming external fragmentation
(D) a technique for overcoming fatal error

21. Operating System maintains the page table for ____________
(A) each process (B) each thread (C) each instruction (D) each address

22. With round robin scheduling algorithm in a time shared system ____________
(A) using very large time slices converts it into First come First served scheduling
algorithm
(B) using very small time slices converts it into First come First served scheduling
algorithm
(C) using extremely small time slices increases performance
(D) using very small time slices converts it into Shortest Job First algorithm

23. The strategy of making processes that are logically runnable to be temporarily
suspended is called ____________
(A) Non preemptive scheduling (B) Preemptive scheduling
(C) Shortest job first (D) First come First served

24. What is the major disadvantage with a linked file allocation strategy?
(A) internal fragmentation (B) external fragmentation
(C) there is no sequential access (D) there is only sequential access

25. If the memory access time is denoted by ‘ma’ and ‘p’ is the probability of a page fault
(0 <= p <= 1). Then the effective access time for a demand paged memory is _________
(A) p x ma + (1-p) x page fault time (B) ma + page fault time
(C) (1-p) x ma + p x page fault time (D) p X ma + page fault time

26. Locality of reference implies that the page reference being made by a process
_________
(A) will always be to the page used in the previous page reference
(B) is likely to be one of the pages used in the last few page references
(C) will always be one of the pages existing in memory
(D) will always lead to page faults

27. A process having multiple threads of control implies ___________
(A) it can do more than one task at a time
(B) it can do only one task at a time, but much faster
(C) it has to use only one thread per process
(D) it runs slower than any other processes

28. If a system has an IP address of 172.16.13.5 with a 255.255.255.128 subnet mask, what
is the class address, subnet address, and broadcast address?
(A) Class A, Subnet 172.16.13.0, Broadcast address 172.16.13.127
(B) Class B, Subnet 172.16.13.0, Broadcast address 172.16.13.127
(C) Class B, Subnet 172.16.13.0, Broadcast address 172.16.13.255
(D) Class B, Subnet 172.16.0.0, Broadcast address 172.16.255.255

Page 312

29. Beyond IP, UDP provides additional services such as _______
(A) Routing and switching
(B) Sending and receiving of packets
(C) Multiplexing and demultiplexing
(D) Demultiplexing and error checking

30. The right to use a domain name is delegated by domain name registers which are
accredited by _______
(A) internet architecture board
(B) internet society
(C) internet research task force
(D) internet corporation for assigned names and numbers

31. Electronic mail uses which Application layer protocol?
(A) SMTP (B) HTTP (C) FTP (D) SIP

32. Firewalls are often configured to block ___________
(A) UDP traffic (B) TCP traffic (C) Sensitive traffic (D) Best-effort traffic

33. Which one of the following is not correct?
(A) telnet is a general purpose client-server program
(B) telnet lets user access an application on a remote computer
(C) telnet can also be used for file transfer
(D) telnet can be used for remote login

34. Which layer of the OSI reference model does IPsec work at?
(A) Layer 1 (B) Layer 2 (C) Layer 3 (D) Layer 4

35. Which element is used for or styling HTML5 layout?
(A) CSS (B) jQuery (C) JavaScript (D) PHP

36. In HTML, which attribute is used to create a link that opens in a new window tab?
(A) src=”_blank” (B) alt=”_blank”
(C) target=”_self” (D) target=”_blank”

37. In which access should a constructor be defined, so that object of the class can be
created in any function?
(A) Any access specifier will work (B) Private
(C) Public (D) Protected

38. The copy constructors can be used to ________
(A) Copy an object so that it can be passed to another primitive type variable
(B) Copy an object for type casting
(C) Copy an object so that it can be passed to a function
(D) Copy an object so that it can be passed to a class

39. Which access specifier is usually used for data members of a class?
(A) Protected (B) Private (C) Public (D) Default

Page 313

40. Which operator can be used to free the memory allocated for an object in C++?
(A) Unallocate (B) Free() (C) Collect (D) Delete

41. What are friend member functions in C++?
(A) Non-member functions which have access to all the members (including private)
of a class
(B) Member function which doesn’t have access to private members
(C) Member function which can modify any data of a class
(D) Member function which can access all the members of a class

42. Which of the following best describes member function overriding?
(A) Member functions having the same name in derived class only
(B) Member functions having the same name and different signature inside main
function
(C) Member functions having the same name in base and derived classes
(D) Member functions having the same name in base class only

43. Which is correct syntax for declaring pointer to object?
(A) *classNameobjectName; (B) className* objectName;
(C) classNameobjectName(); (D) classNameobjectName;

44. Instance of which type of class can’t be created?
(A) Parent class (B) Abstract class
(C) Anonymous class (D) Nested class

45. What is the extension of compiled java classes?
(A) .txt (B) .js (C) .class (D) .java

46. What is the difference between structures and classes in C++?
(A) Structures by default hide every member whereas classes do not
(B) In structures, members are public by default whereas, in classes, they are private by
default
(C) Structures cannot have private members whereas classes can have
(D) In structures, members are private by default whereas, in classes, they are public
by default

47. What are the elements present in the array of the following C code?
int array[5] = {5);
(A) 5, 5, 5, 5, 5
(B) 5, 0, 0, 0, 0
(C) 5, (garbage), (garbage), (garbage), (garbage)
(D) (garbage), (garbage), (garbage), (garbage), 5

48. Which of the following keywords is used to define an alternate name for an already
existing data type?
(A) default (B) volatile (C) typedef (D) static

Page 314

49. Which of the following is a correct syntax to pass a Function Pointer as an argument?
(A) void pass(int (*fptr)(int, float, char)){}
(B) void pass(*fptr(int, float, char)){}
(C) void pass(int (*fptr)){}
(D) void pass(*fptr){}

50. In a 4M-bit chip organisation having a total of 19 external connections, then it has
_______address if 8 data lines are there.
(A) 2 (B) 5 (C) 9 (D) 8

51. The bit used to indicate whether the block was recently used or not is _______
(A) Reference bit (B) Dirty bit
(C) Control bit (D) Idol bit

52. The lower order bits of the virtual address forms the __________
(A) Page number (B) Frame number
(C) Block number (D) Offset

53. In the following indexed addressing mode instruction, MOV 2(R1), LOC the effective
address is ______
(A) EA = 2+R1 (B) EA = R1 (C) EA = [R1] (D) EA = 2+[R1]

54. What must be used along with synchronous control inputs to trigger a change in the flip
flop?
(A) 0 (B) 1 (C) Clock (D) Previous
output

55. What is the minimum distance required for single error detection according to
Hamming’s analysis in Digital Electronics?
(A) 1 (B) 2 (C) 3 (D) 4

56. Which of the following gives the correct number of multiplexers required to build a 32
x 1 multiplexer?
(A) Two 16 x 1 mux (B) Three 8 x 1 mux
(C) Two 8 x 1 mux (D) Three 16 x 1 mux

57. The logical sum of two or more logical product terms is called __________
(A) SOP (B) POS (C) OR operation (D) NAND operation

58. If x(n) is a discrete-time signal, then what is the value of x(n) at non integer value of
‘n’?
(A) Zero (B) Positive (C) Negative (D) Not defined

59. Which property does y(t)=x(1-t) exhibit?
(A) Time scaling (B) Time shifting
(C) Reflecting (D) Time shifting and reflecting

Page 315

60. Which protocol assigns IP address to the client connected to the Internet?
(A) DHCP (B) IP (C) RPC (D) RSVP
61. _________ is a software development life cycle model that is chosen if the development
team has less experience on similar projects.
(A) Iterative Enhancement Model (B) RAD
(C) Spiral (D) Waterfall

62. Agile Software Development is based on which of the following type?
(A) Iterative Development
(B) Incremental Development
(C) Both Incremental and Iterative Development
(D) Linear Development

63. Which of the following is not an activity among for the configuration management of
a software system?
(A) Version management (B) System management
(C) Change management (D) Internship management

64. Which of the following is the best type of module cohesion?
(A) Functional Cohesion (B) Temporal Cohesion
(C) Coincidental Cohesion (D) Sequential Cohesion

65. In what type of coupling, the complete data structure is passed from one module to
another?
(A) Control Coupling (B) Stamp Coupling
(C) External Coupling (D) Content Coupling

66. Number of errors found per person hours expended is an example of a ______
(A) measurement (B) measure (C) metric (D) parameter

67. MTTC falls under category of_________
(A) correctness (B) integrity (C) maintainability (D) reliability

68. Characters are grouped into tokens in which of the following phase of the compiler
design?
(A) Code generator (B) Lexical analyzer (C) Parser (D) Code optimization

69. Which of the following focuses on the discovery of (previously) unknown patterns from
the data?
(A) Data mining (B) Big Data (C) Data wrangling(D) Machine Learning

70. Which of the following is defined as the process of elimination of parts of a scene
outside a window or a viewport?
(A) editing (B) cutting (C) plucking (D) clipping

71. Which of the following is defined as the drawing of number of copies of the same image
in rows and columns across the interface window so that they cover the entire window?
(A) Zooming (B) Panning (C) Tiling (D) Roaming

Page 316

72. What determines the order of evaluation of a prefix expression?
(A) precedence and associativity (B) precedence only
(C) associativity only (D) depends on the parser

73. What are advantages of linked list representation of binary trees over arrays?
(A) dynamic size
(B) ease of insertion/deletion
(C) ease in randomly accessing a node
(D) both dynamic size and ease in insertion/deletion

74. Balanced binary tree with n items allows the lookup of an item in ____ worst-case time.
(A) O(log n) (B) O(nlog 2) (C) O(n) (D) O(1)

75. What does the central limit theorem state?
(A) if the sample size increases sampling distribution must approach normal
distribution
(B) if the sample size decreases then the sample distribution must approach normal
distribution
(C) if the sample size increases then the sampling distribution much approach an
exponential distribution
(D) if the sample size decreases then the sampling distribution much approach an
exponential distribution

x-x-x

(8)

Page 317

MSc(HS)(Physics/Medical Physics/Specialisation in Electronics)
1. A 3x3 matrix has elements such that its trace is 11 and its determinant is 36. The
eigenvalues of the matrix are all known to be positive integers. The largest eigenvalue
of the matrix is:
(A) 6 (B) 9 (C) 12 (D) 18

2. The temperature in Kelvin at which the average speed of H2 molecules will be same as
that of N2 molecules at 35 oC, will be:
(A) 495 (B) 295 (C) 42 (D) 22

3. When mechanical waves have a frequency below the audible range, these are called:
(A) Supersonics (B) Sonics (C) Infrasonics (D) Ultrasonics

4. The solutions to the differential equation (dy/dx) = -x/(y+1) are a family of:
(A) Straight lines with different slopes
(B) Straight lines with different intercepts on the y-axis
(C) Circles with different radii
(D) Circles with different centers

5. A satellite moving in circular orbit about the earth has a kinetic energy E k. What is the
minimum amount of energy to be added so that it can escapes from the earth?
(A) 2Ek (B) Ek (C) Ek/2 (D) Ek/4

6. A cube has density ρo when at rest. What is the density of the cube when it moves with
velocity v parallel to one of its sides?
(A) ρo (1-v2/c2)-1 (B) ρo (1-v2/c2)1/2
(C) ρo (1-v2/c2) (D) ρo (1-v2/c2)-1/2

7. In order to observe Raman effect, the wavelength of the source used:
(A) Can be anywhere in the electromagnetic spectrum
(B) Should be only in the ultraviolet region only
(C) Should be only in the infrared region only
(D) Should be only in the visible region only

8. A bomb at rest explodes in three segments of unequal masses. The most general
description of the final state is that:
(A) Two of them must fly off at right angles to each other
(B) Two of the three must go opposite to each other
(C) The fragments fly off in any arbitrary direction
(D) The fragments fly off in such a way that their directions lie in the same plane

9. If the momentum of an electron moving with a velocity 0.9m/s is increased by 1% then
the increase in its energy is:
(A) 0.5% (B) 0.9% (C) 1% (D) 0.81%

Page 318

10. A telescope has an objective lens of 10 cm diameter and is situated at a distance of 1km
from two objects. The minimum distance between these two objects, which can be
resolved by the telescope, when the mean wavelength of light is 5000 oA is of the order
of:
(A) 5 m (B) 2.5 m (C) 5 cm (D) 5 mm

11. Sij and Aij represent a symmetric and an antisymmetric real-valued tensor respectively
in three dimensions. The number of independent components of S ij and Aij are:
(A) 9 and 6 respectively (B) 6 and 6 respectively
(C) 6 and 3 respectively (D) 3 and 6 respectively

12. A hoop rolling down on an inclined plane without slipping its velocity at the bottom of
the inclined plane:
(A) 4gl sinφ/3 (B) (4gl sinφ/3 )1/2 (C) 2gl sinφ/3 (D) (2gl sinφ/3)1/2

13. If a shift of 100 circular fringes is observed when the movable mirror of Michelson’s
interferometer is shifted by 0.03 mm, then the wavelength of light used is:
(A) 1200 nm (B) 150 nm (C) 300 nm (D) 600 nm

14. The ultrasonic waves are not used in:
(A) Sound signaling
(B) Fire-fighting
(C) Investigation of the structure of the material
(D) In determining sea depth

15. The inverse of the complex number (3+4i)/(3-4i) is:
(A) [(-7/25)-(24i/25)] (B) [(7/25)-(24i/25)]
(C) [(-7/25)+(24i/25)] (D) [(7/25)+(24i/25)]

16. The velocity of longitudinal waves in quartz crystal is 5.46 x 10 3 ms-1. If the thickness
of the quartz crystal is 1mm, then the frequency of the ultrasonic wave generated by it
is:
(A) 5.46 kHz (B) 5.46 MHz (C) 2.73 kHz (D) 2.73 MHz

17. An open pipe of length 33 cm resonates to a frequency of 1000 Hz. The mode of
vibration:
(A) The first harmonic type (B) The second harmonic type
(C) The fourth harmonic type (D) Fundamental

18. The total energy of a vibrating string is:
(A) Directly proportional to the amplitude of vibration
(B) Directly proportional to the square of the amplitude of vibration
(C) Inversely proportional to the period of vibration
(D) Directly proportional to the period of vibration

Page 319

19. In case of a forced vibrations of resonance wave becomes very sharp when the:
(A) Applied oscillatory force is small (B) Quality factor is small
(C) Restoring force is small (D) Damping force is small

20. If e is the coefficient of restitution, then which one of the following gives the condition
for perfectly elastic bodies?
(A) e = 1.0 (B) e = 0.8 (C) e = 0.5 (D) e = 0

21. Which of the following is used in optical fibres?
(A) Scattering (B) Total internal reflection
(C) Interference (D) Reflection

22. A thin mica sheet of thickness 2 x 10-6 and refractive index (1.5) is introduced in the
path of one of the waves. The wavelength of the wave used is 5000 oA. The central
bright maximum will shift:
(A) 0.2 fringes (B) 10 fringes upward
(C) 2 fringes (D) 10 fringes downward

23. A Polaroid is placed at 45o to an incoming light of intensity Io. The intensity of light
passing through Polaroid after polarization would be:
(A) Zero (B) Io/4 (C) Io/2 (D) Io

24. Two light waves having their intensities in the ratio 16:9, interfere to produce
interference pattern. What is the ratio of maximum intensity to minimum intensity in
this pattern?
(A) 49:1 (B) 625:49 (C) 25:7 (D) 4:3

25. Sound waves are classified as longitudinal because:
(A) The particle displacements take place along the direction of propagation
(B) The pressure variations and the particle displacements are out of phase
(C) They always originate from a vibration source
(D) They require material medium to pass

26. The focal length of a zone plate is given by:
(A) 1/f = rn2/nλ (B) 1/f = nrn2/λ (C) 1/f = nλ/ rn2 (D) 1/f = λ/ nrn2

27. The minimum number of lines in a grating which may fully resolve in the second order
sodium line D1 (5890 oA) and D2 (5896 oA) should be:
(A) 499 (B) 491 (C) 984 (D) 982

28. Two star emitting yellow light of wavelength λ are at a distance D apart alog a line
perpendicular to the line of vision. They are at distance R (R>>D) form the point of
observation. If these two stars are to be resolved by a telescope, then the minimum
diameter of the lens should be:
(A) 1.22(λR/D) (B) λD/R (C) 1.22(λD/R) (D) 1.22λD

Page 320

29. A uniform solid cylinder of mass 2kg and radius 0.20m rolls without slipping on a flat
surface. If the total energy of the cylinder be 12J, its rotational kinetic energy will be:
(A) 3J (B) 4J (C) 6J (D) 8J

30. A charge Q flowing through a resistance R varies with time t as Q = at – bt 2? The total
heat produced in R is:
(A) a3R/b (B) a3R/3b (C) a3R/6b (D) a3R/2b

31. What is Poynting vector at the surface of a long cylindrical wire of radius R, length L
carrying a current I, when its ends are kept at potential difference of V?
(A) VI/πR2L (B) VI/2πRL (C) VI/(2πR3L+2πRL) (D) Zero

32. Two large parallel plates, separated by a distance of 3.0 mm, have a capacitance of 10
pF and are charged to a potential of 12V by a battery. The plates are disconnected from
the battery and pulled apart to 0.5 mm. The potential difference between the plates is:
(A) 20V (B) 12V (C) 7.2V (D) Zero

33. VAN-de-Graff generators are sometimes built horizontally, because they
(A) Accelerate protons (B) Accelerate electrons
(C) Are so small (D) Accelerated photons

34. A conductor wire having 1029 free electrons per m3 carries a current of 20A. If the cross-
section area of wire is 1 m2, then the drift velocity of electrons will be of the order of:
(A) 10 ms-1 (B) 10-1 ms-1 (C) 10-2 ms-1 (D) 10-3 ms-1

35. If the binding energy of electron in a hydrogen atom is 13.6 eV, the energy required to
remove the electron from the first excited state of Li ++ is:
(A) 122.4 eV (B) 30.6 eV (C) 13.6 eV (D) 3.4 eV

36. In an LCR circuit inductance is changed from L to L/2. To keep the same resonance
frequency, C should be changed to:
(A) C/4 (B) C/2 (C) 2C (D) 4C

37. If two particles of same mass having charges +q and +9q are allowed to fall from rest
through the same electric potential difference, then their speeds will be in the ratio of:
(A) 1:3 (B) 3:1 (C) 1:9 (D) 9:1

38. The value of lim (sin 2x/x) is equal to:
x→0
(A) 1 (B) 1/2 (C) 2 (D) 0

39. On a (T,S) diagram the isothermals are lines:
(A) at an angle 45o to X-axis (B) having slope of 0.8
(C) parallel to X-axis (D) parallel to the T-axis

Page 321

40. A Carnot engine takes in 3000 Kcal. Of heat from a reservoir at 627 oC and gives it to
sink at 27 oC. The work done by the engine is:
(A) Zero (B) 8.4 x 106 J (C) 4.2 x 106 J (D) 16.8 x 106 J

41. The thermal inertia of thermodynamic system is known as:
(A) Its isothermal condition (B) Its adiabatic condition
(C) Its entropy (D) Its enthalpy

42. The rate of radiation of a black body at 0 oC is E watt. Then the rate of radiation of this
black body at 27 oC will be:
(A) 16E (B) 8E (C) 4E (D) E

43. The temperature at which oxygen molecules will have the same r.m.s. velocity as that
of hydrogen at -100 oC is:
(A) 2500 oC (B) 2495 oC (C) 2768 oC (D) 3040 oC

44. A cup of tea cools from 65.5 oC to 62.5 oC in one minute in a room of 22.5 oC. How
long will the same cup of tea take to cool from 46.5 oC to 40.5 oC in the same room
(choose the nearest value in minutes):
(A) 4 (B) 3 (C) 2 (D) 1

45. The Clausius-Clapeyron equation indicates that an increase in pressure increases the
melting point, in case of:
(A) Substrate which neither expand nor contract on solidification
(B) Substrate which expand on solidification
(C) Substrate which contracts on solidification
(D) All substance

46. Which defect causes decrease in the density of the crystal?
(A) F-centre (B) Frankel (C) Schottky (D) Interstitial

47. The photoelectric threshold of tungsten is 2300 oA. The energy of the electrons ejected
from the surface by ultraviolet light of wavelength 1800 oA is:
(A) 15 eV (B) 10 eV (C) 1.5 eV (D) 0.15 eV

48. If the uncertainty in the position of proton is 6 x 10 -8 m, then the minimum uncertainty
in its speed will be:
(A) 100 m/s (B) 1 mm/s (C) 1 cm/s (D) 1 m/s

49. The essential distinction between X-rays and γ-rays is that:
(A) γ-rays have greater ionizing power than X-rays
(B) γ-rays have more penetrating than X-rays
(C) γ-rays have smaller wavelength than x-rays
(D) γ-rays emanate from nucleus while X-rays emanate from other parts of the atom

Page 322

50. A particle is in the second excited state of a one dimensional box of length 1m. What
is its momentum (in kg m/s)?
(A) 9.9 x 10-34 (B) 13.2 x 10-34 (C) 6.6 x 10-34 (D) 3.3 x 10-34

51. When the potential energy of a system is independent of time, the wave function of the
system:
(A) Is directly proportional to the time
(B) Is a constant
(C) Depends on the vector position r of each particle in the system
(D) Can not be normalized

52. The wavelength of the first line of Balmer series is 6563 oA. The Rydberg constant for
Hydrogen is about:
(A) 1.09 x 105 per m (B) 1.09 x 107 per m (C) 1.09 x 108 per m(D) 1.09 x 109 per m

53. A cyclotron is accelerating deuteron having a mass of 3.3 x 10 -27 kg and a charge of 1.6
x 10-19 C. The strength of the magnetic field B = 1.5 Weber/m2. The frequency of the
R.F. oscillator should approximately be:
(A) 3.7 mHz (B) 5.8 mHz (C) 11.6 MHz (D) 23.2 MHz

54. When an electron jumps from an orbit with n = 1 to another orbit with n = 2 in a singly
ionized helium atom, the change of orbital angular momentum of the electron will be:
(A) 3h/4π (B) h/4π (C) h/2π (D) Zero

55. If a solid state power supply having voltage regulation 25% has full load voltage of
20V, what will be its no load voltage?
(A) 50V (B) 40V (C) 25V (D) 20V

56. The element for which absorption coefficient is larger for a given wave length in X-
rays is:
(A) Aluminum (B) Copper (C) Lead (D) Lithium

57. The shortest wavelength series of hydrogen spectra is 91.2 nm, the longest wavelength
in this series must be:
(A) 121.6 nm (B) 364.8 nm (C) 182.4 nm (D) 243.2 nm

58. What is the difference between the number of atoms per unit cell in face centered cube
and the number of atoms per unit cell in body centered cube?
(A) 1 (B) 2 (C) 3 (D) 4

59. (1111)2 x (1001)2 =
(A) 1001000 (B) (1111000)2 (C) 10110010 (D) 10110110

Page 323

60. A triode, operating at an anode potential of 300 volt, has an amplification factor of 25.
The cut-off grid-bias of the triode is, approximately:
(A) +6 V (B) -6 V (C) -12 V (D) +12 V

61. A given metal crystallizes out with a cubic structure having edge length of 361 pm. If
there are four metal atoms in one unit cell, what is the radius of one atom?
(A) 127 pm (B) 108 pm (C) 80 pm (D) 40 pm

62. The ratio of close packed atoms to tetrahedral holes in cubic close packing is:
(A) 1:3 (B) 2:1 (C) 1:2 (D) 1:1

63. Fermi energy is the:
(A) Maximum energy possessed by an electron at 273 oK
(B) Minimum energy possessed by an electron at 273 oK
(C) Maximum energy possessed by an electron at 0 oK
(D) Minimum energy possessed by an electron at 0 oK

64. Speed of operation of third generation computer lies between:
(A) 30,000-3,00,000 thousands (B) 3,00,000-30,00,000 thousands
(C) 3,000-30,000 thousands (D) 40-3,000 thousands

65. The ratio of longest wavelength and the shortest wavelength observed in the five
spectral series of the emission spectrum of hydrogen is:
(A) 960/11 (B) 525/376 (C) 4/3 (D) 25:1

66. The input and output resistances of common base transistor are:
(A) low, very high (B) very low, very high
(C) high, low (D) low, low

67. A compound is formed by elements A and B. This crystallizes in the cubic structure
when atoms A are the corners of the cube and atoms B are at the centre of the body.
The simplest formula of the compound is:
(A) A2B2 (B) A2B (C) AB2 (D) AB

68. The data bytes operated on in ALU are called:
(A) Digits (B) Mnemonics (C) Operands (D) Op code

69. Thickness of the depletion region is of the order of:
(A) 10-7 cm (B) 10-6 cm (C) 10-5 cm (D) 10-4 cm

70. Select a ferromagnetic material from the following:
(A) Dihydrogen monoxide (B) Dioxygen
(C) Benzene (D) Chromium (IV) oxide

Page 324

71. The intensity of radiation emitted by the Sun has its maximum value at a wavelength
of 510 nm and that emitted by the North star has the maximum value at 350 nm. If these
stars behave like black bodies, then the ratio of the surface temperatures of the Sun and
the North star is:
(A) 0.69 (B) 0.83 (C) 1.21 (D) 1.46

72. A common emitter amplifier is designed with n-p-n transistor (α=0.99). The input
impedance is 1 KΩ and load is 10 KΩ. The voltage gain will be:
(A) 9900 (B) 990 (C) 99 (D) 9.9

73. The dominant mechanism for motion of charge carriers in forward and reverse biased
silicon p-n junction are:
(A) Diffusion in forward biased, drift in reverse biased
(B) Diffusion in both forward and reverse biased
(C) Drift in forward biased, diffusion in reverse biased
(D) Drift in both forward and reverse biased

74. The torque required to hold a small circular coil of 10 turns 2 x 10-4 m2 area and carrying
0.5 A current in the middle of a long solenoid of 103 turns/m carrying 3 A current, with
its axis perpendicular to the axis of the solenoid is:
(A) 2π x 10-7 Nm (B) 4π x 10-7 Nm (C) 6π x 10-7 Nm (D) 12π x 10-7 Nm

75. In a throttling process, which of the following remains constant?
(A) Enthalpy (B) Internal energy
(C) Gibbs free energy (D) Helmholtz free energy

x-x-x

(8)
Space for Rough Work

Page 325

Masters in Public Health
1. An effective hand sanitizer has following percentage of alcohol to kill the germs and
coronavirus.
(A) 30% (B) 45% (C) 60% (D) 80%

2. Natural history of disease is best studied by:
(A) Cohort study (B) Case control study
(C) Cross sectional study (D) Ecological study

3. The heart of randomization control trial is:
(A) Protocol (B) Intervention
(C) Randomization (D) None of the above

4. The ability of an infectious agent to invade and multiply in host is called:
(A) Pathogenicity (B) Infectivity (C) Virulence (D)
Communicability

5. Anti -Viral agent is:
(A) Chlorhexidine (B) Propionate (C) Hypochlorite (D) Phenol

6. Most specific screening test for Vitamin-D deficiency is:
(A) 7-dehydrocholesterol (B) 1,25 dihydroxy vitamin D
(C) 25 hydroxy vitamin D (D) Serum calcium levels

7. Diagnostic power of test is reflected by:
(A) Sensitivity (B) Specificity
(C) Predictive Value (D) Population attributable risk

8. MMR vaccine is recommended at the age of:
(A) 9-12 months (B) 15-18 months (C) 10-19 years (D) 2-3 years

9. True about Citrate in ORS is:
(A) Increases shelf life (B) Nutritious
(C) Cheaper (D) Tastier

10. Which is not true about dengue fever
(A) Thrombocytopenia (B) Hepatomegaly
(C) Shock (D) Plasma leaking

11. HIV virus was discovered in:
(A) 1981 (B) 1983 (C) 1986 (D) 1996

12. Shortest incubation period is associated with:
(A) Influenza (B) Cholera (C) Syphilis (D) AIDS
13. Diet to be prescribed in hypertension is:
(A) Fruits, vegetables and low salt diet
(B) Proteins, fiber and low salt diet
(C) Carbohydrates, fiber and low salt diet
(D) Low fat dairy food, fruits and vegetables

Page 326

14. The most common type of cancer among females is:
(A) Cervical cancer (B) Breast cancer
(C) Ovarian cancer (D) Colon cancer

15. Which of the following should be done to reduce obesity?
(A) Regular exercise with same amount of food
(B) Decrease fat intake and have stomach full
(C) Only reduce the amount of fat in the diet
(D) Reduce intake of fats, carbohydrates and proteins

16. National mental health policy in India was launched in:
(A) 1982 (B) 1987 (C) 1994 (D) 2014

17. What is correct for NDPS act?
(A) If requested, drug users sent for treatment not jail
(B) Alcoholism is included in drugs
(C) Farmers allowed to grow unlimited opium
(D) Equal punishment for drug users and peddlers

18. Food standards and safety authority of India comes under:
(A) Ministry of Consumer affairs (B) Ministry of Agriculture
(C) Ministry of Health and family welfare (D) Ministry of Rural development

19. Under MCH programme, iron and folic acid tablets given daily to mother has:
(A) 60 mg iron +500 mcg folic acid (B) 100mg iron +500 mcg folic acid
(C) 60 mg iron + 100 mcg folic acid (D) 100 mg iron +100 mcg folic acid

20. Limiting amino acids in wheat are:
(A) Methionine and Lysine (B) Lysine and Threonine
(C) Threonine and Methionine (D) Arginine and Lysine

21. Dental fluorosis is best seen in:
(A) Central and Lateral incisors (B) Central incisors and 1st Molars
(C) 1st and 2nd Molar (D) Canines

22. Which of the following is not secreted by human placenta?
(A) hCG (B) Estrogens
(C) Progesterone (D) Leutinizing hormone

23. Circular DNA is present in:
(A) Mitochondria (B) Golgi apparatus
(C) Lysosomes (D) Microbodies

24. Central Dogma states that genetic information flows from:
(A) DNA-RNA Protein (B) RNA-Protein-DNA
(C) Protein-RNA-DNA (D) RNA-DNA-Protein

25. An aerobic and symbiotic nitrogen fixing bacteria is:
(A) Rhizobium (B) Streptococcus (C) Azobactor (D) Clostridium

Page 327

26. Process of RNA interference is used in the plants resistant to:
(A) Insecticides (B) Nematodes (C) Fungi (D) Viruses

27. Which of the following is not word processing software?
(A) MS-Excel (B) MS-Word (C) Notepad (D) Wordpad

28. Where is RAM located in computer?
(A) Expansion Board (B) External Drive
(C) Mother Board (D) All of above

29. Which of the following is dead tissue?
(A) Sclereids (B) Collenchyma (C) Pericycle (D) Endodermis

30. Aedes mosquito grows in:
(A) Clean water (B) Artificial water collection
(C) Stagnant drains (D) Water bodies containing plants

31. Which of the following is not an indoor air pollutant?
(A) Carbon monoxide (B) Nitrous oxide
(C) Radon (D) Mercury

32. Air velocity is measured by:
(A) Hygrometer (B) Psychrometer
(C) Anemometer (D) Wet bulb thermometer

33. Waste water from kitchen is called:
(A) Refuse (B) Garbage (C) Sullage (D) Sewage

34. Vectors do not transmit infection by:
(A) Ingestion (B) Regurgitation
(C) Rubbing (D) Contamination with body fluids

35. What is the color coding of the bags in hospitals to dispose of human anatomical
waste?
(A) Yellow (B) Black (C) Red (D) Blue

36. Safe disposal of mercury is:
(A) Collect carefully and recycle (B) Controlled combustion
(C) Treatment with chemicals (D) Deep burial

37. Lead poisoning in industries commonly occur by:
(A) Inhalation (B) Ingestion
(C) Skin absorption (D) Conjunctival route

38. Nearly ¾ of the occupational cancers are:
(A) Skin cancer (B) Lung cancer
(C) Bladder cancer (D) Blood cancer

Page 328

39. Effect of environment on genes is called:
(A) Positive Eugenics (B) Negative Eugenics
(C) Euthenics (D) Ergonomics

40. Following is the principal of primary health care:
(A) Safe water supply and sanitation (B) Free medical care
(C) Equitable distribution (D) Local disease prevention and control

41. Rural health scheme was launched by:
(A) Bhore committee (B) Mukherjee committee
(C) Shrivastava committee (D) Murali committee

42. Which of the following is referred to as Ivory towers of disease?
(A) Small health centers (B) Large hospitals
(C) Private practitioners (D) Health insurance companies

43. Antenatal support is not delivered by:
(A) Anganwadi workers (B) Female health worker
(C) Female health assistant (D) Traditional birth attendant

44. “Clean care is Safe care”guidelines given by WHO is for :
(A) Hand hygiene (B) Obstetric care
(C) Cord care (D) Injection practices

45. WHO foundation day is:
(A) 5 May (B) 7 April (C) 10 June (D) 10 July

46. Quarantine was originally introduced as a protection against:
(A) Plague (B) Tuberculosis (C) Malaria (D) AIDS

47. Graph to correlate two quantitative data is:
(A) Histogram (B) Scatter diagram
(C) Line diagram (D) Frequency curve

48. Standard deviation is the measure of:
(A) Chance (B) Central tendency
(C) Deviation from mean value (D) None of these

49. Which can have more than one value?
(A) Mean (B) Median (C) Mode (D) Any of these

50. Measuring variation through different units is done through:
(A) Variance (B) Coefficient of variation
(C) Standard deviation (D) Range

51. World environment day is celebrated on:
(A) 5 April (B) 7 September (C) 24 March (D) 5 June

Page 329

52. Biomedical concept of health is based on:
(A) Germ theory of disease (B) Absence of pain
(C) Social and Psychological factors (D) Equilibrium between man and environment

53. Which is not a mortality indicator?
(A) Years of potential life lost (B) Life expectancy
(C) IMR (D) Disability limitation

54. Immunization is:
(A) Primary Prevention (B) Secondary Prevention
(C) Tertiary Prevention (D) Disability limitation

55. Disease elimination is helped by:
(A) Herd immunity (B) Isolation (C) Quarantine (D) None of these

56. The increased use of groundwater for irrigation purpose has led to :
(A) Salinization (B) Lowering of water table
(C) Water logging (D) All of these

57. Most of the red, blue and purple colors of plants are due to a pigment called:
(A) Anthocyanin (B) Carotene (C) Chlorophyll (D) Xanthophyll

58. The compound in bile which emulsify fat in duodenum is:
(A) Bile salts (B) Biliverdin (C) Bilirubin (D) Cholesterol

59. In tooth, hardest part is considered to be:
(A) Enamel (B) Odontoblast layer (C) Dental tubules (D) Dentine

60. Number of chromosomes in Down’s Syndrome is:
(A) 46 (B) 47 (C) 48 (D) 49

61. The ABO blood groups were discovered by:
(A) Charles Darwin (B) Karl Landsteiner
(C) Gregor Mendel (D) Watson

62. Human Blood is viscous fluid due to:
(A) Platelets in plasma (B) Proteins in blood
(C) RBC and WBC in blood (D) Sodium in serum

63. Non-Clotting of blood is caused by the deficiency of:
(A) Vitamin A (B) Vitamin C (C) Vitamin E (D) Vitamin K

64. Other than spreading malaria, anopheles mosquitoes are also vectors of:
(A) Dengue fever (B) Filariasis (C) Encephalitis (D) Yellow fever

65. Most abundant tissues of our body are:
(A) Muscles (B) Connective (C) Epithelial (D) Nervous

Page 330

66. Synthesis of antibodies takes place by which of following cells.
(A) Bone marrow cells (B) T-cells
(C) B-cells (D) Lymph

67. Which immunoglobin can pass through placenta?
(A) IgD (B) IgE (C) IgM (D) IgG

68. Name of the gland which secrete melatonin?
(A) Pituitary gland (B) Pineal gland (C) Thyroid gland (D) Hypothalamus

69. Insecticides usually acts on:
(A) Muscular system (B) Digestive system
(C) Nervous system (D) Circulatory system

70. Secondary sewage treatment is mainly a:
(A) Physical process (B) Mechanical process
(C) Chemical process (D) Biological process

71. The molecular action of Ultraviolet light is mainly reflected through:
(A) Destruction of hydrogen bonds in DNA
(B) Photodynamic action
(C) Formation of pyrimidine
(D) Formation of sticky metaphase

72. Spraying of DDT on crops produce pollution of:
(A) Soil and water only (B) Air and soil only
(C) Air, soil and water (D) Air and water only

73. Rich source of fiber:
(A) Spinach (B) Wheat (C) Gram (D) Ragi

74. The best parameter for assessment of chronic malnutrition is:
(A) Weight for age (B) Weight for height
(C) Height for age (D) Any of these

75. Most important essential fatly acid in diet is:
(A) Linoleic acid (B) Arachidonic acid
(C) Oelic acid (D) Palmitic acid

x-x-x

Page 331

M.A. (Social Work)
1. The term of the Rajya Sabha is-
(A) 3 years (B) 4 years (C) 5 years (D) 6 years

2. Who is the Chairman of the Rajya Sabha -
(A) The President (B) The Vice-President
(C) The Lok Sabha Speaker (D) The Chief Justice of Supreme Court

3. Who is not answerable to any court-
(A) President (B) Vice-President
(C) Prime Minister (D) Speaker Lok Sabha

4. Dada Saheb Phalke Award is associated with-
(A) Literature (B) Film Industry
(C) The best sports person (D) The best musician

5. Arjuna Award is presented to-
(A) The best singer (B) The best actor
(C) The best sports person (D) The best musician

6. Indian Currency notes are printed at-
(A) Mumbai (B) Kolkata (C) Nasik (D) Hyderabad

7. Indian Security Printing Press is located at-
(A) Secundrabad (B) Hyderabad (C) Dewas (D) Hoshangabad

8. The term GDP stands for-
(A) Gross Daily Product (B) Gross Democratic Product
(C) Gross Domestic Product (D) None of these

9. “World No Tobacco Day” is observed by WHO every year on ________.
(A) April 17 (B) May 31 (C) June 20 (D) July 11

10. India’s first large state to record 100 first doze vaccinations till January 2022-
(A) Telangana (B) Odisha (C) Tamil Nadu (D) Karnataka

11. Which football legend’s statue has been unveiled in Panaji (Goa)
(A) Sunil Chetri (B) Bhaichung Bhutia
(C) Cristiano Ronaldo (D) Lionel Messi

12. Indian appointed as New Vice President of Asian Infrastructure Investment Fund
(AIIB)-
(A) Raghuram Rajan (B) Urjit Patel
(C) D. Subbarao (D) Y.V. Reddy

13. Who among the following is a Nobel Prize winner?
(A) V.S. Naipaul (B) J.M. Keynes
(C) Shivnarine Chanderpaul (D) Ramnaresh Sarwan

Page 332

14. Who discovered the vast continent, later known as America?
(A) Vasco da Gama (B) Christopher Columbus
(C) V.S. Naipaul (D) None of these
15. Until 18th century which two countries were considered the richest in the world?
(A) India and China (B) China and Japan
(C) England and France (D) England and Italy

16. Transport of perishable goods over long distance was possible because of-
(A) improved railways (B) Airline services
(C) Refrigerated ships (D) Steam ships

17. The First World War was fought mainly in
(A) Asia (B) Europe (C) America (D) Africa

18. Common foods like potatoes, groundnuts, maize, tomatoes, chillies, sweet potatoes
were introduced in
(A) Europe (B) China (C) Africa (D) Australia

19. Who worked in American plantations during the 18th century:
(A) Emigrants from Europe (B) Slaves captured from Africa
(C) Unemployed population of America (D) Emigrants from India

20. During the First World War women in Europe stepped into jobs which earlier men
were expected to do. The reason was ________.
(A) Because men went to battle
(B) Because men went to other countries in search of jobs
(C) Because of liberalisation of women in society
(D) Because menfolk decided to take charge of the household work

21. Full form of ‘ASD'
(A) Autism spectrum disorder (B) Autism sensory disorder
(C) Autism some disorder (D) All of these

22. Specific learning disability according to RPWD Act 2016 ________.
(A) Dyslexia (B) Dyscalculia (C) Dysgraphia (D) All of these

23. Distance education system is helpful for –
(A) Professionals (B) Students (C) Adult (D) All of these

24. What is the full form of NPE 2020
(A) National Price of Education (B) National Policy of Education
(C) National policy of Exam (D) None of these

25. Man is a Social Animal is given by-
(A) Aristotle (B) Plato (C) Comte (D) Durkheim
26. In some communities, the groom’s family compensates the bride’s family for her
hand in marriage. This is the practice of:
(A) Bride Service (B) Bride Wealth
(C) Dowry (D) Groom Wealth

Page 333

27. The relationship between a caregiver and infant is considered which type of
relationship?
(A) Intimate (B) Friend (C) Acquaintance (D) Romantic
28. The classic avoidance relationship is between which two individuals?
(A) Father-in-law and daughter-in-law (B) Mother and son
(C) Father and daughter (D) Mother-in-law and son-in-law

29. In traditional times, which type of marriage was the norm in Nigeria?
(A) Child marriage (B) Arranged marriage
(C) Love marriage (D) Civil marriage

30. Power to appoint members of UPSC rest with-
(A) President (B) Prime Minister
(C) Parliament (D) Ministers of Home Affairs

31. The first World Telecommunication Day is celebrated in the year ________.
(A) 1970 (B) 1969 (C) 1968 (D) 1965

32. Indian States not sharing border with Myanmar-
(A) Arunachal Pradesh (B) Nagaland
(C) Assam (D) Manipur

33. The “Five Treasures of Great Snows” is which peak?
(A) Mount Everest (B) Nanda Devi
(C) Kanchenjunga (D) Dhaulagiri

34. Countries of the world with no mountains-
(A) Ukraine (B) Vatican City (C) Monaco (D) All of these

35. The nodal agency of Ayushman Bharat Digital Mission-
(A) ICMR (B) AIIMS (C) NHA (D) Nitti Aayog

36. Ford’s passenger vehicle manufacturing plant at Sanand in Gujarat was taken over by-
(A) Mahindra and Mahindra (B) Hyundai
(C) Tata Motors (D) Toyota

37. Which country has recently voted to join the European Union’s Defence policy?
(A) Switzerland (B) Denmark (C) Malta (D) Vatican City

38. Which State/U.T. have Panna Tiger Reserve ________.
(A) Maharashtra (B) Gujarat (C) Madhya Pradesh (D) Rajasthan

39. The Indian Air Force (IAF) signed an MoU with which Union Territory to set up
Indian Air Force Heritage Centre?
(A) Puducherry (B) Ladakh (C) Chandigarh (D) Lakshadweep
40. What will happen if earth stops rotating on its axis?
(A) All parts of the earth will remain in darkness forever
(B) All parts of the earth will receive sunshine all the time

Page 334

(C) Some parts will have daylight forever and some parts will be in darkness all the
time
(D) There will be no effect on the occurrence of day and night
41. Which legal body has the power to enforce the fundamental rights in India?
(A) Parliament of India (B) Supreme Court of India
(C) Human Right Commission (D) Ministry of Home affairs

42. In Social Case Work Interview is an important _______.
(A) Tool (B) Method (C) Technique (D) Principle

43. The Protection of Women from Domestic Violence Act come into force in the year-
(A) 2006 (B) 2002 (C) 1990 (D) 2005

44. Social Justice is a balance between ________.
(A) Individual right and social control (B) Society and Individuals
(C) Fundamental right and judicial system (D) Individual and family

45. Social Policy is a part of ________.
(A) Economic Policy (B) Political Policy
(C) Religions Policy (D) Public Policy

46. Central Social Welfare Board was established in-
(A) 1980 (B) 1970 (C) 1953 (D) 1950

47. The first Indian School of Social Work was started in India in the year 1936 at
________.
(A) New Delhi (B) Mumbai (C) Calcutta (D) Chennai

48. Elizabethan Poor Law is also known as-
(A) 23 Elizabeth (B) 33 Elizabeth (C) 43 Elizabeth (D) 53 Elizabeth

49. Cleaning a village by volunteers is an example of ________.
(A) Social Work (B) Social Service (C) Social Welfare (D) Charity Work

50. Rashtriya Swasthya Bima Yojana was launched in-
(A) April 2008 (B) March 2014 (C) April 2016 (D) March 2019

51. Pradhan Mantri Awaas Yojana was launched in the year-
(A) June 2014 (B) June 2015 (C) June 2017 (D) June 2018

52. French Revolution took place in the year:
(A) 1776 (B) 1789 (C) 1798 (D) 1898

53. At the time of French Revolution, the King of France was-
(A) Edward III (B) Louis XIV (C) Louis XVI (D) Czar IX

54. ‘Every individual has certain rights which cannot be taken away by any authority’ was
said by ________.
(A) Rousseau (B) Hobbes (C) Locke (D) Montesquieu

Page 335

55. Marx studied society in-
(A) Holistic way (B) Conceptual way
(C) Methodological way (D) Factual way

56. Realism holds that-
(A) Group is not real (B) Group is as real as the person
(C) Person is real (D) Society is real

57. A sociological theory is a set of ideas which provides and explanation for-
(A) Continental society (B) Human society
(C) Human behaviour (D) Global society

58. There are two types of definition of society ________.
(A) Structural and Interactional (B) Structural and Functional
(C) Evolutionary and Diffusive (D) Structural and Evolutionary

59. The first stage of human society was of ________.
(A) Agriculture (B) Pastoralist
(C) Hunting and food gathering (D) Cottage industries

60. Two essential qualities of culture-
(A) Learned and shared (B) Transmitted and shared
(C) Learned and forgotten (D) Shared and communicated

61. The process by which an individual learns the culture of their society is ________.
(A) Sanskritization (B) Modernization (C) Internalization (D) Socialization

62. A norm is a ________.
(A) Specific guide to action (B) Culture of society
(C) Guideline for socialization (D) Guideline for social interaction

63. A value is a belief that something is-
(A) Moral (B) Very productive in society
(C) Good and desirable (D) Cultural

64. In which process is the individual united with the group-
(A) Socialization (B) Integration (C) Alienation (D) Un-socialization

65. To prepare for future roles is-
(A) Futurization (B) Prediction
(C) Anticipatory socialization (D) Internalization

66. Interaction between members or groups with different culture is-
(A) Touch of culture (B) Cultural diffusion
(C) Culture contact (D) Accultration

67. A stable society is a prerequisite for-
(A) Bureaucracy (B) Culture
(C) An integrated personality (D) Family

Page 336

68. Lack of relationship with other culture is-
(A) Isolation (B) Insularity (C) Separation (D) Polarity

69. In society differences grow due to ________.
(A) Isolation (B) Non-socialization
(C) Specialization (D) Socialization

70. Marriage is a ________.
(A) Folkway (B) Mores (C) Social institution (D) Social norm

71. Khasi tribes living in the hills of Meghalaya are-
(A) Patrilineal (B) Matrilineal (C) Bi-lineal (D) Cognatic

72. Jajmani system indicated a set of________.
(A) Political affiliation (B) Caste dominance
(C) Economic relations (D) Social obligation

73. Cities and towns came into existence due to ________.
(A) Movement of population (B) Growth of agriculture
(C) Industrialization (D) Development of commerce

74. The essential characteristic of the rural society ________.
(A) Individualism (B) Parochialism
(C) Heterogeneity (D) Face-to-face relation

75. Who was the chairperson of the National Commission on Self Employed Women and
Women in Informal Sector in 1987?
(A) Vina Mazumdar (B) Ela Bhat
(C) Madhuri Shah (D) Armaity Desai

x-x-x

Page 337

M.Sc. Statistics
1. The modulus of z = {(1 + cosθ + i sinθ) / (1 + cosɸ + i sinɸ)} is:

A. |z| = {√(1 + cosθ) / √(1 + cosɸ)}

B. |z| = {√(1 – cosθ) / √(1 + cosɸ)}

C. |z| = {√(1 + sinθ) / √(1 + cosɸ)}

D. |z| = {√(1 + cosθ) / √(1 + sinɸ)}

2. Let f(z) be defined by

f(z) = {((x3 + y3) / (x2 + y2))+ i ((y3 – x3) / (x2 + y2))} for x2+y2 ≠ 0
and = 0 for x2+y2 = 0.

Then

A. Cauchy-Riemann conditions are satisfied at the origin, and 𝑓 (0) exist.
B. Cauchy-Riemann conditions are satisfied at the origin, and 𝑓 (0) does not exist.
C. Cauchy-Riemann conditions are not satisfied at the origin, and 𝑓 (0) exist.
D. Cauchy-Riemann conditions are not satisfied at the origin, and 𝑓 (0) does not exist.

3. The all real numbers satisfying the inequality |3x + 2 | > 5 are:
A. All x in the closed Interval [− 8/3, 1]
B. All x in the closed Interval [− 7/3, 2]
C. All x not in the closed Interval [− 8/3, 2]
D. All x not in the closed Interval [− 7/3, 1]

4. A new spherical ball bearing has a 3.00-inch radius, r. What is the approximate volume of metal
lost after it wears down to r = 2.98 inches? Work out only up to two decimal places.
A. 4.46 cubic inches
B. 3.36 cubic inches
C. 2.26 cubic inches
D. 1.16 cubic inches

5. The derivative of: f(s) = {s / (√(s2 – 1))} with respect to s is:
A. (2) / ((s2 – 1)3/2)
B. (−2) / ((s2 – 1)3/2)
C. (1) / ((s2 – 1)3/2)
D. (−1)((s2 – 1)3/2)

Page 338

/
6. The derivative of: 𝑦 = log with respect to x is:
A. {(4x) / (1 + x2)}
B. {(2x) / (1 − x2)}
C. {(2x) / (1 + x2)}
D. {(4x) / (1 − x2)}

7. The domain of the function 𝑦 = √ 𝑥/(2 − 𝑥) is:
A. 0 ≤ x ≤ 4
B. 1 ≤ x< 2
C. 1<x ≤ 2
D. 0 ≤ x< 2
8. Integrate: ∫ (x / (x + 1))dx
A. x – 2 log(x + 1) + K
B. 2x – 2 log(x - 2) + K
C. 2x – 2 log (x + 1) + K
D. 2x – 2 log(x - 1) + K
(Here K is a constant)

9. The series (1/(1 + √1)) + (1/(1 + √2)) + (1/(1 + √3)) + ((1/(1 + √4))+……. is:
A. Divergent
B. Convergent
C. Oscillatory
D. Converges to the sum 1/2.
10. If 𝑦 = 𝑒 √ , then dy/dx is:
A. 𝑒 √ ∙ {(3𝑥)/ {2 √(𝑥 + 𝑏)}}
B. 𝑒 √ ∙ {(3𝑥 )/ {2 √(𝑥 + 𝑏)}}
C. 𝑒 √ ∙ {(2𝑥 )/ {2√(𝑥 + 𝑏)}}
D. 𝑒 √ ∙ {(2𝑥) / {2 √(𝑥 + 𝑏)}}
11. If P and Q are symmetric matrices of the same order, then PQ -QP is:
A. Skew symmetric matrices
B. Symmetric matrix
C. Zero matrix
D. Identity matrix
12. If 𝑦 = 𝑐𝑜𝑠 (𝑥), then in terms of y is
A. cot(𝑦). 𝑠𝑒𝑐 (𝑦)
B. tan(𝑦). 𝑐𝑜𝑠𝑒𝑐 (𝑦)
C. – tan(𝑦). 𝑠𝑒𝑐 (𝑦)
D. – cot(𝑦). 𝑐𝑜𝑠𝑒𝑐 (𝑦)
1 𝑥 𝑥
13. The determinant of matrix 𝑥 1 𝑥 is
𝑥 𝑥 1
A. (1 − 𝑥 )
B. (1 − 𝑥 )
C. (1 − 𝑥 )
D. (1 − 𝑥 )

Page 339

( )
, 𝑖𝑓 𝑥 ≠
14. For which value of constant k, the function 𝑓(𝑥) = , is continuous at 𝑥 =
3, 𝑖𝑓 𝑥 =
.

A. 3
B. 4
C. 5
D. 6

15. If 𝑦 = 𝑡𝑎𝑛 , √ < 𝑥 < √ , then is
A.

B.

C.

D.

| |
16. The integral I = ∫ dx, where a < b, is:
A. (b − a)
B. (a − b)
C. (|b| − |a|)
D. (|a| − |b|)

17. The integral I = ∫ √ dx is
A. 3
B. 2
C. 1
D. 0
18. The integral I = ∫ Sin √(x) dx is:
A. 0
B. 1
C. 2
D. 3
sin x
1
19. The limit lim   is:
x  0 x
 
A. 3
B. 2
C. 1
D. 0
a b c
20. The value of determinant ∆= b c a where a, b and c are positive and unequal, is:
c a b
A. 0
B. Negative
C. Positive
D. Either Positive or Negative

Page 340

21. The differentiation of the function 𝑡𝑎𝑛 with respect to x is:
A. 1/2
B. 1/3
C. 1/4
D. 1/5

22. The particular solution of the differential equation log = 3x + 4y given that y = 0 when
x = 0 is:
A. 4e + 3e −7=0
B. 4e + 3e − 7 = 0
C. 4e + 3e −7=0
D. 4e + 3e − 7 = 0
23. The integral I = ∫ dx is

A.

B.

C.

D.
24. The differentiation of the function 𝑥 , 𝑥 > 0, with respect to x is:
A. x Cos x + x Cos x log x

B. x Cos x + x Sin x(log x)

C. x Sin x + x Cos x(log x)

D. x Sin x + x Cos x log 𝑥
25. The number of values of k for which the system of equations (𝑘 + 1)𝑥 + 8𝑦 = 4𝑘 and
𝑘𝑥 + (𝑘 + 3)𝑦 = 3𝑘 − 1 has infinitely many solution, is/are:
A. 0
B. 1
C. 2
D. ∞
1 𝛼 3
26. If 𝑃 = 1 3 3 is the adjoint of a 3 × 3 matrix A and |𝐴| = 4, then 𝛼 is equal to:
2 4 4
A. 4
B. 11
C. 5
D. 0
27. The set of all values of 𝜆 for which the system of linear equations 2𝑥 − 2𝑥 + 𝑥 = 𝜆𝑥 , 2𝑥 −
3𝑥 + 2𝑥 = 𝜆𝑥 and − 𝑥 + 2𝑥 = 𝜆𝑥 has a non-trivial solution:

A. is an empty set

Page 341

B. is a singleton set
C. contains two elements
D. contains more than two elements’

 1 2 n 
28. lim   ...   is equal to
n 1  n 2
1 n 2
1  n2 


A. - 1/4
B. - 1/2
C. 1/2
D. 1/4

29. The integral ∫ √ 𝑑𝑥 is:

A. +1

B. −1

C. – 1
D. + 1

30. Let 𝑦(𝑥) be the solution of the differential equation
𝑑𝑦
(𝑥 𝑙𝑜𝑔𝑥) + 𝑦 = 2𝑥 log 𝑥, 𝑥 ≥ 1
𝑑𝑥
Then, 𝑦(𝑒) is equal to:
A. e
B. 2e
C. 0
D. 2

31. If + = , Then

A. + =

B. + =

C. + =

D. + =

32. Given 𝑃 = 𝑆𝑖𝑛 𝜃 + 𝐶𝑜𝑠 𝜃, then for all real values of 𝜃:

A. 1 ≤ 𝑃 ≤ 2

Page 342

B. ≤𝑃≤1

C. ≤𝑃≤1

D. ≤𝑃≤

33. The value of 𝐶𝑜𝑠(2 𝐶𝑜𝑠 𝑥 + 𝑆𝑖𝑛 𝑥) at 𝑥 = , where 0 ≤ 𝐶𝑜𝑠 𝑥 ≤ 𝜋 and

− ≤ 𝑆𝑖𝑛 𝑥≤ is:

√
A. −
√
B.
√
C. −
√
D.

34. The solution of the equation log log √(𝑥 + 5) + √𝑥 = 0 is:

A. 1
B. 2
C. 3
D. 4

35. If 𝛼 and 𝛽 are the roots of equation 𝑥 − 2𝑥 + 4 = 0, then 𝛼 + 𝛽 , n being a positive
integer, is:

A. 2 cos
B. 2 cos
C. 2 cos
D. 2 cos 𝑛𝜋

36. If 𝑧 + ≤ 2, then 𝑧 + can’t exceed

A. 2
B. 1
C. √2
D. √2 - 1
8 −6 2
37. The Eigen values of the matrix −6 7 −4 are:
2 −4 3
A. 0, 3, 5
B. 0, 3, 10
C. 0, 3, 15
D. 0, 3, 20

Page 343

38. The double integral ∬ 𝑥𝑦 𝑑𝑥 𝑑𝑦, where A is the domain bounded by x-axis, ordinate
𝑥 = 2𝑎 and the curve 𝑥 = 4𝑎𝑦, is equal to:

A.

B.

C.

D.
39. The double integral ∬ (𝑥 + 𝑦) 𝑑𝑥 𝑑𝑦, where R is the parallelogram in the xy-plane with vertices
(1,0), (3,1), (2,2), (0,1) using the transformation 𝑢 = 𝑥 + 𝑦 and 𝑣 = 𝑥 − 2𝑦, is equal to:

A. 19
B. 21
C. 23
D. 25

40. The integral ∫ 𝑑𝑧, where c is the circle 𝑐: |𝑧| = 1, is equal to

A. 0
B. 1
C. 2
D. 3
41. The integral ∫ tan 𝑧 𝑑𝑧, where c is the circle 𝑐: |𝑧| = 2, is equal to

A. −2𝜋𝑖
B. 2𝜋𝑖
C. 4𝜋𝑖
D. −4𝜋𝑖
42. The product of real roots of the equation |x| − 26|x| − 27 = 0 is:

A. −3
B. −3
C. −3
D. −3

43 If b < 0, then the roots x and x of the equation 2x + 6x + b = 0, satisfy the condition +
< 𝑘, where k is equal to:

A. – 3
B. – 5

Page 344

C. – 6
D. – 2

44. The number of roots of the equation + √( )
= is:

A. 0
B. 1
C. 2
D. 3

45. The sum S to n terms of the series + + + + ⋯ is equal to:

A. 2 − n − 1
B. 1 − 2
C. 2 + n − 1
D. 2 − 1

46. If 5 = 7 , then x is equal to:

A.
B.

C. log 7
D. log 5

47. If A is a 3 × 3 skew symmetric matrix, then trace of A is equal to:

A. 1
B. 3
C. -1
D. |A|
48. If A and B are two distinct matrices such that A = B and A B = B A, then determinant of
(A + B ) is:

A. 0
B. 1
C. 2
D. 3
 
sin  x 
3 
49. lim is equal to:
 2 cos x  1
x
3

A.

B. √

C. √3

Page 345

D.
√

50. The set of all points where the function 𝑓(𝑥) = |𝑥|𝑆𝑖𝑛𝑥 is differentiable is:

A. (−∞, ∞)
B. (−∞, 0) ∪ (0, ∞)
C. (0, ∞)
D. [0, ∞)

51. If 𝑃(𝐵) = 3/4, 𝑃 𝐴 ∩ 𝐵 ∩ 𝐶 = 1/3 and 𝑃 𝐴̅ ∩ 𝐵 ∩ 𝐶 = 1/3, then 𝑃(𝐵 ∩ 𝐶) is equal to:
A. 1/12
B. 1/6
C. 1/15
D. 1/19

52. If M and N are any two events, then the probability that exactly one of them occurs is:

A. 𝑃(𝑀) + 𝑃(𝑁) − 𝑃 𝑀 ∩ 𝑁
B. 𝑃(𝑀) + 𝑃 𝑁 − 𝑃(𝑀 ∩ 𝑁)
C. 𝑃 𝑀 + 𝑃 𝑁 − 2 𝑃 𝑀 ∩ 𝑁
D. 𝑃 𝑀 + 𝑃(𝑁) − 2 𝑃 𝑀 ∩ 𝑁

53. If two events A and B are such that 𝑃 𝐴 = 0.3, 𝑃(𝐵) = 0.4 and 𝑃 𝐴 ∩ 𝐵 = 0.5, then
𝑃 𝐵| 𝐴 ∪ 𝐵 is:
A. 1/2
B. 1/3
C. 1/4
D. 1/5
54. A and B are two independent events. The probability that both A and B occur is 1/6 and the
probability that neither of them occurs is 1/3. Then the probability of occurrence of A is:

A. 1/6
B. 1/5
C. 1/4
D. 1/3
55. If the mean and variance of a binomial variate X are 2 and 1 respectively, then the probability that
X takes a value greater than one is equal to:
A. 7/20
B. 11/16
C. 13/18
D. 12/23

56. A set of n values 𝑥 , 𝑥 , … , 𝑥 has standard deviation 𝜎. The standard deviation of n values 𝑥 +
𝑘, 𝑥 + 𝑘, … , 𝑥 + 𝑘 (where k is a constant) is:

A. 𝜎
B. 𝜎 + k
C. 𝜎 - k

Page 346

D. 𝑘 𝜎
57. The mean of 100 observations is 50 and their standard deviation is 5. The sum of all squares of all
the observations is:
A. 50000
B. 250000
C. 252500
D. 255000

58. The standard deviation of some temperature data in ℃ is 5. If the data were converted into℉, the
variance would be:
A. 81
B. 57
C. 36
D. 25
59. The mean deviation of data, when measured from the median, is:
A. 0
B. 1
C. Largest
D. Least

60. For any discrete distribution, the general relation between standard deviation (𝜎) and the mean
deviation taken from the arithmetic mean (𝑀𝐷) is:
A. 𝜎 < 𝑀𝐷
B. 𝜎 ≥ 𝑀𝐷
C. 𝜎 = 𝑀𝐷
D. 𝜎 ≠ 𝑀𝐷
61. In a leap year, the probability of having 53 Sundays or 53 Mondays is:
A. 2/7
B. 3/7
C. 4/7
D. 5/7

62. Three of the six vertices of a regular hexagon are chosen at random. What is the probability that the
triangle with these vertices is equilateral?
A. 3/10
B. 3/20
C. 1/20
D. 1/10

63. The probability of simultaneous occurrence of at least one of two events A and B is p. If the
probability that exactly one of A, B occurs is q, then 𝑃 𝐴 + 𝑃 𝐵 is:
A. 1 − 𝑝 − 2𝑞
B. 1 − 2𝑝 − 𝑞
C. 2 − 2𝑝 + 𝑞
D. 2 − 𝑝 − 2𝑞

Page 347

64. 10% of the bulbs produced in a factory are of red colour and 2% are red and defective. If one bulb
us picked at random, the probability of its being defective if it is red, is:
A. 1/5
B. 2/5
C. 3/4
D. 5/6

65. A committee of 4 students is selected at random from a group consisting of 8 boys and 4 girls.
Given that there is at least one girl on the committee, what is the probability that there are exactly
2 girls on the committee?
A. 12/13
B. 113/215
C. 43/58
D. 168/425

66. Let X be a discrete random variable assuming values 𝑥 , 𝑥 , … , 𝑥 with probabilities 𝑝 , 𝑝 , … , 𝑝 ,
respectively. Then variance of X is given by:

A. 𝐸(𝑋 )
B. 𝐸(𝑋 ) + 𝐸(𝑋)
C. 𝐸(𝑋 ) − 𝐸(𝑋)
D. 𝐸(𝑋 ) + 𝐸(𝑋)

67. The random variable X can take only values 0, 1, 2. Given that 𝑃(𝑋 = 0) = 𝑃(𝑋 = 1) = 𝑝 and
that 𝐸(𝑋 ) = 𝐸(𝑋), then the value of p, is:
A. 1/4
B. 1/2
C. 3/4
D. 4/5

68. A manufacturer who produces medicine bottles, finds that 0.1% of the bottles are defective. The
bottles are packed in boxes containing 500 bottles. A drug manufacturer buys 100 boxes from the
producer of bottles. Using Poisson distribution, how many boxes will contain no defectives?
A. 100 e .
B. 100 e .
. )
C. 100(1 − e
.
D. 100(1 − e )

69. The mean of a binomial distribution is 20 and the standard deviation is 4. Then n is:
A. 25
B. 50
C. 75
D. 100
70. Suppose that half of the population of a town is consumers of rice. One hundred investigators are
appointed to find out its truth. Each investigator interviewed 10 individuals. How many
investigators do you expect to report that three or less of the people interviewed are consumers of
rice?

Page 348

A. 11800

B. 13400

C. 15000

D. 17600

71. For a random variable X~N(μ, σ ), the mean deviation about μ is:

A. σ

B. σ

C. σ

D. σ

72. For a random variable X~N(μ, σ ), μ ± 2σ covers approximately an area of:
A. 85%
B. 90%
C. 95%
D. 99%

73. The regression coefficients are:

A. independent of change of origin and scale
B. independent of change of origin but not of scale
C. independent of change of scale but not of origin
D. neither independent of change of origin nor of scale

74. The coefficient of correlation between two variable X and Y is 0.3. Their covariance is 9. The
variance of X is 16. The standard deviation of Y is:
A. 7.0
B. 7.5
C. 8.5
D. 9.5
75. In simple random sampling without replacement, the variance of the sample mean y , based on
a sample of size n from a population of size N, is:

(A) S (B) S (C) S (D) S
x-x-x
(12)
Space for Rough Work

Page 349

MSc(2Yr)(Stem Cell & Tissue Engineering)
1. The protein bands in an electrophoretogram can be identified using which of the
following staining methods
(A) Coomassie brilliant blue (B) Ethidium bromide
(C) Crystal violet (D) Methylene blue

2. All of the following statements are true for ribosomal RNA except one, Select the false
statement
(A) rRNAs acquires a secondary as well as tertiary structure
(B) Folding is driven by hydrophobic interactions
(C) It has double helical stems and single stranded loop structures
(D) rRNA also has nonstandard base pairs and modified nucleosides

3. A microbial mutant that is unable to synthesize an essential metabolite and hence the
metabolite is required as a nutritional supplement for growth is termed as;
(A) Myxotroph (B) Prototrophs (C) Auxotroph (D) Diazotroph

4. The genome in different species that have a common origin will be termed as;
(A) Orthologues (B) Paralogues (C) Analogues (D) Synlogues

5. In an allergic reaction, which of the following types of antibodies will be generated
against the antigen;

(A) IgD (B) IgE (C) IgG (D) IgM

6. All the following statements are true for true for gel exclusion chromatography, except
one. Identify which is not a true statement;
(A) A characteristic elution volume for each protein is the basis for separation of a
protein
(B) Sum of void volume and gel matrix inclusion equals the total volume of the column
(C) Smallest size protein molecules are used to calculate the void volume of the column
(D) The volume contained within the gel particles constitutes the inclusion volume

7. The resolution of a microscope is regulated by all of the following features, except?
(A) Numerical aperture of objective lens
(B) Numerical aperture of a condenser lens
(C) Wavelength of the illuminating light
(D) Wavelength of the transmitted light

8. What is the molarity of a pure water?
(A) 25.5 M (B) 8.0 M (C) 16.0 M (D) 55.5 M

9. Which of the following statements is true about the X-rays as high energy radiations;
(A) These are rays with longer wavelengths and low frequency than ultraviolet rays
(B) These are rays with long wavelengths and high frequency than ultraviolet rays
(C) These are rays with short wavelengths and high frequency than ultraviolet rays
(D) These are rays with short wavelengths and low frequency than ultraviolet rays

Page 350

10. Which of the following is a genetically inherited disease;
(A) Haemophilia (B) Haematoma (C) Influenza (D) COVID-19

11. Which of the following microbes finds applications in Beer industry?
(A) Bacillus thuringenesis (B) Streptomyces subtilis
(C) Saccharomyces cerevisiae (D) Thermus aquaticus

12. In a cell just after completion of mitotic telophase 23 pairs of chromosomes were
identified. The same cell had following number of chromatids at the metaphase;
(A) 23 (B) 46 (C) 92 (D) 184

13. The following types of RNAs are involved to serve as template and transporter of amino
acid respectively for translation process. Identify the correct answer;
(A) miRNA and tRNA (B) mRNA and tRNA
(C) rRNA and siRNA (D) siRNA and tRNA

14. The denaturation of double stranded DNA involves which of the following processes;
(A) Complete breakage into short double stranded fragments
(B) Complete breakage into short single stranded fragments
(C) Separation into single strands
(D) Separation into single nucleotides

15. The Beer-Lambert law describe the absorption in a solution is dependent on following
factors, except;
(A) Concentration of solution (B) Path length of cuvette
(C) Wavelength of incident light (D) Wavelength of transmitted light

16. Identify the most abundant carbohydrate in nature from the list mentioned below;
(A) Amylose (B) Amylopectin (C) Cellulose (D) Glycogen

17. The terminology cDNA is used with reference to which of the following;
(A) Circular conformation of DNA
(B) Semicircular conformation of DNA
(C) Complimentary DNA against m RNA template
(D) Complimentary DNA against DNA template

18. The Chromatography technique harnesses the separation of molecules based on which
one of the following biophysical properties;
(A) Osmotic Pressure (B) Sedimentation coefficient
(C) Electromagnetic radiation (D) Polarity/charge

19. The physical half-life of 32P is represented below. Identify the correct answer
(A) 14 hrs (B) 14 days (C) 32 hrs (D) 32 days

20. Which of the following answers correctly depicts the correct answer for Apoptosis;
(A) A process of necrotic cell death (B) A process of traumatic cell death
(C) A process of programmed cell death (D) A process of any type of cell death

Page 351

21. The Epitope region in a macromolecule is represented by one of the following correct
Answers;
(A) Antiprotein component (B) Antiprotein determinant
(C) Antigenic determinant (D) Antigenic complement

22. The establishment of cell suspension culture requires which of the following procedure
in the tissue;
(A) Organogenesis (B) Electroporation (C) Differentiation(D) Disaggregation

23. How many base pairs are present in Z-DNA in a complete helix;
(A) 8 (B) 10 (C) 12 (D) 14

24. The “Southern Blotting” technique involves which of the following correct process;
(A) The detection of RNA fragments on membranes by specific radioactive antibodies
(B) The detection of DNA fragments on membranes by specific radioactive antibodies
(C) The detection of DNA fragments on membranes by specific radioactive DNA
(D) The detection of RNA fragments on membranes by specific radioactive DNA

25. The newly synthesized proteins are post translationally modified by glycosylation in
which of the following organelles;
(A) Golgi Complex (B) Peroxisome (C) Ribosome (D) Lysosome

26. The quaternary structure of a protein refers to;
(A) The sequence of amino acids
(B) The Alpha helix and beta sheets
(C) Folding of sheets and helices
(D) Interactions of helices and sheets with other subunits

27. The nucleophilic attack by water generally results in cleavage of the amide, glycoside,
or ester bonds that hold biopolymers together. This process is termed as;
(A) Amido lysis (B) Glycosidasis (C) Esterification (D) Hydrolysis

28. The form of a molecule that has an equal number of positive and negative charges is
defined as;
(A) Isoprotonic (B) Isoelectric (C) Isoelectronic (D) Isoneutonic

29. The zymogens are the_____ enzymes. Identify the correct answer;
(A) Proenzymes (B) Ribozymes
(C) Allosteric enzymes (D) Constitutive enzymes

30. The isomers of glucose varying in one position for the placement of -OH group like in
glucose and galactose are known as;
(A) Anomers (B) Epimers (C) Apimers (D) Enomers

31. Phospholipids are termed as derivatives of which of the following molecules;
(A) Phosphatidic acid (B) Phopsphoric acid
(C) Hypophosphoric acid (D) Hypophosphatidic acid

Page 352

32. Glycolysis is regulated by three enzymes mentioned below except one. Identify which
one cannot regulate glycolysis;
(A) Hexokinase
(B) Phosphofructokinase
(C) Pyruvate kinase
(D) Glyceraldehyde-3-phosphate dehydrogenase

33. Higher than normal amount of ketone bodies in blood and urine, respectively, constitute
which of the following conditions;
(A) Ketonemia and Ketonuria (B) Ketonuria and Ketonemia
(C) Ketonemia and ketoacidosis (D) Ketoacidosis and ketonuria

34. The strand of DNA that is transcribed into an RNA molecule is known as;
(A) Template strand (B) Coding strand
(C) Primary transcript (D) Transcript strand

35. The Scurvy disease is caused by deficiency of which one of the following vitamins;
(A) Cobalamin (B) Biotin (C) Thiamin (D) Ascorbic acid

36. Meselson-Stahl experiment provided the information aboutthe DNA replication. Which
one of the following is the correct answer;
(A) Distinguishing between Closed circular DNA and linear DNA replication
(B) Distinguishing between conservative and semi-conservative replication
(C) Distinguishing between plasmid and genomic DNA replication
(D) Distinguishing between Conservative and dispersive replication only

37. The first Synthetic organism ever created is;
(A) A Virus (B) A Bacteria
(C) An animal cell in culture (D) A Fungi

38. You dissolved 58.44g of NaCl in a final volume of 1 litre to make 1.0 Molar solution
of NaCl, how much dilution would you do to achieve 0.2 M NaCl solution;
(A) 2 times (B) 5 time (C) 10 times (D) 20 times

39. The Shine-Dalgarno sequences are present in which type of macromolecules mentioned
Below;
(A) rRNA (B) mRNA (C) tRNA (D) miRNA

40. All of the following hormones are secreted in human by pancreas for metabolic
homeostasis. One of the answers mentioned below is incorrect. Identify the incorrect
answer;
(A) Glucagon (B) Insulin (C) Somatostatin (D) Ghrelin

41. Hemoglobin, the oxygen carrying protein of erythrocytes is a unique protein with
considerable buffering power near pH 7.0. This property is due to a considerable
number of specific amino acid. Identify the correct answer;
(A) Glutamic acid (B) Aspartic acid (C) Histidine (D) Asparagine

Page 353

42. All of the following elements mentioned below are radioactive isotope except one.
Identify the incorrect answer;
(A) Carbon-14 (B) Phosphorus -32 (C) Sodium-24 (D) Sulphur-33

43. All of the following are examplesof Cancer cell lines, except;
(A) MCF-7 (B) HeLa cells (C) Hybridomas(D) Hematopoietic cells

44. Galactosemia disease is inability to metabolize galactose, which may be caused by
inherited defects in following enzymes, except one. Identify the enzyme which does
not contribute to this defect;
(A) Galactokinase (B) Uridyl transferase
(C) 4-Epimerase (D) Aldose reductase

45. All of the following fatty acids listed below are essential fatty acids. One of the answers
mentioned below is incorrect. Identify the incorrect answer;
(A) Arachidonic acid (B) Linoleic acid
(C) Alpha-Linoleic acid (D) Oleic acid

46. Identify the enzyme category from the list mentioned below, where the reaction of bond
formation is coupled with energy obtained from ATP hydrolysis;
(A) Isomerases (B) Lyases (C) Ligases (D) Oxidoreductases

47. The eukaryotic cells with a capability to divide and develop into a complete organism
are termed as;
(A) Unipotent cells (B) Multipotent cells
(C) Pluripotent cells (D) Totipotent cells

48. The molecules mentioned below are nucleosides, except one. Identify the molecule
which does not belong to this list;
(A) Uridine (B) Guanosine (C) Cytosine (D) Adenosine

49. Which one of the following mentioned minerals acts as a cofactor for DNA replication
Process;
(A) Sodium (B) Magnesium (C) Potassium (D) Calcium

50. The Disaccharide Sucrose has monomers of Glucose and Fructose linked by which one
of the following bonds;
(A) 𝛼, 𝛽(1−> 2) glycosidic bond (B) 𝛼, 𝛽(1−> 3) glycosidic bond
(C) 𝛼, 𝛽(1−> 4) glycosidic bond (D) 𝛼, 𝛽(1−> 6) glycosidic bond
51. The genetic disorder Phenylketonuria is caused by the deficiency of one of the
following enzymes. Identify the correct answer;
(A) Phenylalanine reductase (B) Phenylalanine hydroxylase
(C) Phenylalanine oxidase (D) Phenylalanine synthetase
52. The resolution of proteins and peptides on Sodium dodecyl sulphate Polyacrylamide
Gel Electrophoresis (SDS-PAGE) is based on which one of the following factors;
(A) Electric Charge (B) pH
(C) Molecular Weight (D) Molecular Shape

53. Which one of the following mentioned antibodyis most abundant in human milk;

Page 354

(A) IgA (B) IgE (C) IgG (D) IgM

54. In the telophase stage of a mitotic cell division which one of the following events will
take place;
(A) Nuclear process reassembly
(B) Contractile rings form cleavage furrow
(C) Chromosomes are aligned in a equatorial plate
(D) Kinetochore assembly takes place

55. Heparin molecule is a natural anticoagulant, which binds strongly to blood proteins to
inhibit clotting process. By macromolecular nature it is a;
(A) Highly sulfated Protein molecule
(B) Highly sulfated glycoprotein molecule
(C) Highly sulfated glycosyl amino acid molecule
(D) Highly sulphated glyosylaminoglycan molecule

56. Which of the following action justify the enzymatic reaction when a single stranded
DNA fragment step wise produces 3’ mononucleotide;
(A) Exonuclease (B) Endonuclease (C) Endopeptidase (D) Exopeptidase

57. What will be the empirical formula of a hydrocarbon which on analysis gave carbon
composition as 85.63% and Hydrogen Composition as 14.37%;
(A) CH2 (B) C2H4 (C) C3H6 (D) C3H8

58. When water evaporates at a fixed given temperature and pressure its entropy will;
(A) Zero (B) No change (C) Decreases (D) Increases

59. How much stock solution is required to make 100 ml of 20 mM solution of KOH
from a 1M stock;
(A) 0.02 ml (B) 0.2 ml (C) 2.0 ml (D) 20 .0 ml

60. Number of copies of nuclear genomic DNA in human beings is;
(A) One (B) Two (C) Twenty-three (D) Forty-Six

61. Prior to cell division, each chromosome replicates or duplicates its genetic material.
The products are connected by a centromere and are called;
(A) Sister chromatids (B) Centrosome
(C) Starr bodies (D) Homologous chromosome

62. Which of the following organelle one inherits from mothers;
(A) Mitochondria (B) Golgi apparatus
(C) Lysosome (D) Smooth endoplasmic reticulum

63. What would be the pH of 0.1 N HCL;
(A) 0.1 (B) 1.0 (C) 0.2 (D) 2.0

64. Total number of asymmetric carbon atoms are present in the glucose structure
given below are;

Page 355

(A) 1 (B) 2 (C) 4 (D) 6

65. Antibodies majorly belong to which of the following category of proteins;
(A) Gamma globulins (B) Albumin (C) Ovalbumin (D) Keratins

66. Which of the following best describes the essential amino acids;
(A) Amino acid which form the part of both heart and brain proteins only
(B) Amino acid which form the part only heart proteins
(C) Amino acids synthesized by the body
(D) Amino acids not synthesized by the body

67. Which of the following buffer maintains the acid –base equilibrium in human blood;
(A) HEPES (B) Phosphate (C) Bicarbonate (D) Tris

68. Which of the following is essential for RNA synthesis in eukaryotes;
(A) DNA Primer (B) RNA Template
(C) DNA Template (D) RNA Primer

69. The biological membrane are important barriers in the cellular arrangement, which of
the following hold true for biological membrane;
(A) Proteins and phospholipids form main constituents
(B) Proteins and carbohydrates form the main constituents
(C) Phospholipid and carbohydrates forms the main constituents
(D) Phospholipids and glycolipids form the only constituents

70. Which of the following DNA sequences are the target for the action of Restriction
Endonucleases;
(A) Repetitive sequences (B) Palindromic Sequences
(C) Sequences rich in GC base pairs (D) Sequences rich in AT base pairs

71. The Scientists working with Recombinant DNA technology created a first ever
superbug for which of the following application;
(A) Synthesis of human antibodies
(B) Bioremediation of environmental toxicants
(C) For destroying the human viruses
(D) To prevent computers from hacking

Page 356

72. All the following are correct about a suicide inhibitor of enzymatic reaction, except;
(A) Brings about mechanism based inhibition
(B) Irreversible inhibition
(C) Covalently bound inhibitor
(D) Competitive inhibitor

73. All the following, differentiate a normal cell from cancercell, except one;
(A) Tissue of origin (B) Growth rate
(C) Ploidy (D) Nuclear to cytoplasmic ratio

74. Which of the following stops the chain elongation during DNA sequencing by chain
termination methodology;
(A) Deoxy-ribonucleotide (B) Dideoxy-ribonucleotide
(C) Ribonucleotide (D) Deoxy-ribonucleoside

75. In UV spectroscopy, the units for Molar absorption coefficient are generally
represented as;
(A) Litre mol-1cm3 (B) Litre mol-1 cm-1 (C) Litre mol1 cm1 (D) Litre mol cm2

x-x-x

(8)

Page 357

MSc(2Yr)(Bioinformatics/System Bio. & Bio.Informatics)
1. Among the following which one is not the approach to the local alignment?
(A) Smith-Waterman algorithm (B) K-tuple method
(C) Words method (D) Needleman-Wunsch algorithm

2. The scientific discipline concerned with naming organisms is called -
(A) Taxonomy (B) Cladistics
(C) Binomial nomenclature (D) Systematics

3. Which information was most important to the development of genetic engineering
techniques?
(A) Observation of non dominant alleles (B) Discovery of lethal genes
(C) Formulation of Punnett squares (D) Structure of the DNA molecule

4. Science of managing and analyzing biological data using advanced computers.
(A) Bioinformatics (B) Genomics
(C) Forensics (D) Human Genome Project

5. Study of genes and their function.
(A) Forensics (B) Bioinformatics
(C) Genomics (D) Human Genome Project

6. Which of the following does not describe BLOSUM matrices?
(A) It stands for BLOcks SUbstitution Matrix
(B) It was developed by Henikoff and Henikoff
(C) The year it was developed was 1992
(D) These matrices are logarithmic identity values

7. The central hub for the collection of functional information on proteins with accurate,
consistent and rich annotation is
(A) Genbank (B) Uniprot (C) NCBI (D) Wikipedia

8. In the bootstrap method, the data are resampled by _____ choosing _____ columns from
the aligned sequences to produce, in effect, a new sequence alignment of the _____
(A) Randomly, horizontal, same length (B) Specifically, vertical, different lengths
(C) Randomly, vertical, same length (D) Randomly, vertical, different lengths
9. Which technology below would probably be the most important to a person who had
diabetes and had to take insulin every day?
(A) Using recombinant DNA to produce human hormones from bacteria
(B) Testing parents for genetic disorders before they have children
(C) Engineering fruits and vegetables that resist insects and other pests
(D) Developing ways to identify criminals through DNA fingerprinting

Page 358

10. What are the building blocks of matter?
(A) Atoms (B) Cells (C) Protons (D) Neutrons

11. What is the mass number of at isotope that has 20 protons, 21 neutrons and 18 electrons?
(A) 18 (B) 20 (C) 21 (D) 41

12. Activation energy is
(A) The energy to start a car (B) The energy needed to break down
CO2
(C) The energy needed to start a reaction (D) The energy used to digest food

13. Which disease is caused by bacteria?
(A) Tuberculosis (B) Cancer (C) Ringworm (D) Hypertension

14. The primary use of Koch postulates is to
(A) Clearly identify and characterize a particular microorganism
(B) Isolate microbes from diseased animals
(C) Demonstrate that disease is caused by microorganisms
(D) Develop vaccines for specific disease

15. In electron microscope, what material is used as an objective lens?
(A) Magnetic coils (B) Superfine glass (C) Electrons (D) Aluminium
foils

16. Prokaryotic and eukaryotic cells have many differences, but they also share some common
features. Which of the following may be found in either type of cell?
(A) Golgi bodies (B) Mitochondria (C) Ribosomes (D) Nucleus

17. Bacteria protect themselves from viruses by fragmenting viral DNA with
(A) Ligase (B) Endonuclease (C) Exonuclease (D) Gyrase

18. Klenow fragment is derived from
(A) DNA Ligase (B) DNA Pol-I
(C) DNA Pol-II (D) Reverse Transcriptase

19. Southern blotting is
(A) Attachment of probes to DNA fragments
(B) Transfer of DNA fragments from electrophoretic gel to a nitrocellulose sheet
(C) Comparison of DNA fragments to two sources
(D) Transfer of DNA fragments to electrophoretic gel from cellulose membrane

20. The Golden Rice variety is rich in
(A) Vitamin C (B) Β-carotene and ferritin
(C) Biotin (D) Lysine

Page 359

21. The DNA fragments have sticky ends due to
(A) Endonuclease (B) Unpaired bases (C) Calcium ions(D) Free methylation

22. Plasmids are used as cloning vectors for which of the following reasons?
(A) Can be multiplied in culture
(B) Self-replication in bacterial cells
(C) Can be multiplied in laboratories with the help of enzymes
(D) Replicate freely outside bacterial cells

23. The human genome project was launched in the year
(A) 1980 (B) 1973 (C) 1990 (D) 1989

24. The vaccines prepared through recombinant DNA technology are
(A) Third generation vaccines (B) First-generation vaccines
(C) Second-generation vaccines (D) None

25. Which is a genetically modified crop?
(A) Bt-cotton (B) Bt-brinjal (C) Golden rice (D) All

26. RNA interference helps in
(A) Cell proliferation (B) Micropropagation
(C) Cell defence (D) Cell differentiation

27. The first transgenic plant to be produced is
(A) Brinjal (B) Tobacco (C) Rice (D) Cotton

28. The first clinical application of gene therapy over a 4 year old girl was for
(A) Adenosine deaminase deficiency (B) Adenosine deficiency
(C) Growth deficiency (D) Adenine deficiency

29. Excision and insertion of a gene is called
(A) Biotechnology (B) Genetic engineering
(C) Cytogenetics (D) Gene therapy

30. The expression of a transgene in the target tissue is identified by an
(A) Transgene (B) Promoter (C) Enhancer (D) Reporter

31. Which bacterium is used in the production of insulin by genetic engineering?
(A) Saccharomyces (B) Rhizobium
(C) Escherichia (D) Mycobacterium

32. Even after replication, how the modified DNA remain protected?
(A) It remains protected because of the conservative mode of replication
(B) It remains protected because of the semi-conservative mode of replication

Page 360

(C) The mode of replication has no role to play in the protection
(D) It is again modified after replication

33. If only one bond is broken in the sugar-phosphate backbone, it is called as ___________
(A) Gap (B) Nick (C) Break (D) Leakage

34. The ligation reaction is more efficient, in which case?
(A) Blunt end ligation (B) Sticky end ligation
(C) Both have the same efficiency (D) Depends on the reaction condition

35. The sticky ends are held together by which type of bonds?
(A) Hydrogen bond (B) Covalent bond
(C) Ionic bond (D) Van-der-Waal forces

36. Which of the following is an example of a Homology and similarity tool?
(A) BLAST (B) RasMol (C) EMBOSS (D) PROSPECT

37. Which of the following tools is used for the identification of motifs?
(A) BLAST (B) COPIA (C) PROSPECT (D) Pattern hunter

38. The identification of drugs through the genomic study is called__________.
(A) Genomics (B) Pharmacogenomics
(C) Pharmacogenetics (D) Cheminformatics

39. Which of the following compounds has desirable properties to become a drug?
(A) Fit drug (B) Lead (C) Fit compound (D) All of these

40. Proteomics refers to the study of __________.
(A) Set of proteins in a specific region of the cell
(B) Biomolecules
(C) Set of proteins
(D) The entire set of expressed proteins in the cell

41. Which of the following statements is incorrect about the RNA Secondary Structure’s
Prediction?
(A) Every base is compared first to every other base by a type of analysis quite similar to
that of dot matrix analysis
(B) A matches row in the RNA matrix indicates a complementary nucleotides succession
that can potentially produce a double-stranded region
(C) The sequence is listed across the side of the page, top and down, G/C, G/U, and A/U
base pairs are scored
(D) A row of matches in the RNA matrix represents a failure of complementary nucleotides
that can potentially produce a double-stranded region

Page 361

42. What is needed as a source of energy for vital activities of the body?
(A) Iron (B) Calcium (C) Water (D) Carbohydrates

43. Hemoglobin (Hb) is a protein that is found in the _____ of the blood.
(A) Plasma (B) Platelets (C) Red blood cells (D) White blood
cells

44. Cristae in mitochondria serves as sites for
(A) Oxidation reduction reaction (B) Protein synthesis
(C) Macromolecules breakdown (D) Flavoproteins are phosphorylated

45. The bright colours of ripe fruits is due to
(A) Chromoplasts (B) Chloroplasts (C) Amyloplasts (D) Leucoplasts

46. Factory for synthesis of sugars in autotrophic eukaryotes
(A) Mitochondria (B) Chloroplast
(C) Ribosome (D) Endoplasmic reticulum

47. Pick the incorrect statement
(A) Mitochondrial DNA is known as mtDNA
(B) Mitochondria is the powerhouse of the cell
(C) Mitochondria is the site for Calvin cycle
(D) Mitochondria is the site for Krebs cycle and oxidative phosphorylation

48. Chip is a common nickname for a (n):
(A) Transistor (B) Resistor (C) Integrated circuit (D)
Semiconductor

49. All of the following are examples of storage devices except:
(A) Hard disk drives (B) Printer (C) USB drive (D) DVD drives

50._______ tags, when placed on an animal, can be used to record and track in a database all
of the animal’s movements.
(A) POS (B) RFID (C) PPS (D) GPS
51. Surgeons can perform delicate operations by manipulating devices through computers
instead of manually. This technology is known as:
(A) Robotics (B) Computer forensics
(C) Simulation (D) Forecasting
52. The resolution of a monitor is measured in
(A) Megabits (B) Hz
(C) Dots per inch (DPI) (D) Inches (diagonal)
53. What is the full form of DRAM?
(A) Dynamic Remote Access Memory (B) Dynamic Random-Access Memory
(C) Dependent Remote Access Memory (D) Dependent Random-Access Memory

Page 362

54. What kind of language can computer understand?
(A) Normal language (B) Computer language
(C) Assembly language (D) High-level language

55. Which one of the following software applications would be the most appropriate for
performing numerical and statistical calculations?
(A) Database (B) Document processor
(C) Graphics package (D) Spreadsheet

56. Which of the following makes water a liquid at room temperature?
(A) Non covalent interactions
(B) Hydrogen bonds between water molecules
(C) Van der Waals forces of attraction
(D) Covalent bonding

57. The degree of ionization does not depend on which of the following parameter?
(A) Nature of solvent (B) Temperature
(C) Concentration (D) Current

58. Based on which of the following enzymes Hydrolysis reactions are catalyzed?
(A) Hydrolase (B) Oxidoreductase (C) Isomerase (D) Ligase

59. Which of the following is an imino acid?
(A) Serine (B) Alanine (C) Glycine (D) Proline

60. Which of the following is a 39-residue hormone of the anterior pituitary gland?
(A) Glucagon (B) Bradykinin (C) Corticotropin (D) Insulin

61. Which of the following statements is correct about column chromatography?
(A) Resolution improves as column length increases
(B) Mobile phase is a porous solid material kept in the column with appropriate chemical
characteristics
(C) Stationary phase is a buffered solution that percolates through the mobile phase
(D) Large proteins exit the column faster than tiny proteins
62. Who deduced the double-helical structure of DNA?
(A) Watson and Francis Crick (B) Frederick Sanger
(C) Anton van Leeuwenhoek (D) Mendel
63. The amino acid sequences of thousands of different proteins from many species have been
determined using principles first developed by?
(A) Watson and Crick (B) Edman (C) Sanger (D) Mendel

64. The stability of an α-helix is not affected by which of the following?
(A) Bulkiness

Page 363

(B) Occurrence of alanine and glycine residues
(C) Electrostatic repulsion
(D) Interaction between R groups spaced three residues apart

65. Which of the following is a function of chaperone protein?
(A) It provides a template for how the proteins should fold
(B) It degrades proteins that have folded properly
(C) It degrades proteins that have folded improperly
(D) It rescues proteins that have folded improperly and allowed them to refold properly

66. The relationship between oxygen concentration and the fraction of binding sites occupied
in myoglobin can best be described as ________
(A) Linear with a positive slope (B) Hyperbolic
(C) Parabolic (D) Linear with a negative slope

67. Which of the following involves carrying genetic information from DNA for protein
synthesis?
(A) sn-RNA (B) r-RNA (C) m-RNA (D) t-RNA

68. What is the function of a protein?
(A) It is involved in short-term energy store
(B) It is involved in almost every function of the human body
(C) It transmits genetic information
(D) It is involved in long-term energy and body insulation

69. The classical probability method is applied to an experiment that
(A) Does not has equally likely outcomes (B) Has equally likely outcomes
(C) Has independent outcomes (D) Does not have more than two
outcomes

70. Two mutually exclusive events
(A) Always occur together (B) Cannot occur together
(C) Can sometimes occur together (D) Can neven occur together
71. Which mean is most affected by extreme values?
(A) Geometric Mean (B) Harmonic Mean
(C) Arithmetic mean (D) Trimmed Mean

72. Statistics results are:
(A) Absolutely Correct (B) Not True
(C) True on Average (D) Universally True

73. The extreme values in negatively skewed distribution lie in the:
(A) Middle (B) Right Tail (C) Left Tail (D) Whole Curve

Page 364

74. If a constant value 5 is subtracted from each observation of a set, the variance is:
(A) Reduced by 5 (B) Reduced by 25 (C) Unaltered (D) Increased by
25

75. The probability of an impossible event is always
(A) Less than one (B) Greater than one
(C) Between zero and one (D) Zero

x-x-x

(8)
Space for Rough Work

Page 365

MSc(HS/2Yr)(Zoology)
1. The nerve impulse ordered by respiratory centre sends out nerve impulses to ________
(A) control center in brain
(B) diaphragm and intercostal muscles
(C) carotid and aortic bodies
(D) muscles of the body that regulate the use of oxygen

2. Tissue plasmin activator ___________
(A) helps in wound healing
(B) allergy response
(C) Immunity
(D) dissolves clot in blood vessels

3. Which of the following ensure stable binding of the RNA polymerase to the promoter
for transcription initiation in bacteria?
(A) Sigma factor
(B) Rho factor
(C) Alpha factor
(D) DNA glycosylase

4. Which family of proteins regulates the intrinsic pathway of apoptosis?
(A) Bcl-2
(B) Bcl-4
(C) Caspase-2
(D) Caspase-8

5. Name three genes responsible for the production of Rh antigens
(A) RHAG, RHD,RHCE
(B) RHD, RHCE and RHce
(C) RHAG, RH1 and RH2
(D) RHD, RHCc and RHEe

6. Frederick Sanger won two Nobel prizes, one for a method to determine the sequence of
proteins and another for a procedure to determine the sequence of:
(A) Nucleic acids
(B) Amino acids
(C) Triacylglycerols
(D) TCA cycle

7. What best describes epigenetics?
(A) Study of genotypes of complex organisms
(B) Study of alterations in the DNA sequence
(C) Study of heritable phenotype changes not involving changes in the DNA sequence
(D) Study of gene activity

Page 366

8. Chargaff's rules state that:
(A) In RNA, the amount of ribose is equal to the amount of phosphate
(B) In DNA, the amount of adenine is equal to the amount of guanine
(C) In RNA, the percentage of deoxyribose is equal to the amount of uracil
(D) In DNA, the percentage of adenine is equal to the percentage of thymine, and the
percentage of cytosine is equal to the percentage of guanine

9. Forensic techniques once relied on analysis of restriction fragment length polymorphisms,
but more recently has come to depend upon:
(A) FTR
(B) FDR
(C) Analysis of short tandem repeats
(D) NMR

10. Where is Pineal gland located?
(A) Just below Adam’s apple
(B) Hanging down from hypothalamus
(C) Between the right and left hemisphere of the brain
(D) In the frontal lobe of brain

11. Adenohypophysis in humans consists of two portions
(A) Pars distalis and Pars nervosa
(B) Pars intermedia and Pars distalis
(C) Pars nervosa and Pars intermedia
(D) Pars nervosa and tuberalis

12. Which of the following amino acids is the precursor for the thyroid hormones T 3 and T4?
(A) Tryptophan
(B) Lysine
(C) Tyrosine
(D) Histidine

13. Which is a degenerative brain disorder caused by the lack of thiamine (vitamin B1)?
(A) Wernicke’s syndrome
(B) Korsakoff’s syndrome
(C) Osteonecrosis
(D) Tunnel vision

14. The Cholera toxin produced by Vibrio cholera exerts its effect by ___________
(A) modifying G-protein
(B) modifying primary messengers
(C) modifying effectors
(D) modifying receptors

15. The concentration of Calcium in a resting cell is ___________
(A) 10 M

Page 367

(B) 10-2 M
(C) 10-5 M
(D) 10-7 M

16. The term Alpha diversity describes
(A) species diversity in a single community
(B) species diversity between communities
(C) measures biodiversity in a large region
(D) genetic diversity

17. Evolutionary process occurring in a species where accumulation of gradual changes
becomes distinct to form a different species is
(A) Cladogenesis
(B) Anagenesis
(C) Phylogenesis
(D) Heterogenesis

18. Calmodulin has low affinity for ___________
(A) Magnesium ions
(B) Iodine
(C) Non-stimulated cells
(D) Stimulated cells

19. Which messenger molecules are derived from the fatty acid, arachidonic acid?
(A) Eicosanoids
(B) Terpenoids
(C) Corticoids
(D) Steroids

20. Cell junction is abundant in ___________
(A) Hepatic cells
(B) Cardiac cells
(C) Epithelial cells
(D) Prokaryotic cells

21. If bicoid mRNA is injected into the posterior pole of a wild type Drosophila embryo, the
expected phenotype is
(A) Head structures at both the posterior and anterior poles
(B) Head structures at the posterior pole only
(C) Head structures at anterior pole only
(D) No head structures at all

22. Leukocyte extravasation occurs in the following order:
(A) Activation, rolling, transmigration, adhesion
(B) Rolling, activation, adhesion, immigration
(C) Capture, Adhesion, rolling, activation, transmigration

Page 368

(D) Capture, rolling, activation, adhesion, transmigration

23. Which is the main building block of cilia in prokaryotic?
(A) Tubulin
(B) Nexin
(C) Dyenin
(D) Actin
24. Which of the following is a key second messenger is generated by the G protein coupled
receptor present in the human eye?
(A) Diacyl glycerol(DAG)
(B) cGMP
(C) cAMP
(D) Inositol 3,4,5-phosphate(IP3)

25. Which of the serological test is performed for typhoid fever and strep throat?
(A) Precipitation
(B) Agglutination
(C) Immunoelectrophoresis
(D) ELISA

26. During submergence in aquatic turtles the accessory respiratory organs are
(A) Skin
(B) Air sacs
(C) Buccal cavity
(D) Cloacal bladder

27. Entamoeba histolytica is a human parasite found in
(A) Large intestine
(B) Small intestine
(C) Oral cavity
(D) Blood

28. In blister beetles (family Meloidae), courtship begins with a series of antennal taps by the
male on each side of the female's body is which type of communication?
(A) Visual communication
(B) Tectile communication
(C) Auditory communication
(D) Olfactory communication

29. Queen honeybees produce a pheromone that modulates many aspects of worker honeybee
and is critical for colony social organization is secreted by which gland
(A) Mandibular glands
(B) Dufour's gland
(C) Tarsal glands
(D) Rectal gland

Page 369

30. Ingression is
(A) Migration of individual cells from the surface layer into the interior of the embryo
(B) Movement of epithelial sheets
(C) Inward movement of outer layer
(D) Splitting of one cellular sheet into two or more

31. Novobiocin is an aminocoumarin antibiotic used in the regulated expression of transgenes
in mammals is produced by the which of the following actinomycete
(A) Streptomyces nivens
(B) Streptomyces coelicolor
(C) Streptomyces venezuelae
(D) Streptomyces griseus

32. A genetic disorder of the immune system in which the body is unable to produce functional
B cells and T cells to resist infection is
(A) Bruton'sagammaglobulinemia
(B) Hypergammaglobulinemia
(C) Swiss-type agammaglobulinemia
(D) X-linked agammaglobulinemia

33. Which is the signalling molecule released from the notochord that plays an important role
in promoting somite patterning in the developing embryo and regulates bone morphogenic
protein (BMP4) during development?
(A) Noggin
(B) Chordin
(C) GEX-2 and GEX-3 proteins
(D) Catenin beta-1

34. The T wave on an electrocardiogram (ECG) represents
(A) repolarization of the ventricular myocardium
(B) depolarization of ventricles
(C) atrial repolarization
(D) atrial depolarization

35. The Nobel Prize in Medicine 2021 was awarded for the discoveries of ___________
(A) Electrocardiogram mechanism
(B) Receptors for temperature and touch
(C) Cancer Therapy by radiology
(D) Discovery of Hepatitis C virus

36. Mesangial cell relaxation can be mediated by enhanced cAMP or cGMP generation
caused by
(A) Norepinephrine
(B) Dopamine
(C) Oxytocin
(D) Angiotensin II

Page 370

37. Loss-of-function mutations of the SLC5A1 gene prevent
(A) Glucose and galactose from being absorbed in the intestine
(B) Phosphate and citrate reuptake in the proximal tubular system of the kidney
(C) Absorb nutrients from food as it passes through the intestine
(D) Urea reuptake in the proximal tubular system of the kidney

38. Trypanosoma brucei evade the immune response of the host
(A) By generating variant surface antigens (VSG)
(B) By invading the host cell
(C) By switching to other morphological forms
(D) By masking with immune cells of the host

39. Ryanodine receptors (RyRs) are
(A) Intracellular Ca2+ release channels in skeletal and cardiac muscle
(B) Sodium potassium transport channels in membranes
(C) Inward flux of Ca2+ through DHPR in neurons
(D) Voltage-gated Ca2+ channels in skeletal and cardiac muscle

40. Alpine musk Deer is state animal of which state
(A) Manipur
(B) Madhya Pradesh
(C) Arunachal Pradesh
(D) Uttarakhand

41. Binding of which of the following to the promoter site is required for transcription of the
lac operon:
(A) CAP
(B) Camp
(C) CAP-cAMP complex
(D) Lactose

42. Which of the following cleaves the hairpin to form pre-miRNA:
(A) DICER
(B) DROSHA
(C) RSIC
(D) EXPORTIN

43. In herbivores, the molars have greater crushing action due to
(A) Hypocone evolves in the upper molar and loss of paraconid with elevation of talonid
to the height of the rest of the trigonid in the lower molar
(B) Protocone evolves in the upper molar and loss of entoconid with elevation of talonid
to the height of the rest of the trigonid in the lower molar
(C) Paracone evolves in the upper molar and loss of hypoconid with elevation of talonid
to the height of the rest of the trigonid in the lower molar
(D) Metacone evolves in the upper molar and loss of paraconid with elevation of talonid
to the height of the rest of the trigonid in the lower molar

Page 371

44. Which of the following is NOT the function of Maturation-promoting factor involved in
the cell cycle:
(A) Own destruction
(B) Activation of the Anaphase-Promoting Complex
(C) Driving the events of M phase
(D) Inactivation of Separase

45. Hind gut fermentation is a feature of
(A) Herbivores with simple, single chambered stomach
(B) Herbivores with complex, 4-chambered stomach
(C) Herbivores with simple, 2-chambered stomach
(D) Animals with secondarily lost stomach

46. Pulmonary surfactant is composed mainly of
(A) Glycoproteins
(B) Dipalmitoylphosphatidylcholine
(C) Surfactant protein D (SP‐D)
(D) Disaccharide trehalose

47. Chiggers serve as vectors of the disease for
(A) Epidemic typhus
(B) Endemic typhus
(C) Scrub typhus
(D) Trench fever

48. Romaña sign, also known as the periorbital swelling syndrome is due the infection of
(A) Trypanosoma cruzi
(B) Leishmania donovani
(C) Babesia microti
(D) Loa loa

49. Which of the following is not an amine hormone?
(A) Norepinephrine
(B) Adrenaline
(C) Thyroxine
(D) Oxytocin

50. Telomeric DNA has non coding sequence are usually rich in which nucleotide?
(A) Adenine
(B) Guanine
(C) Thymine
(D) Cytosine
51. Which of the following is a physiological uncoupler Oxidative phosphorylation:
(A) 2,4-Dinitrophenol
(B) Dinitrocresol
(C) Pentachlorophenol
(D) Thermogenin

Page 372

52. Regeneration of salamander limbs
P. It is an example of epimorphosis
Q. Involves formation of an apical ectodermal cap from the epidermis
R. Involves dedifferentiation of cells into a blastema
S. Retinoic acid appears to play an important role both in the dedifferentiation of the cells
to form the regeneration blastemal and in the respecification processes as the cell
redifferentiate
(A) P and Q
(B) Q and R
(C) P and R
(D) P, Q, R and S

53. The cranial capacity of which of the following prehistoric humans was within the range of
the values for modern humans?
(A) Neanderthal man
(B) Peking man
(C) Java ape man
(D) CroMagnon man
54. What best represents the ecotone zone between marine and terrestrial ecosystems?
(A) Grasslands
(B) Mangrove forests
(C) Estuaries
(D) Tropical deciduous forests

55. In which autoimmune disease the affected individuals may produce auto-antibodies to a
vast array of tissue antigens, such as DNA, histones, RBCs, platelets, leukocytes, and
clotting factors
(A) Systemic Lupus Erythematosus (SLE)
(B) Multiple sclerosis (MS)
(C) Goodpasture Syndrome
(D) Myasthenia gravis

56. Which of the following is a major reason of Hemophilia A:
(A) X-linked recessive disorder
(B) X-linked dominant disorder
(C) Sex limited disorder
(D) Sex influenced disorder

57. Philadelphia chromosome is:
(A) Defective chromosome 9, trisomy
(B) Defective chromosome 4, trisomy
(C) Defective chromosome 22, because of reciprocal translocation between
chromosome 9 and chromosome 22
(D) Defective chromosome 21, produced during Down Syndrome

Page 373

58. In India which of the following endemic species of earthworms is extensively used for
vermiculture
(A) Eudrilus eugeniae
(B) Perionyx excavates
(C) Eisenia foetida
(D) Lumbricus terrestris

59. Pearl mother layer is :
(A) Prismatic layer
(B) Periostracum
(C) Nacre
(D) Mantle

60. Immunoglobulin deficiency can be detected by
(A) Flow cytometry
(B) DTH skin test
(C) Mixed lymphocyte response (MLR)
(D) Serum protein electrophoresis

61. For adjuvants to be effective, they need to do all of the following except
(A) Prolong antigen exposure
(B) Enhance release of TGFβ
(C) Induce high affinity response
(D) Induce granuloma formation

62. Molecules directly involved in NK cell mediated killing include
(A) muramyl dipeptide.
(B) granzyme A and B
(C) complement
(D) IFNγ

63. Which of the following lake zones has phytoplanktons in abundance?
(A) Littoral zone
(B) Benthic zone
(C) Limnetic zone
(D) Profundal zone
64. Secretin stimulates
(A) pancreatic bicarbonate and enzyme secretions
(B) stimulates gallbladder contraction
(C) stimulates acid secretion in the stomach
(D) stimulates insulin secretion and inhibits glucagon secretion

65. What is the result from bilateral destruction of amygdala
(A) Voracious appetite
(B) Dementia
(C) Epilepsy
(D) Schizophrenia

Page 374

66. When two or more non allelic gene pairs affect the same character in the same way, this is
called
(A) Polygenic inheritance
(B) Pleiotropy
(C) Multiple alleles
(D) Additive expressivity

67. Nissl granules and myeloid bodies are rich in
(A) ER
(B) Fats
(C) Proteins
(D) Golgi bodies

68. Tuatara belongs to the order
(A) Rhyncocephalia
(B) Chelonia
(C) Crocodilia
(D) Squamata

69. Armadillos have been important to the development of vaccine for
(A) Tuberculosis
(B) Hepatitis B
(C) Leprosy
(D) AIDS

70. Hensen’s node is formed of cells of presumptive
(A) Notochord
(B) Mesoderm
(C) Gut
(D) Heart

71. Retinoic acid receptor alpha (RARA) gene is normally located on
(A) Chromosome 17
(B) Chromosome 14
(C) Chromosome 15
(D) Chromosome 16

72. How many genes does Zebra fish share with humans?
(A) 70%
(B) 60%
(C) 50%
(D) 84%

73. Which of the following pair will produce complementary sticky ends?
(A) Eco RI & MspI
(B) Msp I & HPA II

Page 375

(C) Sau 3A & Bam HI
(D) Mbo I & Sau 3A

74. Range of osmolarity tolerated/accepted in mOsm/Kg of H2O by mammalian cells is
(A) 150-300
(B) 280-360
(C) 300-325
(D) 360-400

75. Sensory cephalic tentacles in Dentalium
(A) Byssus thread
(B) Radula
(C) Capticula
(D) Osphredia
x-x-x

(10)
Space for Rough Work

Document Details

Board / Org	Panjab University
Exam	PU CET PG
Type	Question Paper
Pages	156
Language	english
Updated	22 Jul 2026

More for PU CET PG

✅Answer Key 📄Question Paper 📝Sample Paper 📘Syllabus

More from Panjab University

Chandigarh B.Ed CET PU CET PG PU LAW PG PU LAW UG PU MBA Entrance Test PU MET PU PhD PUCET PULEET PUMEET PUTHAT

SELECT YOUR STATE