CBSE Class 12 Sample Paper 2026 Solution for Biology

CBSE BOARD

SAMPLE
PAPER
2026
SOLUTIONS

DOWNLOAD

BIOLOGY Code no. 044
MARKING SCHEME
CLASS – XII (2025–26)

Q. Answer Mar
No. ks

Section - A

1 C. Mitotic division of nucleus of generative cell 1

2 B. A male gamete and two polar nuclei 1

3 C. FSH and LH 1

4 C. Frederick Griffith 1

5 A. Probes 1

6 C. Hardy-Weinberg principle says that phenotype frequencies in a population 1
are stable and are constant from generation to generation.

7 B. 25% 1

8 D. The leg mutation might lead to reproductive isolation and speciation due to 1
an effect on the mating call.

9 D. Sporozoites, Liver infection, Erythrocyte infection, Gametocytes 1

10 B AUGAGACGGACUGCAUUCCCAACCUGA 1

11 A. Lysozyme, ribonuclease, protease, chilled ethanol 1

12 C. Both I and II 1

13 C. A is true but R is false 1

14 A. Both A and R are true and R is the correct explanation of A 1

15 A. Both A and R are true and R is the correct explanation of A 1

16 C. A is true but R is false 1

Section - B

17 A. It is achieved by emasculation and bagging techniques. 2
If the female parent bears bisexual flowers, removal of anthers from the flower
bud before the anther dehisces using a pair of forceps is necessary. This step
is referred to as emasculation.
Emasculated flowers have to be covered with a bag of suitable size, generally
made up of butter paper, to prevent contamination of its stigma with unwanted
pollen. This process is called bagging. (1 x 2 = 2)
OR
B. In pea plants, manual emasculation is easier and pollen grains are viable
for months as it belongs to Leguminosae.

In wheat flowers (spikelets) pollen grain loses its viability half an
hour after release. (1 x 2 = 2)

18 In a transcription unit, the activity of RNA polymerase at a given promoter is 2
regulated by accessory proteins that have an ability to recognise start sites.
(1)
These regulatory proteins can act both positively (activators) and negatively
(repressors) with the operator which is adjacent to the promoter in an operon
unit. (1)

19 A. Innate immunity/ non-specific type of defense/immunity present at the time 2
of birth is effected. It provides different types of barriers to the entry of the
foreign agents into our body/destroys microbes/ prevents microbial growth.
(1)
B. Cellular barrier-monocytes is with least count and it can phagocytose and
destroy microbes. (1)

20 Anyone who can use/modify any living organism or their products using 2
technology is considered to be a biotechnologist. (1)
Thus, cheese maker can be a biotechnologist as he uses microbes like
bacteria, fungi to make cheese for commercial purpose (1)
OR
Selection of recombinants due to inactivation of antibiotics is a cumbersome
procedure because it requires simultaneous plating on two plates having
different antibiotics. (1)
In insertional inactivation method, insertion of recombinant DNA within the
coding sequence of the enzyme beta galactosidase results into inactivation of
this enzyme and the colonies do not produce any colour. The presence of a
chromogenic substrate gives blue coloured colonies in absence of an insert.
(1)

21 A. 2
(i) The first (upright) pyramid of biomass corresponds to a terrestrial
ecosystem. Producers have maximum biomass, decreasing with
herbivores (primary consumer), secondary consumer and tertiary
consumer. Second (inverted) pyramid refers to a small standing crop of
phytoplankton supporting a large standing crop of zooplankton/aquatic
ecosystem. (1)
(ii)

(1)
-------------------
For Visually impaired students
(Answer same as (i) and (ii) above)
OR
B.

(i) 3000+1300+427+427+378= 5532 (1)
(ii)
(a) Animals are mobile and can migrate to escape harsh conditions or
explore new areas.
(b) Animals have adapted to changing environments, developing complex
nervous systems and receptors. Their responses are adaptive and
ensure survival. Iii. Plants, being fixed, have fewer evolutionary
adaptations for water, minerals, and sunlight. (Anyone, 1)

Section – C

22 (i) Condoms; these act by blocking the entry of microbes and sperms in the 3
cervix.
(ii) Surgical methods such as Tubectomy by her or vasectomy by her
husband as these are highly effective but irreversible methods.
(iii) Oral pills containing progestogens or progestogen – estrogen combination
are very effective and can be repeated as long as the female derives to
prevent conception. (1 x 3 =3)

23 (i) (a) ovum is haploid (n) and (c) – blastomeres are diploid(2n). 3
(ii) If the trophoblast (L) does not attach to the endometrium properly, it can
lead to implantation failure, pregnancy loss, and other pregnancy
complications.
(iii) In case X, the cells of these embryos will have identical genome as they
have developed from the same zygote. (1 x 3 =3)
-------------------
For Visually impaired students
 The mitotic division called cleavage starts as the zygote moves through
the isthmus of the oviduct towards the uterus and forms 2,4,8,16 daughter
cells called blastomeres. The embryo with 8 to 16 cell blastomeres is
called a morula. (1)
 The morula transforms into blastocyst and the blastomeres in the
blastocyst are arranged into an outer layer called trophoblast and an inner
group of cells attached to trophoblast called the inner cell mass. (1)
 The trophoblast layer then gets attached to the endometrium of the uterus
and the inner cell mass gets differentiated as the embryo. After
attachment, the uterine cells divide rapidly and cover the blastocyst which
gets embedded in the endometrium leading to implantation. (1)

24 BbGg Male is crossed with BbGg female which are both heterozygous of 3
both the characters for eye and coat colour. (1)

Punnett square (1)
1/16 or 6.25 % - blue eyes and white coat (1)

25 A. These animals exhibit convergent evolution, structures that are not 3
anatomically similar are evolved to perform similar functions adapted to
the same habitat, the fins of Salmon and Shark, flippers of Dolphins, Seals
and whales. One can say that it is the similar habitat that has resulted in
selection of similar adaptive features in different groups of organisms but
toward the same function: hence, analogous structures are a result of
convergent evolution. (2)
B. Ichthyosaurs. Some of the land reptiles went back into water to evolve into
fish like reptiles probably 200 mya. (1)
-------------------
For Visually impaired students
A. Both Lamarck and Darwin believed that living things had hereditary traits,
traits they could pass on to their offspring. They believed that some traits
were more useful than others, and that over time the more useful trait
would become more common. (1)
The difference is that Lamarck believed that the changes in an organism
experienced during its life could be passed on to succeeding
generations/Inheritance of acquired characters. So, for instance Giraffe
stretched its neck its entire life to eat leaves on tall plants, it would have
longer-necked offspring (or any other example of Lamarckian theory). (1)
Darwin believed that small, random and gradual genetic variations
followed by natural selection lead to evolution- that some giraffes just
naturally had longer necks, and these were the ones who had more
children. So over time natural selection led to evolution of Giraffes with
long neck were fitter than short-necked. (1)

26 'Flocs' and 'activated sludge' in sewage treatment help to reduce the BOD. 3
(i) Flocs: These are masses of bacteria held together by slime and fungal
filaments to form mesh-like structures. These are used during the
secondary sewage treatment in the aeration tank to increase the rate of
decomposition. The microbes digest a lot of organic matter, converting it
into microbial biomass and releasing a lot of minerals. As a result, the

BOD of sewage is reduced. As the BOD of waste is reduced to 1% of
raw sewage. it is passed into the settling tank. In these tanks, flocs are
allowed to undergo sedimentation.
(ii) Activated sludge: The sediment of the settling tank is called activated
sludge. A part of it is used as an inoculum in aeration tanks. The
remaining part is passed into a large tank called an anaerobic sludge
digester. In these tanks, anaerobic microbes are present that digest the
organic mass as well as aerobic microbes of activated sludge. The
remaining sludge is used as manure or compost.

27 ELISA-Enzyme Linked Immunosorbent Assay. (1) 3
ELISA is based on antigen-antibody interaction. (1)
The ways to detect the presence of infection or disease by ELISA are as
follows:
The presence of antigens (proteins, glycoproteins, etc.) is detected. /
Antibodies produced against the pathogens are detected. (1)

28 1950 – Expanding - The population structure in 1950 exhibits a broad-based 3
pyramid with a wider base, indicating a higher percentage of young individuals.
This suggests a population with a higher birth rate. (1)
2007 – Stable - The narrowing of the pyramid towards the top signifies a lower
proportion of elderly individuals. By 2007, the population was more stable with
the number of pre reproductive and reproductive age nearly being the same.
Bell shape indicates static population. (1)
2050– Declining - By 2050 urn shaped pyramid shows a declining population
where birth rates are very less and the populations of elderly people will
increase. (1)
-------------------
For Visually impaired students
Answer same as above

Section – D

29 A. One embryo sac is present in each ovule and one egg is present in each 4
embryo sac when the embryo sac is developed from a single megaspore.
(1)
B.
(i) P exhibits polyembryony due to occurrence of more than one embryo in
a seed. Embryos developed from nucellar cells by apomixis, a form of
asexual reproduction, don't show genetic variation. (1)
(ii) Cells of embryos developed from diploid nucellar cells are diploid (2n)
as these are formed by apomixis, a form of asexual reproduction. (1)

Student to attempt either subpart C or D.
C. Q, because this fruit is developed without fertilisation and will thus be
seedless. (1)
OR
D. Fruit S is a true fruit with seeds. True fruits develop from the ripened ovary
after fertilisation and fertilised ovules mature into seeds. (1)

30 A. Passive immunity – Ready made antibodies from colostrum / less effective 4
/ transient / no memory cells involved
Active Immunity – Made by host’s immune system/ Lag phase/ memory
based/ largely effective. (1)
B. Active immunity. As the vaccine contains a weakened or inactivated form
of the pathogen (microbe), which is harmless but still recognized by the
immune system as foreign. The immune system responds by activating
lymphocytes, which produce specific antibodies to fight the pathogen.
This process also leads to the creation of memory cells, which provide
long-term protection by "remembering" to fight this pathogen if the person
is exposed again. (2)
Attempt either subpart C or D.
C. This passive immunity peaks at day 1 and declines as the calf ag as the
antibodies are used up to develop immunity against diseases/no memory.
(1)
OR
D. Active immunity is slow, and it takes time to give its full effective response.
(1)
-------------------
For Visually impaired students
Same answers as given in parts A - D.

Section – E

31 A. 5

B. (2)
 Transcription in eukaryotes involves one of three types of polymerases,
depending on the gene being transcribed. RNA polymerase II transcribes
all of the protein-coding genes, whereas RNA polymerase I transcribes
rRNA genes, and RNA polymerase III transcribes rRNA, tRNA, and small
nuclear RNA genes. (1)
 The primary transcripts contains the coding region, exon, and non-coding
region, intron, hnRNA undergoes a process where the introns are
removed and exons are joined to form mRNA by the process called
splicing. (1)
 The hnRNA undergoes two additional processes called capping and
tailing. In capping, an unusual nucleotide, methyl guanosine triphosphate,
is added to the 5′-end of hnRNA. In tailing, adenylate residues (about 200–
300) are added at 3′-end in a template independent manner. (1)
-------------------
For visually impaired students
A. If both strands act as a template, they will code for RNA molecules with

different sequences as complementarity does not mean the strands are
identical and hence, the sequence of amino acids in the proteins would be
different. Hence, one segment of the DNA would be coding for two different
proteins, and this would complicate the genetic information transfer
machinery. (1)
The two RNA molecules if produced simultaneously would be
complementary to each other, hence would form a double stranded RNA.
This would prevent RNA from being translated into protein and the exercise
of transcription would become a futile one. (1)
B. Transcription in eukaryotes involves one of three types of polymerases,
depending on the gene being transcribed. RNA polymerase II transcribes
all of the protein-coding genes, whereas RNA polymerase I transcribes
rRNA genes, and RNA polymerase III transcribes rRNA, tRNA, and small
nuclear RNA genes. (1)
The primary transcripts contain the coding region, exon, and non-coding
region, intron, hnRNA undergoes a process where the introns are removed
and exons are joined to form mRNA by the process called splicing. (1)
The hnRNA undergoes two additional processes called capping and tailing.
In capping, an unusual nucleotide, methyl guanosine triphosphate, is added
to the 5′-end of hnRNA. In tailing, adenylate residues (about 200–300) are
added at 3′-end in a template independent manner. (1)
OR
A. Aminoacylation is the process by which amino acids become activated by
binding with its aminoacyl tRNA synthetase in the presence of ATP. If two
charged tRNAs come close during translation process the formation of
peptide bond between them is energetically favourable. (1)
B. The cellular factory responsible for synthesising proteins is the ribosome.
In its inactive state it exists as two subunits: a large subunit and a small
subunit. When the small subunit encounters an mRNA the process of
translation of the mRNA to protein begins. There are two sites in the large
subunit for subsequent amino acids to bind to and thus be close enough
to each other for the formation of a peptide bond. The ribosome also acts
as a catalyst 23S rRNA in bacteria is the enzyme-ribozyme for the
formation of peptide bonds. (2)
C. ARGININE, THREONINE, HISTIDINE, LEUCINE, PROLINE, GLYCINE,
PROLINE PROLINE, PROLINE, LEUCINE SERINE (1)
Stop codon UGA/UAG/UAA (1)
-------------------
For visually impaired students
A and B as above
C. Insertion or deletion of one or two bases changes the reading frame from
the point of insertion or deletion. Such mutations are referred to as frame-
shift mutations. Insertion or deletion of three or multiple of three bases
does not alter the frame. However, the mutation takes place. This proves
that codon is a triplet and it is read in a contiguous manner. (2)

32 A. Retrovirus in animals and Agrobacterium tumefaciens can transform 5
normal cells into cancerous cells/Agrobacterium tumefaciens is
responsible for causing crown gall disease/ it can transfer its T-DNA to
transform normal plant cell into tumorous cells (1). They are used as
cloning vectors to deliver desirable genes into animal/plant cells. (1)
B. restriction enzyme and ligase. (1).
C.
(i) Biolistic/ gene guns can be used. The plant cells are bombarded with
high velocity micro particles of gold or tungsten coated with DNA. (1)
(ii) the cry gene will create Bt toxin inside the pest which will get activated
in the alkaline gut of the pest and cause the gut epithelial lining to
disintegrate. (1)
OR
A. 5' - GGATCC - 3'.
3’- CCTAGG-5’ (1)
B. drawing and labelling (2)

C. If ampicillin is added, the bacteria will show resistance as the gene is
intact and will survive;
if tetracycline is added, the bacteria will die as it will show insertional
inactivation/ gene is not functional owing to insertion of the gene of
interest in the tetracycline region of selectable marker. (2)

33 A. Totally unrelated species could also compete for the same resource. For 5
instance, in some shallow South American lakes, visiting flamingoes and
resident fishes compete for their common food, the zooplankton in the
lake. (1)
B. Resources need not be limiting for competition to occur; in interference
competition, the feeding efficiency of one species might be reduced due
to the interfering and inhibitory presence of the other species, even if
resources (food and space) are abundant. (1)
C. Gause and other experimental ecologists believed when resources are
limited the competitively superior species will eventually eliminate the
other species. The Abingdon tortoise in Galapagos Islands became

extinct within a decade after goats were introduced on the island,
apparently due to the greater browsing efficiency of the goats. (1)
D. One such mechanism is ‘resource partitioning’. If two species compete for
the same resource, they could avoid competition by choosing, for
instance, different times for feeding or different foraging patterns.
MacArthur showed that five closely related species of warblers living on
the same tree were able to avoid competition and co-exist due to
behavioural differences in their foraging activities. (1)
E. A species whose distribution is limited to a smaller area because of the
presence of a competitively superior organism, is found to increase its
range when the competing species is experimentally removed. For
example, in the coasts of Scotland the superior barnacle (Balanus)
dominates the intertidal region and excludes the smaller barnacle from
that zone. (1)
OR
A. Food chain and the first law of thermodynamics. The solar energy trapped
by the plants is transformed to chemical energy through the process of
photosynthesis. When the plants are consumed by the animals, the
organic matter (chemical energy) is transferred to the animal, some
amount of this organic matter is lost as heat through the process of
respiration. Death of the producers or consumers will result in the organic
matter getting transferred to detritivores. As demonstrated, energy is not
created nor destroyed but transformed from one form to another. (2)
B. Greater diversity is seen in regions closer to equator/ tropics (latitudinal
range of 23.5° N to 23.5° S) harbour more species. (1)
Reasons for this greater diversity are: (Any two reason)
● Speciation is generally a function of time, unlike temperate regions
subjected to frequent glaciations in the past, tropical latitudes have
remained relatively undisturbed for millions of years and thus, had a
long evolutionary time for species diversification
● Tropical environments, unlike temperate ones, are less seasonal,
relatively more constant and predictable. Such constant
environments promote niche specialisation and lead to a greater
species diversity
● There is more solar energy available in the tropics, which contributes
to higher productivity; this in turn might contribute indirectly to
greater diversity. (2, any two)

***********

जीवववज्ञान – कोड न. 044
अंकन योजना
कक्षा XII (2025-26)

खण्ड- क

1. ग. जनन कोशिका के नाशिक का समसूत्री शििाजन द्वारा 1

2. ख. एक नर युग्मक और दो ध्रुिीय केन्द्रक 1

3. ग. एफएसएच और एलएच 1

4. ग. फ्रेडररक शिशफथ का प्रयोग 1

5. क. प्रोब 1

6. ग. हाडी-िेनबगग शसद्ाां त कहता है शक जनसांख्या में फेनोटाइप आिृशियााँ स्थथर होती हैं 1
और पीढी दर पीढी एक समान होती हैं ।
7. ख. 25% 1

8. घ. पैर के शिकार से प्रजनन अलगाि और प्रजनन की प्रशिया प्रिाशित हो सकती है , जो 1
प्रजनन की पुकार पर प्रिाि डालती है ।
9. घ. जीिाणुज , यकृत सांिमण, लाल रक्त कोशिका सां िमण, युग्मकजनक 1

10. ख. AUGAGACGGACUGCAUUCCCAACCUGA 1

11. क. लाइसोजाइम, राइबोन्यूस्िऐस, प्रोटीएज़, ठां डा इथेनॉल 1

12. ग. I और II दोनोां 1

13. ग. A सत्य है लेशकन R असत्य है । 1

14. क. A और R दोनोां सत्य हैं और R, A का सही स्पष्टीकरण है । 1

15. क. A और R दोनोां सत्य हैं और R, A का सही स्पष्टीकरण है । 1

16. ग. A सत्य है लेशकन R असत्य है । 1

खण्ड- ख
17. क. यह शिपुां सन और बोरा िस्त्रािरण तकनीकोां द्वारा प्राप्त शकया जाता है । 2
यशद मादा जनक में उियशलांगी फूल होते हैं , तो परागकोष के शिखांडन से पहले फूल
की कली से परागकोष को शचमटी का उपयोग करके शनकालना आिश्यक होता है ।
इस चरण को शिपुांसन कहा जाता है ।
नपुांसक फूलोां को उपयुक्त आकार के बैग से ढकना पड़ता है , जो आम तौर पर बटर
पेपर से बना होता है , ताशक अिाां शित पराग से उसके िशतगकाि को दू शषत होने से
बचाया जा सके। इस प्रशिया को बैशगांग या बोरा िस्त्रािरण कहा जाता है ।
(1 x 2 = 2)
अथवा

ख. मटर के पौधोां में, हस्टचशलत शिपुांसन आसान है और पराग कण महीनोां तक व्यिहायग
रहते हैं क्ोांशक यह लेग्युशमनोसी से सांबांशधत है ।
गेहां के फूलोां (स्पाइकलेट्स) में पराग कण शनकलने के आधे घांटे बाद अपनी
जीिनक्षमता खो दे ते हैं । (1 x 2 = 2)

18. एक प्रशतलेखन इकाई में, शकसी शदए गए उन्नायक पर आरएनए पॉलीमरे ज़ की गशतशिशध 2

सहायक प्रोटीन द्वारा शिशनयशमत होती है शजसमें प्रारां ि थथलोां को पहचानने की क्षमता
होती है । (1)
ये शिशनयामक प्रोटीन ऑपरे टर के साथ सकारात्मक (एस्ििेटर) और नकारात्मक
(ररप्रेसर) दोनोां तरह से कायग कर सकते हैं जो ऑपेरॉन इकाई में उन्नायक के शनकट होता
है । (1)
19. 2
क. जन्म के समय मौजूद जन्मजात प्रशतरक्षा/गैर-शिशिष्ट प्रकार की रक्षा/प्रशतरक्षा
प्रिाशित होती है क्ोांशक यह हमारे िरीर में शिदे िी एजें टोां के प्रिेि के शलए शिशिन्न
प्रकार की बाधाएां प्रदान करती है । (1)
ख. सेलुलर बाधा-मोनोसाइट् स सबसे कम सां ख्या में है और यह सूक्ष्मजीिोां को
फागोसाइटोज और नष्ट कर सकता है । (1)
20. 2
क. कोई िी व्यस्क्त जो शकसी िी जीशित जीि या उनके उत्पादोां को प्रौद्योशगकी का
उपयोग/ सां िोधन कर सकता है , उसे जैि प्रौद्योशगकीशिद् माना जाता है । (1)
इस प्रकार, पनीर शनमाग ता एक जैि प्रौद्योशगकीशिद् हो सकता है क्ोांशक िह
िाशणस्िक उद्दे श्य के शलए पनीर बनाने के शलए बैिीररया, किक जैसे सूक्ष्म जीिोां
का प्रयोग कर रहा है । (1)
अथवा
ख. एां टीबायोशटक दिाओां के शनस्ियण के कारण पुनः सांयोजकोां का चयन एक बोशिल
प्रशिया है , क्ोांशक इसके शलए अलग-अलग एां टीबायोशटक दिाओां िाली दो प्लेटोां
पर एक साथ प्लेशटां ग की आिश्यकता होती है । (1)
शनिेिन शनस्ियण शिशध में, बीटा गैलेिोशसडे ज़ एां जाइम के कोशडां ग अनुिम में पुनः
सांयोजक डीएनए के शनिेिन से यह एां जाइम शनस्िय हो जाता है और कॉलोशनयााँ
कोई रां ग उत्पन्न नहीां करतीां। शनिेिन की अनुपस्थथशत में, िणगजनक सब्सटर े ट की
उपस्थथशत से कॉलोशनयााँ नीले रां ग की हो जाती हैं । (1)
21. 2
क.
(i) बायोमास का पहला (सीधा) शपराशमड थथलीय पाररस्थथशतकी तांत्र के अनुरूप है ।
उत्पादकोां के पास अशधकतम बायोमास होता है , जो िाकाहारी (प्राथशमक
उपिोक्ता), शद्वतीयक उपिोक्ता और तृतीयक उपिोक्ता के साथ घटता है । दू सरा
(उल्टा) शपराशमड फाइटोप्लाां कटन की एक िोटी खड़ी फसल को सांदशिगत करता है
जो ज़ूप्लाां कटन/जलीय पाररस्थथशतकी तांत्र की एक बड़ी खड़ी फसल का समथग न
करता है । (1)

(ii)

दृशष्टबाशधत शिद्याशथगयोां के शलए
(उिर उपरोक्त (i) और (ii) के समान है )
अथवा
ख.
(i) 3000+1300+427+427+378=5532
(ii)
क. जानिर गशतिील होते हैं और कठोर पररस्थथशतयोां से बचने या नए क्षेत्रोां की खोज
करने के शलए पलायन कर सकते हैं ।
ख. जानिरोां ने बदलते िातािरण के साथ अनुकूलन शकया है , जशटल तांशत्रका तां त्र और
ररसेप्टसग शिकशसत शकए हैं । उनकी प्रशतशियाएाँ अनुकूली हैं और जीशित रहने को
सुशनशित करती हैं । पौधे, स्थथर होने के कारण, पानी, खशनजोां और सूरज की रोिनी
के शलए कम शिकासिादी अनुकूलन करते हैं । (कोई िी एक) (1)

खण्ड- ग
22. (i) कांडोम; ये गिाग िय िीिा में िुिाणुओां के प्रिेि को अिरुद् करके कायग करते 3
हैं ।
(ii) सशजगकल शिशधयााँ जैसे शक मशहला द्वारा ट्यू बेिोमी या उसके पशत द्वारा पुरुष
नसबांदी, क्ोांशक ये अपररितगनीय शिशधयााँ हैं ।
(iii) प्रोजेस्टोजेन या प्रोजेस्टोजेन-एस्टर ोजन सांयोजन युक्त मौस्खक गोशलयााँ , क्ोांशक
अिरोध शिशधयोां की शिफलता दर अशधक होती है । (1x3=3)

23. (i) (a) अांडाणु अगुशणत (n) होता है तथा (c) - ब्लास्टोशमयर शद्वगुशणत (2n) होते हैं । 3

(ii) यशद टर ोफोब्लास्ट (L) एां डोमेशटर यम से ठीक से नहीां जु ड़ता है , तो इससे आरोपण
शिफलता, गिाग िथथा की हाशन और अन्य गिाग िथथा सांबांधी जशटलताएां हो सकती हैं ।
(iii) केस X में, इन भ्रूणोां की कोशिकाओां का जीनोम एक समान होगा क्ोांशक िे एक ही
युग्मनज से शिकशसत हुए हैं । (1x3=3)

दृशष्टबाशधत शिद्याशथगयोां के शलए

(i) माइटोशटक शििाजन शजसे िीिेज कहते हैं , तब िु रू होता है जब यु ग्मनज
शडां बिाशहनी के इथथमस से होकर गिाग िय की ओर बढता है और 2,4,8,16 सांतशत
कोशिकाएाँ बनाता है शजन्हें ब्लास्टोमेरेस कहते हैं । 8 से 16 कोशिका ब्लास्टोमेरेस
िाले भ्रूण को मोरुला कहते हैं । (1)
(ii) मोरुला ब्लास्टोशसस्ट में पररिशतगत हो जाता है और ब्लास्टोशसस्ट में ब्लास्टोमेरेस
एक बाहरी परत में व्यिस्थथत हो जाते हैं शजसे टर ोफोब्लास्ट कहा जाता है और
टर ोफोब्लास्ट से जुड़ी कोशिकाओां का एक आां तररक समूह शजसे आां तररक
कोशिका द्रव्यमान कहा जाता है । (1)
(iii) टर ोफोब्लास्ट परत शफर गिाग िय के एां डोमेशटर यम से जुड़ जाती है और आां तररक
कोशिका द्रव्यमान भ्रूण के रूप में शििेशदत हो जाता है । जुड़ने के बाद, गिाग िय
की कोशिकाएाँ तेज़ी से शििाशजत होती हैं और ब्लास्टोशसस्ट को ढक लेती हैं जो
एां डोमेशटर यम में समाशहत हो जाती है शजससे प्रत्यारोपण होता है । (1)
24. 3
BbGg नर को BbGg मादा के साथ सांकरण कराया गया है , जो दोनोां ही आां खोां और
बालोां के रां ग के शलए शिषमयुग्मी हैं । (1)

पुनेट स्क्वायर (1)
1/16 या 6.25% - नीली आां खें और सफेद कोट (1)
25. 3
क. ये जानिर अशिसारी शिकास प्रदशिगत करते हैं , इसमें सांरचनाएाँ िारीररक रूप से
समान नहीां होते हैं , िे समान कायग करने के शलए शिकशसत होती हैं , जो एक ही आिास
के शलए अनुकूशलत होते हैं , सैल्मन और िाकग के पांख, डॉस्फ़िन, सील और व्हे ल के
स्ललपर। कोई यह कह सकता है शक यह समान आिास है शजसके पररणामस्वरूप
जीिोां के शिशिन्न समूहोां में समान अनुकूली शििेषताओां का चयन हुआ है , लेशकन एक
ही कायग की ओर: इसशलए, समान सांरचनाएाँ अशिसारी शिकास का पररणाम हैं । (2)
ख. इचशथयोसॉर। कुि िूशम सरीसृप सांिितः 200 शमशलयन िषग पहले मिली जै से
सरीसृपोां में शिकशसत होने के शलए पानी में िापस चले गए। (1)
दृशष्टबाशधत शिद्याशथगयोां के शलए
लैमाकग और डाशिगन दोनोां का मानना था शक जीशित चीजोां में िांिानुगत गुण होते हैं , ऐसे
गुण जो िे अपनी सांतानोां को दे सकते हैं । उनका मानना था शक कुि गुण दू सरोां की
तुलना में अशधक उपयोगी होते हैं , और समय के साथ अशधक उपयोगी गुण अशधक आम
हो जाते हैं । (1)

अांतर यह है शक लैमाकग का मानना था शक शकसी जीि में उसके जीिन के दौरान होने
िाले पररितगन आने िाली पीशढयोां/अशधिशहत लक्षणोां की शिरासत में शमल सकते हैं ।
इसशलए, उदाहरण के शलए शजरा़ि ने अपने पूरे जीिन में ऊाँचे पौधोां की पशियााँ खाने के
शलए अपनी गदग न को फैलाया, तो उसकी सांतान लांबी गदग न िाली होगी (या लैमाशकगयन
शसद्ाां त का कोई अन्य उदाहरण)। (1)
डाशिगन का मानना था शक प्राकृशतक चयन के बाद िोटे , यादृस्िक और िशमक
आनुिांशिक पररितगन शिकास की ओर ले जाते हैं - शक कुि शजराफोां की गदग न स्वािाशिक
रूप से लांबी होती थी, और ये िे थे शजनके ज़्यादा बच्चे होते थे। इसशलए समय के साथ
प्राकृशतक चयन के कारण शिकास हुआ लांबी गदग न िाले शजराफ िोटी गदग न िाले शजराफोां
से ज़्यादा शफट थे (1)

26. 3
सीिेज उपचार में 'फ्लोक्स' और 'सशिय आपां क' बीओडी को कम करने में मदद करते
हैं ।
(i) फ्लोक्स: ये बैिीररया के समूह होते हैं जो कीचड़ और फांगल तांतुओां द्वारा एक साथ
रखे जाते हैं और जाल जै सी सांरचना बनाते हैं । इनका उपयोग शद्वतीयक सीिे ज
उपचार के दौरान िातन टैं क में अपघटन की दर बढाने के शलए शकया जाता है ।
सूक्ष्मजीि बहुत सारे काबगशनक पदाथों को पचाते हैं , इसे माइिोशबयल बायोमास में
पररिशतगत करते हैं और बहुत सारे खशनज िोड़ते हैं । नतीजतन, सीिेज का BOD कम
हो जाता है । चूांशक अपशिष्ट का BOD कच्चे सीिेज के 1% तक कम हो जाता है ,
इसशलए इसे शनपटान टैं क में िेज शदया जाता है । इन टैं कोां में, फ्लोक्स को अिसादन
से गुजरने शदया जाता है ।
(ii) सशिय आपांक: शनपटान टैं क के तलिट को सशिय आपांक कहा जाता है । इसका
एक शहस्सा िातन टैं क में इनोकुलम के रूप में उपयोग शकया जाता है । िेष िाग को
एनारोशबक स्लज डाइजेस्टर नामक एक बड़े टैं क में डाला जाता है । इन टैं कोां में
एनारोशबक सूक्ष्मजीि मौजू द होते हैं जो सशिय आपां क के काबगशनक द्रव्यमान के
साथ-साथ एरोशबक सूक्ष्मजीिोां को िी पचाते हैं । िेष आपांक का उपयोग खाद या
कम्पोस्ट के रूप में शकया जाता है ।

27. 3
एशलसा-एां जाइम शलांक्ड इम्यूनोसॉबेंट एसेस (1)
एशलसा प्रशतजन-प्रशतरक्षी अां तः शिया पर आधाररत है ।
एशलसा द्वारा सांिमण या बीमारी की उपस्थथशत का पता लगाने के तरीके इस प्रकार हैं :
एां टीजन (प्रोटीन, ग्लाइकोप्रोटीन, आशद) की उपस्थथशत का पता लगाया जाता है | (1)
रोगजनकोां के शिरुद् उत्पाशदत एां टीबॉडी का पता लगाया जाता है । (1)
28. 3
1950 – शिस्तार - 1950 में जनसांख्या सांरचना एक चौड़े आधार िाले शपराशमड को
प्रदशिगत करती है , जो शक अशधक व्यापक आधार के साथ है , जो युिा व्यस्क्तयोां के उच्च
प्रशतित को दिाग ता है । यह उच्च जन्म दर िाली जनसांख्या का सांकेत दे ता है । (1)
2007 – स्थथर - िीषग की ओर शपराशमड का सां कुशचत होना कम को दिाग ता है ।बुजुगग
व्यस्क्तयोां का अनुपात। 2007 तक, जनसांख्या अशधक स्थथर थी प्रजनन पूिग और प्रजनन
आयु की सांख्या लगिग समान है ।घांटी का आकार स्थथर जनसांख्या को दिाग ता है । (1)

2050 – घटती - 2050 तक घटती हुई जनसांख्या कलि के आकार का शपराशमड घटती
हुई जनसांख्या को दिाग ता है जहााँ जन्म दर बहुत कम है और बुजुगग लोगोां की आबादी
बढोतरी होगी | (1)
दृविबावित छात्ों के विए
उिर ऊपर शदए गए अनुसार ही होगा

खण्ड- घ
29. क. प्रत्येक बीजाां ड में एक भ्रूणकोष मौजूद होता है और प्रत्येक भ्रूणकोष में एक अां डा 4

मौजूद होता है जब भ्रूणकोष एक एकल बीजाां डशरांत से शिकशसत होती है । (1)
ख.
(i) P एक बीज में एक से बहुभ्रूणोां की उपस्थथशत के कारण बहुभ्रूणता प्रदशिगत करता
है । भ्रूण बीजाां डकोशिका कोशिकाओां से असांग जनन द्वारा शिकशसत होते हैं , जो शक
एक प्रकार का भ्रूण है , शजसमे अलैंशगक प्रजनन, आनुिांशिक शिन्नता नहीां शदखाते
हैं । (1)
(ii) शद्वगुशणत बीजाां डकाय कोशिकाओां से शिकशसत भ्रूण की कोशिकाएाँ शद्वगुशणत (2n)
होती हैं क्ोांशक ये असांग जनन द्वारा बनते हैं , जो अलैंशगक प्रजनन का एक रूप है ।
(1)
िात्र को उपिाग ग या घ में से कोई एक करना होगा।
ग. Q, क्ोांशक यह फल शबना शनषेचन के शिकशसत होता है और इस प्रकार बीज रशहत
होगा। (1)
अथवा
घ. फल S बीज िाला एक िास्तशिक फल है । िास्तशिक फल शनषेचन के बाद पके हुए
अांडािय से शिकशसत होते हैं और शनषेशचत बीजाां ड बीज में पररपक्व होते हैं । (1)

30. क. शनस्िय प्रशतरक्षा - कोलोस्टर म से तैयार एां टीबॉडी / कम प्रिािी / क्षशणक / कोई 4
स्मृशत कोशिका िाशमल नहीां
सशिय प्रशतरक्षा - मेजबान की प्रशतरक्षा प्रणाली / लैग चरण / स्मृशत द्वारा शनशमगत
आधाररत/काफी हद तक प्रिािी। (1)
ख. सशिय प्रशतरक्षा: चूांशक िैक्सीन में रोगज़नक़ (सूक्ष्मजीि) का कमज़ोर या शनस्िय
रूप होता है , जो हाशनरशहत होता है लेशकन शफर िी प्रशतरक्षा प्रणाली द्वारा शिदे िी
के रूप में पहचाना जाता है । प्रशतरक्षा प्रणाली शलम्फोसाइटोां को सशिय करके
प्रशतशिया करती है , जो रोगज़नक़ से लड़ने के शलए शिशिष्ट एां टीबॉडी का उत्पादन
करते हैं । इस प्रशिया से मेमोरी कोशिकाओां का शनमाग ण िी होता है , जो व्यस्क्त के
शफर से सांपकग में आने पर इस रोगज़नक़ से लड़ने के शलए "याद" करके दीघग काशलक
सुरक्षा प्रदान करते हैं । (2)
िात्र को उपिाग ग या घ में से कोई एक करना होगा।
ग. यह शनस्िय प्रशतरक्षा पहले शदन चरम पर होती है और बिड़े के बड़े होने पर घटती
जाती है , क्ोांशक रोगोां के शिरुद् प्रशतरक्षा शिकशसत करने के शलए एां टीबॉडी का
उपयोग हो जाता है /स्मृशत नहीां रहती।
अथवा

घ. सशिय प्रशतरक्षा धीमी होती है , तथा इसे पूणग प्रिािी प्रशतशिया दे ने में समय लगता
है ।
दृशष्टबाशधत िात्रोां के शलए
िाग क - घ में शदए गए उिर समान होांगे।

खण्ड - ड
31. क. 5

(2)
ख.
● सुकेंद्रकक में अनु लेखन में तीन प्रकार के पॉलीमरे ज़ में से एक िाशमल होता है , जो
अनुलेखन शकए जा रहे जीन पर शनिगर करता है । RNA पॉलीमरे ज़ II सिी प्रोटीन-
कोशडां ग जीन को अनुलेस्खत करता है , जबशक RNA पॉलीमरे ज़ I आरआरएनए जीन
को अनुलेस्खत करता है , और आरएनए पॉलीमरे ज़ III rRNA, tRNA और िोटे
परमाणु RNA जीन को अनुलेस्खत करता है । (1)
● प्राथशमक अनुलेख में कोशडां ग क्षेत्र, एक्सॉन, और गैर-कोशडां ग क्षेत्र, इां टरोन िाशमल होते
हैं , hnRNA एक प्रशिया से गुजरता है जहाां इां टरोन हटा शदए जाते हैं और एक्सॉन को
स्थप्लशसांग नामक प्रशिया द्वारा mRNA बनाने के शलए जोड़ा जाता है । (1)
● hnRNA दो अशतररक्त प्रशियाओां से गुजरता है शजन्हें आिादन (कैशपां ग) और पूिन
(टे शलांग) कहा जाता है । कैशपां ग में, एक असामान्य न्यूस्ियोटाइड, शमथाइल ग्वानोशसन
टर ाइफॉस्फेट, hnRNA के 5'-अांत में जोड़ा जाता है । पूिन में, एडे शनलेट अििेष
(लगिग 200- 300) टे म्पलेट स्वतां त्र तरीके से 3'-अांत में जोड़े जाते हैं । (1)

दृविबावित ववद्यावथियों के विए
क. यशद दोनोां िाख एक टे म्पलेट के रूप में कायग करते हैं , तो िे अलग-अलग अनुिमोां
िाले RNA अणुओां के शलए कोड करें गे क्ोांशक पूरकता का मतलब यह नहीां है शक
िाख़ समान हैं और इसशलए, प्रोटीन में अमीनो एशसड का अनुिम अलग होगा।
इसशलए, DNA का एक खां ड दो अलग-अलग प्रोटीन के शलए कोशडां ग करे गा, और
यह आनुिांशिक सूचना हस्ताां तरण मिीनरी को जशटल करे गा। (1)
यशद दो RNA अणु एक साथ उत्पाशदत होते हैं तो िे एक दू सरे के पूरक होांगे, इसशलए
एक शद्व िाख़ RNA बन जाएगा। यह RNA को प्रोटीन में रूपाां तररत होने से रोक
दे गा और व्यायाम को रोक दे गा। अनुलेखन का कायग शनरथगक हो जाएगा। (1)
ख. सुकेंद्रकक में अनु लेखन में तीन प्रकार के पॉलीमरे ज़ में से एक िाशमल होता
है ,अनुलेस्खत शकए जाने िाले जीन के आधार पर RNA पॉलीमरे ज़ II सिी प्रोटीन-
कोशडां ग जीन को अनुलेस्खत करता है , जबशक RNA पॉलीमरे ज़ I rRNA जीन को
अनुलेस्खत करता है , और RNA पॉलीमरे ज़ III rRNA, tRNA और िोटे प्रोटीन तथा
िोटे केंद्रकी RNA (sn RNA) जीन को अनुलेस्खत करता है । (1)

प्राथशमक अनुलेख में कोशडां ग क्षेत्र, एक्सॉन और गैर-कोशडां ग क्षेत्र, इां टरोन िाशमल होते
हैं , hnRNA एक प्रशिया से गुजरता है जहाां इां टरोन को हटा शदया जाता है और एक्सॉन
को स्थप्लशसां ग( सां बांधन)नामक प्रशिया द्वारा mRNA बनाने के शलए जोड़ा जाता है ।
(1)
hnRNA दो अशतररक्त प्रशियाओां से गुजरता है शजन्हें आिादन (कैशपांग) और
पुिन (टे शलांग) कहा जाता है । कैशपांग में, एक असामान्य न्यूस्ियोटाइड, शमथाइल
ग्वानोशसन टर ाइफॉस्फेट, hnRNA के 5'-िोर पर जोड़ा जाता है , टे शलांग में,
एशडनाइलेट अििेष (लगिग 200-300) टे म्पलेट स्वतां त्र तरीके से 3'-िोर पर जोड़े
जाते हैं । (1)
अथवा
क. अमीनोएसाइलेिन या अन्तरण आर ऐन ए का आिेिीकरण िह प्रशिया है शजसके
द्वारा अमीनो एशसड ATP की उपस्थथशत में अपने अमीनोएसाइल tRNA शसांथेटेस के
साथ बांध कर सशिय हो जाते हैं । यशद दो आिेशित tRNA अनुिाद प्रशिया के दौरान
पास आते हैं तो उनके बीच पेप्टाइड बॉन्ड का शनमाग ण ऊजाग िान रूप से अनुकूल
होता है । (1)
ख. प्रोटीन के सांश्लेषण ( रूपाां तरण)के शलए शजम्मेदार कोशिकीय कारखाना राइबोसोम
है । अपनी शनस्िय अिथथा में यह दो उप एक को के रूप में मौजूद होता है , एक
बड़ा एकक और एक िोटी एकक ।जब िोटी एकक से टकराती है तो mRNA के
प्रोटीन में रूपाां तरण की प्रशिया िुरू हो जाती है । बड़ी एकक (सबयूशनट) में बाद
के अमीनो एशसड के शलए दो जगह होती हैं , शजससे िे पे प्टाइड आबांध के शनमाग ण के
शलए एक दू सरे के काफी करीब होते हैं । राइबोसोम उत्प्रेरक के रूप में िी काम
करता है बैिीररया में 23S rRNA पेप्टाइड आबांध के शनमाग ण के शलए एां जाइम-
राइबोजाइम है । (2)
ग. आशजगशनन, थ्रेओनीन, शहस्स्टडीन, ल्यूसीन, प्रोलाइन, ग्लाइशसन, प्रोलाइन प्रोलाइन,
प्रोलाइन, ल्यूसीन, सेरीन। (1)
स्टॉप कोडन:- यूजीए/यूएजी/यूएए। (1)

दृविबावित ववद्यावथियों के विए
उपरोक्तानुसार क और ख
ग. एक या दो बेस के सस्म्मलन या शिलोपन से सस्म्मलन या शिलोपन के शबांदु से प्राधार
(रीशडां ग फ़्रेम )बदल जाता है । ऐसे उत्पररितगनोां को फ़्रेम-शिफ्ट उत्पररितगन कहा
जाता है । तीन या तीन से अशधक बेस के सस्म्मलन या शिलोपन से फ़्रेम में कोई
पररितगन नहीां होता। हालााँ शक, उत्पररितगन होता है । इससे यह साशबत होता है शक
प्रकूट (कोडन )एक शत्रक है और इसे एक साथ पढा जाता है । (2)

32. क. जानिरोां में रे टर ोिायरस और एिोबैिीररयम ट्यूमेफेशसएन्स सामान्य कोशिकाओां को 5
कैंसर कोशिकाओां में बदल सकते हैं /एिोबैिीररयम ट्यूमेफेशसएन्स िाउन गॉल रोग
पैदा करने के शलए शजम्मेदार है /यह अपने टी-डीएनए को सामान्य पौधे की कोशिका
को ट्यूमर कोशिकाओां में बदलने के शलए थथानाां तररत कर सकता है । (1)
इनका उपयोग िोशनांग िे िर के रूप में पिु /पौधे की कोशिकाओां में िाां शित जीन
पहुां चाने के शलए शकया जाता है । (1)

ख. प्रशतबांधन एां जाइम और लाइगेज (1)
ग.
(i) बायोशलस्स्टक/जीन गन का इस्तेमाल शकया जा सकता है । पौधोां की कोशिकाओां पर
डीएनए से लेशपत सोने या टां गस्टन के उच्च िेग िाले सू क्ष्म कणोां की बमबारी की जाती
है । (1)
(ii) िाई जीन कीट के अांदर बीटी शिष पैदा करे गा जो कीट की क्षारीय आां त में सशिय
हो जाएगा और आां त की उपकला परत को शिघशटत कर दे गा। (1)

अथवा
क. 5'-जीजीएटीसीसी - 3'
3'-सीसीटीएजीजी-5' (1)
ख. नामाां शकत शचत्र (2)

ग. यशद एम्पीशसलीन शमलाया जाता है , तो बैिीररया प्रशतरोध शदखाएगा क्ोांशक जीन
उपस्थथत है और जीशित रहे गा।
यशद टे टरासाइस्िन शमलाया जाता है , तो बैिीररया मर जाएगा क्ोांशक यह शनिेषन
से शनस्ियता शदखाएगा/चयन योग्य माकगर के टे टरासाइस्िन क्षेत्र में रुशच के जीन
के सस्म्मलन के कारण जीन कायाग त्मक नहीां है । (2)

33. क. पूरी तरह से असां बांशधत प्रजाशतयााँ िी एक ही सांसाधन के शलए प्रशतस्पधाग कर सकती 5
हैं । उदाहरण के शलए, कुि उथली दशक्षण अमेररकी िीलोां में, आने िाले फ्लेशमांगो
और थथानीय मिशलयााँ अपने आम िोजन, िील में ज़ूप्लैंकटन के शलए प्रशतस्पधाग
करती हैं | (1)
ख. प्रशतस्पधाग के शलए सांसाधनोां का सीशमत होना आिश्यक नहीां है ; हस्तक्षेप प्रशतस्पधाग
में, एक प्रजाशत की िोजन दक्षता अन्य प्रजाशतयोां की हस्तक्षेपकारी और शनरोधात्मक
उपस्थथशत के कारण कम हो सकती है , िले ही सांसाधन (िोजन और थथान) प्रचुर
मात्रा में होां। (1)
ग. गौस और अन्य प्रायोशगक पाररस्थथशतकीशिदोां का मानना था शक जब सांसाधन सीशमत
होते हैं तो प्रशतस्पधाग त्मक रूप से श्रेष्ठ प्रजाशतयााँ अांततः अन्य प्रजाशतयोां को खत्म कर
दे ती हैं । गैलापागोस द्वीप समूह में एशबांगडन किु आ बकररयोां के द्वीप पर आने के

एक दिक के िीतर शिलुप्त हो गया, जाशहर तौर पर बकररयोां की अशधक ब्राउशज़ांग
दक्षता के कारण। (1)
घ. ऐसा ही एक तां त्र है 'सांसाधन शििाजन'। यशद दो प्रजाशतयााँ एक ही सांसाधन के शलए
प्रशतस्पधाग करती हैं , तो िे उदाहरण के शलए, िोजन के शलए अलग-अलग समय या
अलग-अलग चारागाह पैटनग चुनकर प्रशतस्पधाग से बच सकती हैं । मैकआथगर ने
शदखाया शक एक ही पेड़ पर रहने िाले िॉरब्लर की पााँ च शनकट सां बांधी प्रजाशतयााँ
अपनी चारागाह गशतशिशधयोां में व्यिहाररक अां तर के कारण प्रशतस्पधाग से बचने और
सह-अस्स्तत्व में रहने में सक्षम थीां। (1)
ङ. एक प्रजाशत शजसका शितरण प्रशतस्पधाग त्मक रूप से श्रेष्ठ जीि की उपस्थथशत के
कारण एक िोटे क्षेत्र तक सीशमत है , जब प्रशतस्पधी प्रजाशत को प्रयोगात्मक रूप से
हटा शदया जाता है , तो इसकी सीमा बढ जाती है । उदाहरण के शलए, स्कॉटलैंड के
तटोां में श्रेष्ठ बानेकल (बैलेनस) इां टरटाइडल क्षेत्र पर हािी है और िोटे बानेकल को
उस क्षेत्र से बाहर कर दे ता है । (1)
अथवा
क. खाद्य श्रृांखला और ऊष्मागशतकी का पहला शनयम पौधोां द्वारा पकड़ी गई सौर ऊजाग
प्रकाि सांश्लेषण की प्रशिया के माध्यम से रासायशनक ऊजाग में बदल जाती है । जब
पौधे जानिरोां द्वारा खाए जाते हैं , तो काबगशनक पदाथग (रासायशनक ऊजाग ) जानिरोां में
थथानाां तररत हो जाता है , इस काबगशनक पदाथग की कुि मात्रा श्वसन की प्रशिया के
माध्यम से गमी के रूप में खो जाती है । उत्पादकोां या उपिोक्ताओां की मृत्यु के
पररणामस्वरूप काबगशनक पदाथग अपरदिक्षी में थथानाां तररत हो जाएगा। जैसा शक
प्रदशिगत शकया गया है , ऊजाग का शनमाग ण या शिनाि नहीां होता है , बस्ि एक रूप से
दू सरे रूप में पररिशतगत होता है । (2)
ख. िूमध्य रे खा/उष्णकशटबांधीय क्षेत्रोां (23.5° उिर से 23.5° दशक्षण की अक्षाां िीय सीमा)
के करीब के क्षेत्रोां में अशधक शिशिधता दे खी जाती है , जहााँ अशधक प्रजाशतयााँ पाई जाती
हैं । (1)
इस अशधक शिशिधता के कारण हैं (कोई दो कारण)
● प्रजाशत का उद्भि सामान्यतः समय का एक कायग है , अतीत में बार-बार
शहमनदीकरण के अधीन रहे समिीतोष्ण क्षेत्रोां के शिपरीत, उष्णकशटबांधीय अक्षाां ि
लाखोां िषों से अपेक्षाकृत अप्रिाशित रहे हैं और इस प्रकार, प्रजाशतयोां के
शिशिधीकरण के शलए एक लांबा शिकासिादी समय रहा है
● उष्णकशटबांधीय िातािरण, समिीतोष्ण िातािरण के शिपरीत, कम मौसमी,
अपेक्षाकृत अशधक स्थथर और पूिाग नुमान योग्य होते हैं । ऐसे स्थथर िातािरण आला
शििेषज्ञता को बढािा दे ते हैं और अशधक प्रजाशत शिशिधता को बढािा दे ते हैं
● उष्णकशटबांधीय क्षेत्रोां में अशधक सौर ऊजाग उपलब्ध है , जो उच्च उत्पादकता में
योगदान दे ती है ; यह बदले में अप्रत्यक्ष रूप से अशधक शिशिधता में योगदान दे
सकती है । (2, कोई दो)

*******

Study Materials
Notes

Model Papers Class 6 Notes

Sample Papers Class 7 Notes
Half Yearly Sample Papers Class 8 Notes

Class 9 Notes
Important Resources
Class 10 Notes
Periodic Table
Class 11 Notes
Writing Skills / Formats

Maps of India / World Class 12 Notes

Books and Solutions

NCERT Books
NCERT Book Solutions
HC Verma Chapter Wise Solutions
RD Sharma Solutions
CGBSE Solutions