Uttarakhand Board Class 12 Sample Paper 2026 Biology

AGLASEM

UBSE
MODEL
Papers
2026

DOWNLOAD

UBSE Sample Question Papers 2026
izfrn”kZ iz”u i=
2025&26
tho foKku ¼lS)kfUrd½
BIOLOGY (THEORY)
le;% 3 ?k.Vs iw.a kkZd % 70
Time: 3 Hours [Max. Marks: 70]

funsZ”k % (i) bl iz”u i= esa dqy 26 iz”u gSaA lHkh iz”u vfuok;Z gSA
Directions : There are in all 26 questions in this question paper. All questions are compulsory.

(ii) iz”uksa gsrq fu/kkZfjr vad muds lEeq[k vafdr gSAa
Marks allotted to the questions are mentioned against them.

(iii) izR;sd iz”u dks /;kuiwoZd if<+;s rFkk leqfpr mÙkj nhft,A
Read each question carefully and answer to the point.

(iv) iz”u la[;k 1 cgqfodYih; iz”u gSA bl iz”u ds mÙkj esa pkj fodYi fn;s x;s gSA lgh fodYi
viuh mÙkj iqfLrdk esa fyf[k,A iz”u la[;k 2 ls 5 rd fuf”pr mÙkjh; iz”u gSA
Question No. 1 is multiple choice question. Four options are given in answer of each part of this
question. Write correct option in your answer book. Question No. 2 to 5 are definite answer type
questions.

(v) iz”u la[;k 1 dk izR;sd [k.M ,d vad dk gSA iz”u la[;k 2 ls 5 rd ,d vad ds iz”u gSA
iz”u la[;k 6 ls 15 rd nks vad ds iz”u gSA iz”u la[;k 16 ls 23 rd rhu vad ds iz”u gSA
iz”u la[;k 24 ls 26 rd pkj vad ds iz”u gS] ftlesa iz”u la[;k 26 dsl@Jksr vk/kkfjr iz”u
gSA
Each part of Question No. 1 carries one mark. Question No. 2 to 5 are of one mark each.
Question No. 6 to 15 are of two marks each. Question No. 16 to 23 are of three marks each.
Question No. 24 to 26 are of four marks each in which question No. 26 is Case/Source based
question.
(vi) bl iz”u i= esa lexz ij dksbZ fodYi ugha gS rFkkfi dfri; iz”uksa esa vkarfjd fodYi iznku
fd;k x;k gSA ,sls iz”uksa esa dsoy ,d fodYi dk gh mÙkj nhft,A
There is no overall choice in this Question paper. However, an internal choice has been
providedin few questions. Attempt only one of the given choices in such question.

1- ¼d½ ;qXed fuekZ.k dh izfØ;k D;k dgykrh gS & 1
What is the process of gamete formatioin called ?

(i) v)Zlw=h foHkktu (ii) lelw=h foHkktu
Meiosis Mitosis

(iii) ;qXedtuu (iv) fu"kspu
Gametogenesis Fertilization

¼[k½ vkrZo pdz ds nkSjku ,d xzkQ ,y ,p Lrj esa “kh’kZ iznf”kZr djrk gSA ;g f”k[kj D;k
iznf”kZr djrk gS \ 1
A graph shows a peak in LH level during the menstrual cycle. What does this peak indicate?

(i) v.MksRlxZ (Ovulation) (ii) jtks/keZ (Menstruation)

(iii) fu’kspu (Fertilization) (iv) vkjks’k.k (Implantation)

¼x½ lef’V vuqofa ”kdh esa gkMÊ osucxZ fl)kUr dk D;k egRo gS \ 1
What is the significance of Hardy-Weinberg principle in population genetics?

(i) ;g vuqoaf”kd mRifjorZu dk iwokZuqeku nsrk gSA
It predicts the frequency of genetic mutation.

(ii) ;g izkd`frd oj.k dh fØz;k fof/k dh O;k[;k djrk gSA
This explain the mechanism of natural selection.

(iii) ;g lef’V dh vuqofa ”kd lajpuk dk o.kZu djrk gSA
It describe the genetic structure of a population.

(iv) ;g vuqoaf”kd fopyu dh nj dk fu/kkZj.k djrk gSA
It determines the rate of genetic drift.

¼?k½ Mh0,u0,0 ds fdlh Hkkx dks izfrfyfi djus dks dgk tkrk gS & 1
Copying of a part of DNA is called.

(i) vuqoknu (Translatioin) (ii) vuqy[
s ku (Transcription)

(iii) izfrd`fr (Replication) (iv) foHkktu (Division)

¼M+½ fuEu~ esa dkSu ,d izdkj dk Vhdk gS & 1
Which of the following is a type of vaccine?

(i) fuf’Ø; Vhdk (ii) thfor {khfrr Vhdk
Inactivated vaccine Live Attenuated vaccine

(iii) lo ;wfuV Vhdk (iv) mijksDr lHkh
Subunit vaccine All above

¼p½ ih0lh0vkj0 ¼ikWfa yejst psu fj,Dlu½ dk eq[; mi;ksx D;k gS\ 1
What is the main use of PCR (Polymerase Chain Reaction) ?
(i) thu fpfdRlk (ii) Mh ,u , vaxqyhNki
Gene therapy DNA Finger print

(iii) Mh ,u , izo/kZu (iv) izksVhu fuekZ.k
DNA Amplification Protein synthesis

¼N+½ chVh dkWaVu dks mi;ksx djus dk lEHkkfor ykHk gS & 1
The potential benefit of using Bt Cotton-

(i) jklk;fud dhVuk”kd dk vf/kd mi;ksx djuk gksxkA
Increased use of chemical pesticides.
(ii) Qly iSnkokj esa deh gksxhA
Reduced crop yields.
(iii) i;kZoj.k izn’w k.k c<sxkA
Incrised environmental pollution.
(iv) jklk;fud dhVuk”kdksa dk mi;ksx de gksxkA
Decreased Pesticides use.

¼t+½ vuqofa ”kd vfHk;kaf=dh ds ek/;e ls ,d Qly dh ubZ fdLe dk fodkl fd;k x;k tks ,d
fof”k’V jksx dkjd dhV ds fy, izfrjks/kh Hkh gSA bl ds D;k laHkkfor ykHk gks ldrs gS& 1
Through genetic engineering, a new variety of a crop that is also resistant to a specific disease
causing pest has been developed. What are the potential benefit of this -

(i) Qly mRiknu esa c<ksRrjhA
Increase in crop production.

(ii) dhVuk”kdksa dk de mi;ksxA
Reduced use of pesticides.

(iii) iks’kdrk esa o`f)A
Increase in nutrition.

(iv) mijksDr lHkhA
Above all.

funsZ”k % iz”u la[;k &1 ds vxys nks [k.Mksa esa ]nks dFkuksa dks vfHkdFku ¼A½ rFkk dkj.k ¼R½ ds :i esa
fpfUgr fd;k x;k gSA fuEufyf[kr fodYiksa 1]2]3 rFkk 4 esa ls pqudj budk lgh mÙkj nhft,A
Directions: In next two part of Question No.- 1, there are two statements labeled as Assertion (A) and Reason
(R). From the following options 1, 2, 3, and 4, select their correct answer.

(i) ¼A½ rFkk ¼R½ nksuksa lgh gS rFkk ¼R½] ¼A½ dh lgh O;k[;k djrk gSA
Both (A) and (R) are correct and (R) is the correct explanation of (A).

(ii) ¼A½ rFkk ¼R½ nksuksa lgh gS rFkk ¼R½] ¼A½ dh lgh O;k[;k ugha djrk gSA
Both (A) and (R) are correct but (R) is not the correct explanation of (A).

(iii) ¼A½lgh gS ijUrq ¼R½ xyr gSA
¼A½Is correct but ¼R½ is incorrect.

(iv) ¼A½ rFkk ¼R½ nksuksa xyr gSA
Both (A) and ¼R½ are wrong.

¼>½ vfHkdFku ¼A½% tSo fodkl ds fy, thu fofo/krk vko”;d gSA 1
Assertion (A): Gene diversity is essential for evolution.
dkj.k ¼R½% thu fofo/krk izkd`frd oj.k ds fy, dPpk eky miyC/k djrh gSA
Reason(R): Gene diversity provide the raw material for natural selection.

¼´½ vfHkdFku ¼A½% tSo fofo/krk laj{k.k ds fy, lajf{kr {ks= vko”;d gSA 1
Assertion (A): Protected Area is essential for biodiversity conservation.
dkj.k ¼R½% lajf{kr {ks= yqIr izk;% iztkfr;ksa ds fy, lqjf{kr vkokl iznku djrs gSA
Reason(R): Protected Area often provide safe habitat for endangered species.

2- vijk ds nks eq[; dk;Z fyf[k,sA 1
Write two main function of placenta.

3- U;wfDy;ksVkbM rFkk U;wfDy;kslkbM esa ,d vUrj fyf[k,sA 1
Write a difference between nucleotide and nucleoside.

4- gkFkh ikWao jksx dk D;k dkjd gS\ 1

What is the cause of elephant foot disease?

5- thu fFkjsih ¼thu fpfdRlk½ D;k gS\ 1
What is gene therapy?

6- ekuo “kqØk.kq dh lajpuk n”kkZrs gq, ,d ukekafdr fp= cukb;sA 2
Draw a labeled diagram showing the structure of human sperm.

vFkok / OR
fyax p;u djrs gq, fd;s tkus okys xHkZikr dh uSfrdrk dk ewY;kdau dhft, vkSj blds
fyaxkuqikr ij izHkko fyf[k,sA
Evaluate the ethics of sex selective abortion and its effect on sex ratio.

7- thu izk:i ¼thuksVkbi½ “kCn dks ifjHkkf’kr dhft,\ 2
Define the term Genotype.

8- E;wVslu¼mRifjorZu½ fdls dgrs gS \ 2
What is a Mutation?

9- Ekkuo LokLF; esa lq/kkj gsrq tSo izkS|ksfxdh dk mi;ksx fdl izdkj fd;k tk ldrk gS\ pkj
fcUnqvksa esa fyf[k,sA 2
How can biotechnology be used to improve human health? Write four points.

10- ,dy dksf”kdk izkVs hu D;k gS \ mnkgj.k nhft,A 2
What is single cell protein? Give example.

11- vuqofa ”kd vfHk;af=dh esa okgd D;k gksrk gS \ mnkgj.k nhft,A 2
What is vector in genetic engineering? Give example.

12- dzkbZ izksVhu D;k gS \ fdlh tho dk uke crkb;s tks bls mRikfnr djrk gSA 2
What is cry protein? Name the organism that produces it.

13- VªkUlQSDlu ¼vfHkdeZd½ D;k gS \ fdlh ,d fof/k dk uke fyf[k,sA 2
What is transfection. Name one of the methods.

14- fuEu~ fp= dks ukekafdr dhft,& 2
Label the diagram below-

15- fdlh LFkku dh ouLifr dks izHkkfor djus okys dksbZ pkj dkjd fyf[k,A 2
Write down any four factors affecting the vegetation of a place.

vFkok / OR

fuEufyf[kr ij laf{kIr fVIi.kh fyf[k,&
Write short notes on the following.

(i) tSo vko/kZu ¼ck;ks eSfXufQdslu½ (ii) jkelj LFky
Biomagnifications Ramsar sites

16- vkrZo pØ D;k gS \ vkrZo pdz dh fofHkUu voLFkkvksa dh O;k[;k dhft,A 3
What is menstrtrual cycle? Explain the different stages of the menstrual cycle.

vFkok /OR

uj rFkk L=h tuu pØ dks fu;af=r djus okys gkeksZu dh O;k[;k dhft,A
Explain the hormones that controle the male and female reproductive cycle.

17- U;kf;d foKku ¼QkSjasfld lkbal½ esa Mh ,u , vaxy
q h Nki ds mi;ksfxrk dh ppkZ djsaA 3
Discuss the utility of DNA fingerprints in forensic science.

18- fuEufyf[kr ij laf{kIr fVIi.kh fyf[k,& 3
Write short notes on the following.

¼d½ lg izHkkfork ¼[k½ lgyXurk ¼x½ eknk fo’ke;qXedrk
Co-dominance Linkage Female heterogamity

vFkok /OR

d`f’k esa vuqoaf”kd :i ls lalksf/kr thoksa ds vuqiz;ksx ij ppkZ djsAa
Discuss the application of Genetically Modified Organisms in Agriculture.

19- fuEufyf[kr ij laf{kIr fVIi.kh fyf[k,& 3
Write short notes on the following.
¼d½ ladj ¼[k½ QhuksVkbi ¼voyksduh; fo”ks’krk½ ¼x½ izkd`frd oj.k
Hybrid Phenotype Natural selection

vFkok / OR
oa”kkoyh fo”ys’k.k ¼isMsxhz ,ukfyfll½ D;k gS\ blesa iz;qDr gksus okys izrhdksa ds ek/;e ls nks
ih<+h iznf”kZr djsAa
What is pedigree analysis? Demonstrate two generation through the symbols used in it.

20- esVkLVsfll dk D;k vFkZ gS\ O;k[;k dhft,A 3

What is metastasis? Explain.

vFkok / OR

,Ydksgy ds dqiz;ksx ls gksus okys izHkkoksa dks fyf[k,sA
Write down the effects of misuse of alcohol.

21- fuEu~ dk laf{kIr o.kZu djsa& 3
Briefly describe the following-

¼d½ tSo la;= ¼ck;ksfj,DVj½ ¼[k½ ih lh vkj ¼x½ izfrcU/ku ,tkbe
Bioreactor PCR Restriction enzyme

vFkok /OR
fuEu~ dk laf{kIr o.kZu djsa&
Briefly describe the following-

¼d½ izfrd`fr;u mnHko ¼[k½ vuqizokg lalk/ku ¼x½ dkbfVust
Origin of replication Downstream Processing Chitinase

22- ikfjLFkfrdh ra= dh fLFkjrk esa vi/kVdksa dh Hkwfedk dk o.kZu djsaA 3
Describe the roll role of decomposers in the stability of ecosystem.

23- vius vkl&ikl ds fdlh ikfjLFkfrdh ra= ds fdlh ladVxzLFk iztkfr ds laj{k.k gsrq lq>ko
iznku djsAa 3
Provide suggestions for the conservation of an endangered species in an ecosystem around you.

24- euq’; esa v.Mk.kq dksf”kdk ds fodkl dks lfEefyr djrs gq, v.Mtuu dh izfØ;k dh O;k[;k
djsAa 4
Explain the process of oogenesis in humans, including the different stages of oocyte development.

vFkok /OR

“kaØk.kqtuu izfd;k D;k gS\ o.kZu dhft,A
What is the process of spermetogenesis? Explain.

25- vuqofa ”kd fopyu ¼tsufs Vd fMª¶V½ dh vo/kkj.kk vkSj tula[;k vuqofa ”kdh ij bl ds izHkko dh
O;k[;k djsAa vius mÙkj dks Li’V djus ds fy, mnkgj.k iznku djsAa 4
Explain the concept of genetic drift and its impact on population genetics. Provide example to
illustrate your answer.
vFkok /OR

Mh ,u , rFkk vkj ,u , dh lajpuk vkSj dk;ksZ lfgr oa”kkuqdze ds vkk.kfod vk/kkj ij ppkZ
djsAa
Discuss the molecular basis of inheritance including the structure and function of DNA and RNA.
26- fuEufyf[kr vuqPNsn dks /;kuiwoZd if<+, rFkk ml ds uhps fn;s x, iz”uksa ds mRrj fyf[k,&
Read the following passage carefully and answer the question given below-

Vhdkdj.k dk;Zdze nqfu;kHkj esa ladzked jksxksa dks fu;af=r djus vkSj jksdus esa izHkkoh jgs
gSA Vhdkdj.k dk;Zdzeksa ds dkj.k oSDlhu jksdFkke ;ksX; chekfj;ksa dh /kVukvksa esa mYys[kuh;

fxjkoV vkbZ gSA tc vkcknh ds i;kZIr izfr”kr dks Vhdk yxk;k tkrk gS] rks ;g ,d vojks/k
iSnk djrk gSA tks chekfj;ksa ds QSyko dks jksdrk gSA Vhdkdj.k dk;Zdzeksa us ladzked jksxksa ls
gksus okyh ekSrksa dks jksd dj nqfu;k Hkj esa yk[kksa yksxksa dh tku cpkbZ gSA Vhdkdj.k dk;Zdze
ykxr izHkkoh gS tks oSDlhu jksdFkke ;ksX; chekfj;ksa ds bykt ls tqM+h LokLF; ns[kHkky ykxr
dks de djrs gSA chekfj;ksa dks jksddj Vhdkdj.k dk;Zdze dk;Zry mRikndrk cuk, j[kus vkSj
vkfFkZd uqdlku dks de djus esa enn djrs gSA xyr lwpuk vkSj Vhds dh f>>d ls Vhdkdj.k
nj de gks ldrh gS vkSj oSDlhu jksdFkke ;ksX; chekfj;ksa dk izdksi gks ldrk gSA fo”ks’k :i ls

de vk; okys ns”kksa esa Vhdksa rd leku igqWp
a lqfuf”pr djuk ,d egRoiw.kZ pqukSrh cuh gqbZ gSA
u;s Vhdksa dk fujarj vuqla/kku vkSj fodkl egRoiw.kZ gSA

Vaccination programs have been highly effective in controlling and preventing infectious
disease worldwide. Vaccination program have led to a significant decline in the incidence of
vaccine-preventable disease. When a sufficient percentage of population is vaccinated it creates a
barrier that prevents the spread of disease. Vaccination programs have saved millions of lives
worldwide by preventing deaths from infectious diseases. Vaccination program are cost effective,
reducing health care costs associated with treating vaccine-preventable disease. By preventing
illness, vaccination programs help maintain work force productivity and reduced economic losses.
Misinformation and vaccine hesitancy can lead to reduced vaccination rates and out breaks of
vaccine preventable diseases. Ensuring equitable access to vaccine, particularly in low-income
countries remains a significant challenge. Continued research and development of new vaccines
are crucial.

¼d½ Vhdkdj.k dk;ZØe ds eq[; ykHk D;k gS\ 1
What are the main benefits of the vaccination program?

¼[k½ Vhdkdj.k dk;ZØe ls D;k ifj.kke gksrk gS\ 1
What is the result of vaccination?

¼x½ Vhdkdj.k dk;ZØe vkfFkZd :I ls dSls ykHkdkjh gS\ 1
How is vaccination program economically beneficial?

¼?k½ Vhdkdj.k dk;ZØe dh lcls cM+h pqukSrh D;k gS\ 1
What is the biggest challenge to the vaccination program?

izfrn'kZ iz'ui= 2025&2026
d{kk & 12
tho foKku ¼lS)kafrd½
BIOLOGY (THEORY)
le; % 3%00 ?k.Vs iw.kkZd % 70
Time : 3 Hours (Max Marks : 70)

funsZ'k % (i) bl iz'u&i= esa dqy 26 iz'u gSAa lHkh iz'u vfuok;Z gSaA

Directions : There are in all 26 questions in this question paper. All questions

are compulsory.

(ii) iz'uksa gsrq fu/kkZfjr vad muds lEeq[k vafdr gSaA

Marks allotted to the questions are mentioned against them.

(iii) izR;sd iz'u dks /;kuiwoZd if<+;s rFkk leqfpr mRrj nhft,A

Read each question carefully and answer to the point.

(iv) iz'u la[;k 1 cgqfodYih; iz'u gSaA bl iz'u ds izR;sd [k.M ds mÙkj esa pkj fodYi fn;s x, gSAa
lgh fodYi viuh mÙkjiqfLrdk esa fyf[k,A iz'u la[;k 2 ls 5 rd fuf'pr mÙkjh; iz'u gSAa
Question No.1 is multiple choice question. Four options are given in answer

of each part of this question. Write correct option in your answer book.

Question No. 2 to 5 are definite answer type questions.

(v) iz'u la[;k 1 dk izR;sd [k.M ,d vad dk gSA iz'u la[;k 2 ls 5 rd ,d vad ds iz'u gSAa iz'u
la[;k 6 ls 15 rd nks vad ds iz'u gSAa iz'u la[;k 16 ls 23 rd rhu vad ds iz'u gSaA iz'u
la[;k 24 ls 26 rd pkj vad ds iz'u gSa] ftlls iz'u la[;k 26 dsl@lzkrs vk/kkfjr iz'u gSaA
Each part of Question No. 1 carries one mark. Question No. 2 to 5 are of

one mark each. Question No. 6 to 15 are of two marks each. Question No.

16 to 23 are of three marks each. Question No. 24 to 26 are of four marks

each, in which Question No. 26 is Case/Source based question.

(vi) bl iz'u&i= esa lexz ij dksbZ fodYi ugha gS rFkkfi dfri; iz'uksa esa vkarfjd fodYi iznku fd;k
x;k gSA ,sls iz'uksa esa dsoy ,d fodYi dk gh mÙkj nhft,A

There is no overall choice in this question paper, however, an internal

choice has been provided in few questions. Attempt only one of the given

choices in such questions.

1- ¼d½ ijkxd.k dh ckâ; fHkfRr curh gS & 1
The outer wall of pollengrain is formed by :

(i) lsY;qykst }kjk (ii) Liksjksiksyfs uu }kjk

Cellulose Sporopollenin

(iii) isDVks lsY;qykst }kjk (iv) fyfXuu }kjk

Pecto cellulose Lignin

¼[k½ fuEufyf[kr esa ls dkSu ih lh vkj vfHkfØ;k dk ?kVd ugha gS\ 1
Which of the following is not a component of PCR reaction :

(i) Mh ,u , ikWfyejst (ii) izkbej

DNA Polymerase Primer

(iii) Vksiks vkblksejst (iv) VSd ikWfyejst

Topoisomerase Taq Polymerase

¼x½ fLol pht ds mRiknu esa fdl lw{etho dk mi;ksx fd;k tkrk gS\ 1
Which microbe is used in the production of Swiss Cheese?

(i) isuhlhfy;e uksVVs e (ii) lSdjksekblht

Penicillium notatum Saccharomyces

(iii) izkfs ivksfucSDVhfj;e 'kkjeSukbZ (iv) ,Lijftyl ukbxj

Propionibacterium Shermanii Aspergillus niger

¼?k½ vuqoknu dh izfØ;k esa fuEufyf[kr esa ls dkSu lk vkj-,u-, ugha gksrk gSA 1
Which of the following RNA is not involved in translation:

(i) nwr vkj ,u , (ii) jkbckslksey vkj ,u ,

mRNA rRNA

¼(iii) varj.k vkj ,u , (iv) NksVk dsUnzdh vkj ,u ,

tRNA snRNA

¼³½ fuEufyf[kr esa ls dkSu lk jksx ?kjsyw eD[kh }kjk QSyrk gS\ 1
Which one of the following disease is spread by housefly :

(i) Max
s w (ii) Qkbysfj;k (iii) vehcrk (iv) ,sLdsfjlrk

Dengue Filariasis Amoebiasis Ascariasis

¼p½ fuEufyf[kr LrEHkks dk feyku djsa %& 1
Match the following columns :

LraHk(Column I) LraHk(Column II)

eknk tuu Hkkx (Female Reproductive Parts) lanHkZ (Related to)

A. v.Mk'k;(Ovaries) 1- fu"kspu(Fertilisation)

B. fMacokfguh (Oviduct) 2- vaMksRlxZ(Ovulation)

C. xHkkZ'k;(Uterus) 3- xHkkZoLFkk(Pregnancy)

D. xzhok(Cervix) 4- f'k'kq&tUe(Child birth)

Codes :

A B C D
(i) 2 1 3 4
(ii) 1 2 3 4
(iii) 4 3 1 2
(iv) 2 3 4 1
¼N½ XO izdkj dk fyax fu/kkZj.k ik;k tkrk gS & 1

XO type of sex determination is found in :

(i) gkFkh (ii) euq"; (iii) dqRrk (iv) fVM~Mk

Elephant Human Being Dog Grasshopper

¼t½ [kk| J`a[kyk esa izkFkfed tho D;k gS\ 1
What is the primary organism in the food chain?

(i) 'kh"kZ miHkksDrk (ii) f}rh; miHkksDrk

Top Consumer Second Consumer

(iii) izFke miHkksDrk (iv) izdk'k la'ys"kd

First Consumer Photosynthetic

funsZ'k % iz'u la[;k&1 ds vxys nks [k.Mks esa] nks dFkuksa dks vfHkdFku ¼A½ rFkk dkj.k ¼R½ ds :i esa fpfUgr
fd;k x;k gSA fuEufyf[kr fodYiksa ¼i½] ¼ii½] ¼iii½ rFkk ¼iv½ esa ls pqudj budk lgh mRrj nhft,A
Direction : In next two parts of Questions No.-1, there are two statements labelled as

Assertion (A) and Reason (R) From the following options (i), (ii), (iii) and (iv),

select their correct answer.

(i) A rFkk R nksuksa lgh gSa rFkk R, A dh lgh O;k[;k djrk gSA

Both A and R are correct and R is the correct explanation of A.

(ii) A rFkk R nksuksa lgh gS ijUrq R, A dh lgh O;k[;k ugha djrk gSA

Both A and R are correct but R is not the correct explanation of A.

(iii) A lgh gS ijUrq R xyr gSA

A is correct but R is incorrect.

(iv) ArFkk R nksuksa xyr gSaA

Both A and R are incorrect.

¼>½ vfHkdFku(A) % VkbQkbM jksx lkyeksuyk VkbQh thok.kq ds dkj.k gksrk gS &

dkj.k(R) % VkbQkbM jksx dsoy nwf"kr ikuh ds lsou ls QSyrk gSA 1

Assertion (A) : Typhoid is caused by the bacteria Salmonella typhi.

Reason (R) : Typhoid spreads only through the consumption of

contaminated water.

¼¥½ vfHkdFku(A) % tSy oS|qr d.k lapyu esa Mh ,u , [kaM vyx fy, tkrs gSA

dkj.k(R) % Mh ,u , _.kkRed vkosf'kr gksrk gS] blfy, ;g fo|qr {ks= ds vUrxZr
,uksM dh vksj xfr djrk gSA 1

Assertion (A) : In gel electrophoresis; DNA fragments are separated.

Reason (R) : DNA is negatively charged, so it moves towards anode under

electric field.

2- ySd&vksijs kWu ekWMy fdl oSKkfud us izLrqr fd;k Fkk\ 1
Which scientist presented the Lac Operon model?

3- igyk izfrca/kd ,atkbe fdl thok.kq ls vyx fd;k x;k Fkk\ 1
The first restriction enzyme was isolated from which bacteria?

4- fpfdRldh; lxHkZrk lekiu dks dkuwuh Lohd`fr iznku fdl o"kZ nh x;h Fkh\ 1
In which year was medical termination of pregnancy legally approved?

5- ;fn gjs ikS/ks 300 twy ÅtkZ xzg.k djrs gSa rks r`rh; miHkksDrk fdruh ÅtkZ xzg.k djsxk\ 1
If green plants absorb 300 joules of energy then how much energy the third

consumer will absorb?

6- 'kqØk.kq dk ,d ukekafdr vkjs[k cuk,aA 2
Draw a labelled diagram of sperm.

7- fuEu 'kCnksa dks mnkgj.k lfgr le>kb;sA 2
¼v½ lg izHkkfork ¼c½ viw.kZ izHkkfork
Explain the following terms with example :

(a) Co-dominance (b) Incomplete dominance

8- fuEu dk iwjk :i crkb, & 2
State the full form of the following :

¼v½ ,e , ,y Vh ¼c½ lh ,e vkbZ ¼l½ ,M~l ¼n½ ,u , lh vks
MALT CMI AIDS NACO
9- iqu;ksZxt Mh ,u , rduhd esa oj.k ;ksX; fpUgd dk egRo D;k gS\ 2
What is the importance of a selectable marker in recombination DNA technology?

10- fo'o ds dqN {ks=ksa dks tSo fofo/krk gkWLikWV ?kksf"kr fd;k x;k gSA budk egRo D;k gS\ 2
Some regions of the world are declared Biodiversity Hot spots. What is their

significance? 2

11- uhps fn, x, fp= esa thok.kq dksf'kdk fn[kkbZ xbZ gSA ^A* vkSj ^B* dks ukekafdr dhft,A lkFk gh] iqu;ksZxt

Mh ,u , rduhd esa Hkkx ^A* ds mi;ksx dk Hkh mYys[k dhft,A

Bacterial cell is shown in the figure given below. 2

Label the part 'A' and 'B', also mention the use of part 'A' in recombination DNA

technology.

12- 'kqØtud ufydk ds fp= esa A, B, C vkSj D dks ukekafdr dhft,A 2

Name the labels A, B, C, & D in the diagram of seminiferous tuble.

13- fuEufyf[kr mRNA LVªSM
a dk dksfMax vuqØe fy[ksAa 2

Write the coding sequence of the following mRNA strand.

5'AAUGUUAGAGAGUAGGGAAU3'

14- rkack ekspd vkbZ ;w Mh dk uke crkb,A nks dkj.k crkb,] tks mUgsa izHkkoh xHkZfujks/kd cukrs gSAa 2
Name any to copper-releasing IUDs. List two reasons that make them effective

contraceptives.

OR

tuu xzafFk dks gVkuk xHkZ fujks/kdksa dk fodYi ugha ekuk tk ldrk gS\ D;ksa\ 2

Removal of gonads cannot be considered as a contraceptive option. Why?

15- ,d d`f=e oSDVj cuk,a vkSj fuEufyf[kr dks n'kkZb, & 2
¼v½ nks lgh fcnyu LFky
¼c½ jksi

Draw an artificial vector and label the following :

(a) Two correct cleavage sites

(b) rop

OR

fo"kk.kq eqDr ikni rS;kj djus ds fy, ikni dk dkSu lk Hkkx lcls vf/kd mi;qDr gS rFkk D;ksa\ 2
Which part of the plant is best suited for making virus-free plants and why?

16- vaMk'k; ds vuqHkkxh; n`'; dk ,d ukekafdr fp= cuk,a] ftlesa iqVd ds pj.kksa dks n'kkZ;k x;k gksA 3
Draw a labelled diagram of a sectional view of the human female ovary, showing

various stages of follicle.

17- Mh-,u-,- vaxqfyNkih D;k gS\ blds mi;ksfxrk crkb,A 3
What is DNA finger printing? Describe its application.

OR

f'k'kq dk :f/kj oxZ ^O* gSA firk dk :f/kj oxZ ^A* vkSj ekrk dk :f/kj oxZ ^B* gSA tudksa ds thuksVkbi
irk djsa vkSj vU; larfr esa izR;kf'kr thuksVkbiksa dh tkudkjh izkIr djsaA 3
A child has blood group 'O'. If the father has blood group 'A' and mother blood

group 'B', work out the genotypes of the parents and the possible genotype of the

other offerings.

18- ØkbZ izkVs hal D;k gS\ ml tho dk uke crkb, tks bls iSnk djrk gSA euq"; bl izksVhu dks vius Qk;ns ds
fy, dSls mi;ksx esa ykrk gS\ 3
What are cry proteins? Name an organism that produce it. How has man exploited

this protein in his benefit?

OR

la{ksi esa crkb, & 3
Explain briefly :

¼v½ ifrd`rh;u dk mn~Hko Origin of replication

¼c½ ck;ksfj,DVj Bioreactors

¼l½ vuqizokg lalk/ku Downstream processing

19- fuEufyf[kr dh ifjHkk"kk nhft, vkSj izR;sd dk ,d&,d mnkgj.k nhft,& 3
Define the following terms and give one example for each:

¼v½ lgHkksftrk ¼c½ lgksidkfjrk ¼l½ Nn~ekoj.k
Commensolism Mutualism Camouflage

20- ,d fd'kksj yM+ds esa eknd inkFkksZa ds lsou dh vknr fodflr gks jgh gSA bl leL;k ds laHkkfor dkj.k
vkSj lekt ij blds izHkkoksa dk fo'ys"k.k dhft,A 3
A teenage boy developing a drug addiction. Analyze the possible causes of this

problem and its impact on society.

21- ¼d½ euq"; esa fyax fu/kkZj.k dh O;k[;k djsaA 3
¼[k½ XXY vlekU;rk okys uj euq"; dSls ihfM+r gksrs gSa\

(a) Explain sex determination in Humans.

(b) How do human males with XXY abnormality suffer?

OR

¼d½ fp= dh lgk;rk ls DNA izfrd`fr dh izfØ;k dh O;k[;k djsaA 3
¼[k½ ;wdfs j;ksV~l esa dkssf'kdk pØ dh dkSu lh voLFkk esa izfrd`fr gksrh gS\
(a) Explain the process of DNA replication with the help of a schematic

diagram.

(b) In which phase of the cell cycle does replication occur in Eukaryotes?

22- fp= }kjk Li"V djsa fd vuqdwyh fofdj.k us MkfoZu ds fQap if{k;ksa ds fodkl esa dSls ;ksxnku fn;k\ 3
Explain with the help of diagram, how adaptive radiation contributed to the

evolution of Darwin's finches.

OR

vilkjh ,oa vfHklkjh fodkl D;k gS\ o.kZu dhft,A 3

Describe, what is divergent and convergent evolution?

23- ifo= miou D;k gS\ mudh laj{k.k esa D;k Hkwfedk gS\ 3
What are sacred groves? What is their role in conservation?

24 Mh ,u , vkuqoaf'kd inkFkZ gS bls fl) djus ds fy, g'ksZ vkSj pst ds iz;ksx dk mnkgj.k nsaA 4
Analyze the experimented proof that DNA is the genetic material, citing the

Hershey and Chase experiment.

OR

cSaxuh Qwyksa okys ,d eVj ds ikS/ks dks lQsn Qwyksa okys ikS/ks ds lkFk ladj.k fd;k x;kA larfr esa dsoy
cSaxuh Qwy gh mRiUu gq,A Lo&la;kstu ij] bu ikS/kksa ls cSx
a uh Qwyks okys 482 ikS/ks vkSj lQsn Qwyksa okys
162 ikS/ks mRiUu gq,A bu ifj.kkeksa ds fy, dkSu lh vkuqokaf'kd fØ;kfof/k ftEesnkj gS\ O;k[;k dhft,A4
A Pea plant with purple flowers was crossed with plant having white flowers. The

progeny produced only purple flowers. On selfing, these plants pronounced 482

plants with purple flowers and 162 plants with white flowers. What genetic

mechanisms accounts for these results? Explain.

25- f}fus"kspu dh izfØ;k dk fooj.k nhft, rFkk ;g ikS/kksa ds fodkloknh n`f"Vdks.k ls D;ksa egRoiw.kZ gS\ 4
Describe the process of double fertilization and explain why it is significant from

one evolutionary perspective in plants?

OR

(a) Draw a diagram of an enlarged view of T.S. one microsperangium of an

angiosperm and label the following parts.

(i) Tapetum (ii) Middle layer

(iii) Endothecium (iv) Microspore mother cells

(b) Mention the function of Tapetum

(c) Explain the pollen tablets are in use by people these days.

¼v½ ,d vko`rchth ikS/ks dh y?kqchtk.kq/kkuh dk foLrkfjr fp= cukb, vkSj fuEufyf[kr Hkkxksa dks

ukekafdr djsa %&
¼d½ VSfiVe ¼[k½ e/; ijr
¼x½ vUrLFkhfl;e ¼?k½ y?kqchtk.kqekr`dksf'kdk
¼c½ VsfiVe ds dk;ksZa dk mYys[k djsa

¼l½ vktdy yksx ijkx xksfy;ksa dk iz;ksx dj jgs gSaA Li"V dhft,A
26. Case Study.

fn;s x;s x|ka'k dks /;kuiwoZd i<+dj fn;s x;s iz'uksa ds mRrj nhft,A
Read the following text carefully and answer the questions that follow : 4

lapkjh jksx %&
fj;k ,d ljdkjh Ldwy esa NBh d{kk esa i<+rh gSA og ,d fiNM+s ifjokj ls gS vkSj mlds ekrk&firk us
Vhdkdj.k dk;ZØe ds vuqlkj mldk Vhdkdj.k Bhd ls ugha djok;k FkkA ,d ckj Ldwy ds [ksy ds eSnku
esa [ksyrs le; og det+kjs h ds dkj.k fxj iM+h vkSj mls rst+ cq[kkj] fljnnZ vkSj xnZu esa vdM+u gks xbZA
mls dkSulh chekjh gks ldrh gS] bldh igpku dhft, vkSj fuEufyf[kr iz'uksa ds mRrj nhft,A
Communicable disease :-

Riya studies in VIth standard in a government school. She belongs to a backward

family and her parents did not get her properly vaccinated according to

immunisation programme. Once while playing in school playground she fell down

due to weakness and developed high fever; headache and stiffness in her neck.

Identify the illness she could be suffering from and answer the following questions.

Q.(i) fj;k dh chekjh ds fy, ftEesnkj lw{e tho gks ldrk gS%

The microbe responsible for Riya's illness could be:

(a) fofcz;ks dksyjs k (b) IykTeksfM;e

Vibrio cholerae Plasmodium

(c) ,aVjksok;jl (d) ekbdkscSDVhfj;e

Enterovirus Mycobacterium

Q.(ii) dkSu lk Vhdk] ;fn igys yxk;k tkrk] rks fj;k dks nqHkkZX;o'k gq;h chekjh ls cpk;k tk ldrk

Fkk\
Which vaccine, if administered earlier, would have saved Riya from the

illness she unfortunately contracted?

(a) lkYd Vhdk (b) oSjhlsyk Vhdk

Salk vaccine Varicella vaccine

(c) ,e,evkj Vhdk (d) chlhth Vhdk

MMR vaccine BCG vaccine

Q.(iii) fj;ksdks tks chekjh gqbZ gS og fdlds ek/;e ls QSyrh gS\

The disease that Riya has contracted spreads through:

(a) laØfer ePNj ds dkVus ls (b) laØfer dqRrs ds dkVus

bite of an infected mosquito bite of an infected dog

(c) ey&ekSf[kd ekxZ (d) laØfer O;fDr ds lkFk lh/kk lEidZ

faecal oral route direct contact with the infected

person

Q.4. fj;k viuh chekjh vU; cPpksa esa fdlds ek/;e ls QSyk ldrh gS\

Riya can spread her illness to other children through:

(a) mldk ey (b) lh/kk leidZ

her faeces direct contact

(c) [kqys esa [kkaluk vkSj Nhaduk (d) oSDVj

coughing and sneezing in open vectors

AglaSem Earn while Learn Program. Send your papers and get paid.
Contact: support@

AglaSem Earn While You Learn Program!

Share your recent question papers with us and get paid!
अपने हाल के न प हम भेज और कमाएँ!

To participate, email us with the following details:
भाग लेने के लए हम न न ववरण के साथ ईमेल कर:

- Your Name
- Your Class
- Your Board
- Details of the Question Papers you have
आपके पास उपल ध न प का ववरण

Our team will reach out to you with the next steps.
हमार ट म आगे क या के लए आपसे संपक करे गी।

Email: support@

Study Materials
Notes

Model Papers Class 6 Notes

Sample Papers Class 7 Notes
Half Yearly Sample Papers Class 8 Notes

Class 9 Notes
Important Resources
Class 10 Notes
Periodic Table
Class 11 Notes
Writing Skills / Formats

Maps of India / World Class 12 Notes

Books and Solutions

NCERT Books
NCERT Book Solutions
HC Verma Chapter Wise Solutions
RD Sharma Solutions
CGBSE Solutions